Evolution of the Mycobacterium tuberculosis complex! or what have we learned on this subject since the publication of the! M. tuberculosis H37Rv genome! Roland Brosch! Integrated! Mycobacterial! Pathogenomics! Institut Pasteur!
mycobacteria M. fortuitum ATCC49403! M. fortuitum! M. senegalense! M. fortuitum ATCC49404! M. peregrinum! M. aichiense! M. gilvum! M. mucogenicum! M. mucogenicum! Mycobacterium M. neoaurum! M. diernhofer! M. obuense! M. chubuense! M. aurum! M. fallax! M. chelonae! M. abscessus! M. chitae! M. confluentis! M. madagascariense! M. vaccae! M. phlei! MCRO17! M. flavescens! M. smegmatis! MCRO10! M. chromogenicum! MCRO7! M. thermoresistible! M. gadium! Slow growing mycobacteria! http://wwwabi.snv.jussieu.fr/~erocha/research/ordervsdisorder.html
M. fortuitum! M. peregrinum! M. triviale! M. simiae! M. genavense! MCRO18! MCRO19! M. interjectum! M. intermedium! M. terrae! M. hiberniae! M. nonchromogenicum! MCRO6! M. cookii! M. celatum! M. xenopi! M. shimoidei! M. asiaticum! M. gordonae! M. marinum! M. ulcerans! M. tuberculosis Complex! M. leprae! M. szulgai! M. malmoense! M. haemophilum! M. gastri/ kansasii! M. scrofulaceum! M. paraffinicum! M. intracellulare! M. avium! slowly growing mycobacteria.! fish pathog & human opportun. pathogen! aquatic mycobacterium,! etiological agent of Buruli ulcer! aquatic mycobacterium,! produces mycolactone! M. tuberculosis! M. canettii! M. africanum! M. microti! M. pinnipedii! M. bovis! M. bov. BCG! etiological agent of leprosy! reductive evolution! 16S rrna tree - Springer et al., J. Clin. Microbiol., (1996)! Johneʼs disease
What are the molecular determinants for the evolutionary success of M. tuberculosis as a human pathogen?!
Genome of M. tuberculosis H37Rv!!!!!! 4,4 Mb GC 65.6% 4000 genes! genes for aerobic, micro-aerophilic and anaerobic! abundance of genes involved in lipid metabolism! eukaryotic like Serine/Threonine Protein Kinases! 1998 novel gene/protein families e.g. PE/PPE, ESAT-6,! Cole ST, Brosch R, Parkhill J, et al.,! (1998), Nature 393, 537-544.!
Comparative genomics between different species! To extract the biological information from genome sequence data! M. tuberculosis H37Rv! Comparison! M. marinum! Based 16S rrna genetically similar! other species! allows insights into the more distant events!
Genome of M. marinum! genome size! G+C! 6.6 Mb! 65.7 %! (M. tub.)! (4.4 Mb)! (65.6 %)! protein encoding genes! orthologs in both genoms! 5424! (3,974)! 3066! Pseudogenes! 65! (17)! 2008 Stinear et al., (2008), Genome Res.!
Identification of ~ 600 M. tuberculosis - specific CDS! Mycobacterial core genome (not including M. leprae) ~ 2500 genes At least 80 regions containing 600 genes seem to have been gained by the ancestor of M. tuberculosis through horizontal gene transfer during its more distant evolution (soil?) Stinear et al., (2008), Genome Res.!
M. tuberculosis-specific CDS Many encode known virulence factors sulfolipid locus virs locus pilin gene fumarate reductase locus (Rv1552-55)
? possible early evolution of M. tuberculosis Gordon et al., (2009), Bioessays!
Comparative genomics within the tubercle bacilli! Comparison! M. tuberculosis H37Rv! M. bovis BCG! genetically very similar! but attenuated! the more recent events! other tubercle bacilli! 20 Regions of Difference (RD) described! Gordon et al., 1999 Mol Micro; Behr et al., 1999 Science;!
Comparative genomics identifies! Regions of Difference (RD)! Example of RD9! RD region! RD flanking primers! RD flanking primers! M. canettii! M. tuberculosis! M. africanum! M. microti! M. pinnipedii! M. bovis! BCG! RD flanking primers!
RD9! M. tuberculosis! sigc! 2325 kb! 2329 kb! Rv2074! 2333 kb! cobl! Rv2075c! Rv2067c! blac! cobk! cobm! Rv2073c! 2325 kb! sigc! RD9 region! sequence conservation! 2329 kb! present in all tested M. tuberculosis strains! cobl! Rv2067c! blac! cobk! of the RD9 junction region! in different subspecies! AAATTACTGTGGCCCTGCGC...!.GGTGGCACGCCGGGCCGG! Rv2074! 2333 kb! Rv2075c! Rv2073c! AAATTACTGTGGCCCACGCCGGGCCGG! M. africanum! M. microti! M. bovis! BCG!
Comparative genomics identifies! M. tuberculosis deletion region 1 (TbD1)! TbD flanking primers! TbD region! TbD flanking primers! M. canettii! M. tuberculosis! M. africanum! M. microti! M. pinnipedii! M. bovis! BCG! TbD flanking primers! TbD1= M. tuberculosis deletion region 1!
Region TbD1 absent from many M. tuberculosis strains! M. bovis! M. africanum! M. microti! BCG! ancestral M. tub.! M. tuberculosis H37Rv,! M. tuberculosis CDC1551,! M. tuberculosis Beijing 210! M. tuberculosis C! M. tuberculosis F11!
Deletion events and the M. tuberculosis complex! most junction regions of RDs are located within genes! deletion events --> not insertion events! conserved deletions! among members of the M. tuberculosis complex! most probably occurred! in a common progenitor strain!
M. tuberculosis! Evolutionary pathway of the M. tuberculosis complex! Numerous sequence! polymorphisms! RD can! M. canettii! ancestral, gr.1, SE Asian! Common ancestor of the! M. tuberculosis complex! RD 9! TbD 1! RD 7! RD 8! RD 10! katg c463 CTG CGG! gyra c95 ACC AGC! e.g. gr.1, Beijing! e.g. gr.2, CDC1551! e.g. gr.3, H37Rv! modern! M. africanum! highly clonal population structure! perfect correlation of RDs with SNPs! (and resistance to pyrazinamide)! mmpl6 551 AAC AAG! oxyr n285 G A! RD mic! RD 12! RD 13! RD seal! M. microti! M. pinnipedii (seal)! oryx! no recent horizontal gene transfer! detectable! Brosch et al. 2002, PNAS 99:3684-9.! pnca c57 CAC GAC! RD 4! RD 1! RD 2! goat-m. caprae! classical! BCG Tokyo! M. bovis! Mostowy S et al. 2002, J Infect Dis 186:74-80.! RD 14! BCG Pasteur!
.. confirmed by genome analysis of M. bovis! M. tuberculosis H37Rv!!4,411,532 bp! M. tuberculosis CDC1551!4,403,836 bp! M. bovis AF2122/97!!4,345,492 bp! Single Nucleotide Polymorphisms! M. tub. H37Rv! 1135! M. tub. CDC1551! 2348! 2380! M. bovis!
M. bovis phylogeny! based on SNPs! Garcia Pelayo et al., Infect. Immun., 2009
M. tuberculosis! Focus on the M. tuberculosis cluster! Numerous sequence! polymorphisms! RD can! M. canettii! ancestral, gr.1, SE Asian! Common ancestor of the! M. tuberculosis complex! RD 9! TbD 1! RD 7! RD 8! RD 10! katg c463 CTG CGG! gyra c95 ACC AGC! e.g. gr.1, Beijing! e.g. gr.2, CDC1551! e.g. gr.3, H37Rv! modern! M. africanum! mmpl6 551 AAC AAG! RD mic! RD seal! M. microti! oxyr n285 G A! M. pinnipedii (seal)! RD 12! RD 13! oryx! Brosch et al. 2002, Proc Natl Acad Sci U S A. 99:3684-9.! pnca c57 CAC GAC! RD 4! RD 1! RD 2! RD 14! goat-m. caprae! classical! BCG Tokyo! BCG Pasteur! M. bovis!
Spoligotyping (Spacer-Oligo-Typing) Direct Repeat (DR) region in the genome of
Ancestral M. tub.! katg 463 group 1! region TbD1 present,! spacer 33 present! M. tub. Beijing family! katg 463 group 1! region TbD1 absent! spacers 1-34 deleted! M. tub. katg 463 group 2 or 3! region TbD1 absent! spacers 33-36 deleted! M. bovis! RD7-13 deleted,! spacers 39-43 deleted! after Kremer et al., J. Clin. Microb., 1998!
Example of strains isolated in Bangladesh! Signature! ancestral M. tub.! TbD1 present,! gr.1, katg, CTG! spacer 33 present! TbD1 absent! Delhi family,! gr.1, katg, CTG! Spacers 23-34 deleted! Beijing family,! gr.1, katg, CTG! Spacers 1-34 deleted! M. tub.,! gr. 2 or 3, katg, CGG! Spacers 33-36 deleted! Banu et al., J. Clin. Microb., 2004!
The oldest cas of human tuberculosis known in Britain (Iron age)! 2,200 years ago! --> TbD1 region deleted --> modern M. tuberculosis! Tb Tb Tayloret al., J Clin Microbiol, 2005!
RD-analyses (LSP) allowed to reveal stable association between strains of M. tuberculosis and their human host populations /geographical distribution Hirsh et al. 2004, PNAS! Gagneux et al. 2006, PNAS!
Strict correlation! of RDs and SNPs! Baker et al., 2004 Gutacker et al., 2006 Filliol et al., 2006 after Gagneux & Small., Lancet Infect Dis., 2007!
Broad diversity! of worldwide! M. tuberculosis! Strains! Multi-Locus-Sequence-Ananlysis! (MLST) based on 89 concatenated! gene sequences for 108 strains! after Hershberg et al., PLoS Biol., 2008!
M. tuberculosis! Focus on M. canetti! RD can! M. canettii! ancestral, gr.1, SE Asian! Common ancestor of the! M. tuberculosis complex! RD 9! TbD 1! RD 7! RD 8! RD 10! katg c463 CTG CGG! gyra c95 ACC AGC! e.g. gr.1, Beijing! e.g. gr.2, CDC1551! e.g. gr.3, H37Rv! modern! M. africanum! mmpl6 551 AAC AAG! RD mic! RD seal! M. microti! oxyr n285 G A! M. pinnipedii (seal)! RD 12! RD 13! oryx! Brosch et al. 2002, Proc Natl Acad Sci U S A. 99:3684-9.! pnca c57 CAC GAC! RD 4! RD 1! RD 2! RD 14! goat-m. caprae! classical! BCG Tokyo! BCG Pasteur! M. bovis!
Mycobacterium canettii and smooth tubercle bacilli! ~ 60 clinical isolates with! smooth colony morphology! Georges Canetti! Smooth tubercle bacilli! from tuberculosis patients! in Djibouti / East Africa! 14 lineages according to molecular! typing characteristics (lineages A-N)! M. tuberculosis! Synonymous SNP 10-50 x higher than! in the classical M. tuberculosis complex!
In some of these strains the DR region (groups E, G, H, and I), or IS1081 are missing (groups E, F); Most of the contain ISMyca1, an IS specific of M. canettii in several copies. Almost all show the RD12can deletion
Minor variation of 16S rrna sequence M. tub.h37rv M. tub. E M. afr. F A B G C H D I
Clear evidence of horizontal transfer among smooth tubercle bacilli gyrb gyra hsp65 rpob katg soda Gutierrez et al., 2005, PLoS Pathog.!
High genetic diversity of M. proto-tuberculosis strains Classical Mtb complex M. proto-tuberculosis 140060008= pulmonary TB! 140070008= lymph node TB! 140070010= cutaneous TB! 140070017= lymph node TB! 4 M. proto-tuberculosis! strains presently sequenced! at the Génoscope in Evry,! in collaboration with! Philip SUPPLY, IP Lille! 1 M. canettii strain sequenced! at the Sanger Institute! Whole genome restriction profiles XbaI
Sequenced at the Génoscope (IPL/IPP)! Sequenced at the Sanger Institute! Phylogenetic distance! of the 14 lineages (A-N)! Classical M. tub. complex! Smooth strains! B A C, D J F L E I H G M N K 56 smooth and 10 MTBC strains, 12 House Keeping Genes! Brisse et al. unpublished
Genome sizes of M. prototuberculosis strains! M. prototub. A! M. canetti 140010059! M. prototub. D! 140060008! M. prototub. L! 140070008! M. prototub. K! 140070010! M. prototub. J! 140070017! 4,481 kb! 4,448 kb! 4,437 kb! 4,525 kb! ~ 4,510 kb! M. tub. H37Rv! 4,411kb! M. africanum! 4,389 kb! M. bovis! 4,345 kb!
Visualisation of SNPs in M.prototub. 140070010 versus of M.tub. H37Rv and by ACT!
Visualisation of SNPs in M.prototub. 140070010 versus of M.tub. H37Rv and by ACT!
M. tuberculosis! Conclusions! M. canettii and other extant! M. prototuberculosis strains! M. prototuberculosis! Common ancestor of the! M. tuberculosis complex! The classical M. tuberculosis complex! RD 9! TbD 1! successful lineage that evolved by clonal expansion! Tubercle bacilli are much older than thought! The longer co-evolution explains the paradox between:! katg c463 CTG CGG! gyra c95 ACC AGC! RD 7! RD 8! RD 10! mmpl6 551 AAC AAG! M. tuberculosis being considered as evolutionary young! extraordinary balance of host adaptation (cavities )! Comparison of smooth & classical tubercle bacilli! RD mic! oxyr n285 G A! RD 12! RD 13! RD seal! pnca c57 CAC GAC! RD 4! RD 1! RD 2! RD 14! ancestral, SE Asian! e.g. Beijing! e.g. CDC1551! e.g. H37Rv! M. africanum! M. microti! M. pinnipedii! oryx! goat-m. caprae! classical! BCG Tokyo! BCG Pasteur! modern! M. bovis! potential to identify factors that contributed to the evolutionary succes! of M. tuberculosis!
Philip SUPPLY! Michael MARCEAU! Christina GUTIERREZ! Julien TAP! Sylvain BRISSE! Cecile PARMENTIER! Valerie BARBE! Sophie MANGENOT! Stéphane CRUVEILLER! Gregory SALVIGNOL! Claudine MEDIGUE! Steve GORDON! Thierry GARNIER! Stewart COLE! Stephen BENTLEY! Julian PARKHILL! http://www.pasteur.fr/recherche/unites/pmi