Supporting Information for Pathways and Controls of N 2 O Production in Nitritation Anammox Biomass Chun Ma, Marlene Mark Jensen, Barth F. Smets, Bo Thamdrup, Department of Biology, University of Southern Denmark, 5230 Odense M, Denmark Department of Environmental Engineering, Technical University of Denmark, 2800 Kongens Lyngby, Denmark Corresponding author. Email: bot@biology.sdu.dk; Tel: +45 6550 2477; Fax: +45 6550 2477. Number of pages: 9 2 Figures and 4 Tables Table of contents Figure S1. Examples of incubations with 15 NH 4 + + 14 NO 2 - at 0.2 mg O 2 L -1 (black) and 1.0 mg O 2 L -1 (red) from Experiment 1. (A) Changes in concentrations of 15 N labeled N 2, N 2 O, NH 4 + and NO 2 -, and in the 15 N labeling of the NH 4 + and NO 2 - pools (F A and F N ) over time; (B). Calculated net cumulative N 2 O production by the hydroxylamine oxidation pathway (HA oxid.) and denitrification pathways (Nit. den. and Het. den.) during the first 2 hours. Lines represent linear regression. Figure S2. Net N 2 O production rates by the denitrification pathways (Nit. den. and Het. den.) as a function of nitrite concentration (average ± SD). Data from Experiment 1 to 4; all experiments at around 0.2 mg O 2 L -1. Each data point represents individual time intervals during the incubations. Error bars on rates represent standard errors from linear regressions of concentration versus time from each single treatment. Table S1. Summary of 15 N incubation experiments. Table S2. Primers and conditions used for the quantification of gene copy numbers of and functional genes by qpcr. Table S3. Abundance of nitrogen transforming microbes, as gene copy numbers, and functional genes based on biomass used for Experiment 1 and 4 (Table 1). Standard deviations in parentheses. Table S4. Rates ± SE of net N 2 O production, N 2 production, and aerobic ammonium oxidation in combination with bulk NO 2 - concentrations (average ± SD) and N 2 O yields at varying imposed concentrations of oxygen, NO 2 -, and 15 NH 4 +. S1
Figure S1. Examples of incubations with 15 NH 4 + + 14 NO 2 - at 0.2 mg O 2 L -1 (black) and 1.0 mg O 2 L -1 (red) from Experiment 1. (A) Changes in concentrations of 15 N labeled N 2, N 2 O, NH 4 + and NO 2 -, and in the 15 N labeling of the NH 4 + and NO 2 - pools (F A and F N ) over time; (B). Calculated net cumulative N 2 O production by the hydroxylamine oxidation pathway (HA oxid.) and denitrification pathways (Nit. den and Het. den.) during the first 2 hours. Lines represent linear regression. S2
Net N 2 O production by Nit. den. (µmoln gvss -1 h -1 ) 2.5 2.0 1.5 1.0 0.5 0.4 0.3 0.2 0.1 0.0 0 50 100 150 0.0 0 400 800 1200 NO 2 - (µm) Figure S2. Net N 2 O production rates by the denitrification pathways (Nit. den. and Het. den.) as a function of nitrite concentration (average ± SD). Data from Experiment 1 to 4; all experiments at around 0.2 mg O 2 L -1. Each data point represents individual time intervals during the incubations. Error bars on rates represent standard errors from linear regressions of concentration versus time from each single treatment. S3
Table S1 Summary of 15 N incubation experiments. Experiment Sludge sampling /experiment date 1 June 30 - July 3 2016 2 May 13-28 2014 3 May 13-28 2014 4 October 17-28 2014 O 2 (mg O 2 L -1 ) 0 0.20 ± 0.05 0.46 ± 0.12 1.0 ± 0.12 3.0 ± 0.13 44.5 ± 1.9 0 0.28 ± 0.10 0.27 ± 0.09 0.26 ± 0.08 Same treatment as listed for the one above. Substrate composition (mm added) 15 NH + 4 (1) + 14 NO - 2 (0.075) 15 NO - 2 (1.0) + 14 NH + 4 (1.0) 15 - NO 3 (1.0) + 14 NH + 4 (1.0) 15 NH + 4 (1.0) 15 NO - 2 (1.0) 15 NO - 3 (1.0) 15 NH + 4 (1.0) 15 NH + 4 (1.0) + 14 NO - 2 (0.2) 15 NH + 4 (1.0) + 14 NO - 2 (0.7) 15 NH + 4 (1.0) + 14 NO - 2 (1.1) 15 NH 4 + (1.3) 15 NH 4 + (4.7) 15 NH 4 + (8.4) 15 NH 4 + (13.1) 15 NH 4 + (34.1) 18 O 2 + 14 NH 4 + (1.3) 18 O 2 + 14 NH 4 + (4.9) 18 O 2 + 14 NH 4 + (8.9) 18 O 2 + 14 NH 4 + (13.8) 18 O 2 + 14 NH 4 + (34.8) Aim Effect of O 2 concentration Anoxic process rates. Determination of Het. Den. potential. Effect of NO 2 -. Effect of NH 4 +. Comparison of N 2 O production pathways by 15 N and 18 O 2 labeling. S4
Table S2. Primers and conditions used for the quantification of gene copy numbers of and functional genes by qpcr. Target Organism All Bacteria Betaproteobac terial AOB NOB Nitrobacter Target Gene Primers Sequence (5-3 ) Annealing Temp. Reference 1055f ATG GCT GTC GTC AGC T 55 1, 2 1392r ACG GGC GGT GTG TAC CTO189fa/b CTO189fc RT1r FGPS872f FGP1269r GGA GRA AAG CAG GGG ATC G GGA GGA AAG TAG GGG ATC G CGT CCT CTC AGA CCA RCT ACT G CTA AAA CTC AAA GGA ATT GA TTT TTT GAG ATT TGC TAG 60 3, 4 50 5 NOB Nitrospira Anammox Ammonium oxidizing bacteria NOB Nitrobacter/ Nitrococcus Denitrifying bacteria Denitrifying bacteria/ AOB Denitrifying bacteria amoa nxra nirs nirk nosz Nspra675f Nspra746r Amx809f Amx1066r amoa 1f amoa 2r F1370f1 F2843r2 cd3af R3cd F1aCu R3Cu nosz2f nosz2r GCG GTG AAA TGC GTA GAK ATC G TCA GCG TCA GRW AYG TTC CAG AG GCC GTA AAC GAT GGG CAC T AACGTCTCACGACACGAGCTG GGG GTT TCT ACT GGT GGT CCC CTC KGS AAA GCC TTC TTC CAG ACC GAC GTG TGC GAA AG TCC ACA AGG AAC GGA AGG TC AAC GYS AAG GAR ACS GG GAS TTC GGR TGS GTC TTS AYG AA ATC ATG GT(C/G) CTG CCG CG GCC TCG ATC AG(A/G) TTG TGG TT CGC RAC GGC AAS AAG GTS MSS GT CAK RTG CAK SGC RTG GCA GAA 58 6 67 7 55 8 55 9, 10 45 11,12 57 13 60 14 S5
Table S3. Abundance of nitrogen transforming microbes, as gene copy numbers, and functional genes based on biomass used for Experiment 1 and 4 (Table 1). Standard deviations in parentheses. + Target bacterial O 2 experiment NH 4 experiment group or gene Copy number 1 (copies g wet biomass -1 ) Rel. abundance 1 (%) Copy number 1 (copies g wet biomass -1 ) Rel. abundance 2 (%) AOB 6.3 (1.2) 10 8 3.2 (0.5) 2.6 (0.22) 10 8 3.1 (0.05) Anammox 6.0 (2.3) 10 9 29.1 (5.3) 2.3 (0.25) 10 9 28 (0.3) Nitrobacter 8.3 (3.1) 10 6 0.04 (0.03) 2.3 (0.55) 10 6 0.03 (0.01) Nitrospira 2.3 (0.2) 10 7 0.12 (0.02) 2.2 (0.18) 10 7 1.0 (0.03) Other 1.3 (0.2) 10 10 67 (5.0) 5.6 (0.55) 10 9 69 (0.2) amoa 1.4 (0.5) 10 8 0.7 (0.09) 4.9 (0.5) 10 7 0.6 (0.1) N bacter nxra 7.1 (1.6) 10 6 0.04 (0.001) 2.7 (1.1) 10 6 0.03 (0.01) nirs 1.9 (0.4) 10 10 96 (22) 6.5 (0.3) 10 9 80 (11) nirk 1.5 (0.11) 10 9 7.4 (1.1) 7.3 (0.2) 10 8 8.9 (0.6) nosz 5.5 (0.8) 10 8 2.9 (0.7) 1.6 (0.01) 10 8 1.7 (0.5) 1 Abundance relative to bacterial gene copy number S6
Table S4. Rates ± SE of net N 2 O production, N 2 production, and aerobic ammonium oxidation in combination with bulk NO 2 - concentrations (average ± SD) and N 2 O yields at varying imposed concentrations of oxygen, NO 2 -, and 15 NH 4 +. Experiment Experimental parameter O 2 (mg O 2 L 1 ) a Net N 2 O production (µmol N gvss -1 h -1 ) Aerobic ammonium oxidation rate c (µmol N gvss -1 h -1 ) NO 2 - conc. (µm) N 2 production rate (µmol N gvss -1 h -1 ) Yield (N 2 O/N 2 in %) 1 3 Anoxic b n.a. n.d. 30.3 ± 35.4 274 n.a. 0.20 ± 0.05 0.46 ± 0.01-77.7 ± 8.5 73.8 ± 12.4 57.0 ± 6.7 0.8 0.46 ± 0.12 0.32 ± 0.02-85.1 ± 15.4 103 ± 36.2 52.4 ± 7.1 0.6 1.0 ± 0.12 0.19 ± 0.02-110 ± 24.6 113 ± 34.2 18.9 ± 1.4 1.0 2.8 ± 0.3 0.037 ± 0.002-111 ± 18.0 145 ± 62.1 0.31 ± 0.05 12 45 ± 1.9 0.022 ± 0.002-121 ± 29.7 143 ±57.1 n.d. n.d. Initial 14 NO - 2 (mm) at 0.2 mg O 2 L -1 0 0.66 ± 0.01-46.7 ± 8.4 52.5 ± 33.6 32.8 ± 0.5 2.0 0.2 0.78 ± 0.08-41.6 ± 15.8 120 ± 67.0 72.7 ± 1.3 1.1 0.7 1.73 ± 0.20-66.4 ± 7.5 379 ± 219 182 ± 14.8 0.95 1.1 1.68 ± 0.10-69.1 ± 5.2 802 ± 204 196 ± 4.2 0.86 15 NH + 4 (mm) at 0.2 mg O 2 L -1 d 1.1± 0.2 0.31 ± 0.007-48.5 ± 2.1 33.7 ± 26.1 35.8 ± 3.4 0.87 4.3 ±0.5 0.57 ± 0.04-54.6 ± 7.3 45.7 ± 35.7 50.9 ± 3.2 1.1 4 7.7 ± 1.0 0.70 ± 0.03-57.2 ± 1.3 58.9 ± 41.3 40.2 ± 3.1 1.7 13.7 ± 1.4 0.92 ± 0.04-59.3 ± 6.1 55.2 ± 43.4 53.3 ± 3.1 1.7 34.0 ± 3.0 0.86 ± 0.05-50.0 ± 2.9 41.6 ± 26.7 53.5 ± 3.3 1.6 a Oxygen concentrations are averages ± SD of measurements made during the incubations (n = 10). b Rates and concentrations are based on the first 0.5 h of incubation as total NO - 2 concentration decreased fast and was below detection after 0.5 h c Aerobic ammonium oxidation rates in Experiment 4 were calculated as the sum of accumulation rates of NO - 2, NO - - 3 (excluding NO 3 produced by anammox bacteria) and NO 2 - consumption rate by anammox, because the relative precision of the ammonium analysis was too low to yield accurate rates at the highest concentrations. d Ammonium concentrations are averages ± SD of measurements made during the incubations (n = 7-10). S7
References (1) Lane, D. J., 16S/23S sequencing. Nucleic Acid Techniques in Bacterial Systematics, Wiley, Chichester 1991. (2) Ferris, M. J.; Muyzer, G.; Ward, D. M., Denaturing gradient gel electrophoresis profiles of 16S -defined populations inhabiting a hot spring microbial mat community. Appl Environ Microb 1996, 62, (2), 340-346. (3) Kowalchuk, G. A.; Stephen, J. R.; DeBoer, W.; Prosser, J. I.; Embley, T. M.; Woldendorp, J. W., Analysis of ammonia-oxidizing bacteria of the beta subdivision of the class Proteobacteria in coastal sand dunes by denaturing gradient gel electrophoresis and sequencing of PCR-amplified 16S ribosomal DNA fragments. Appl Environ Microb 1997, 63, (4), 1489-1497. (4) Hermansson, A.; Lindgren, P. E., Quantification of ammonia-oxidizing bacteria in arable soil by real-time PCR. Appl Environ Microb 2001, 67, (2), 972-976. (5) Degrange, V.; Bardin, R., Detection and Counting of Nitrobacter Populations in Soil by Pcr. Appl Environ Microb 1995, 61, (6), 2093-2098. (6) Graham, D. W.; Knapp, C. W.; Van Vleck, E. S.; Bloor, K.; Lane, T. B.; Graham, C. E., Experimental demonstration of chaotic instability in biological nitrification. ISME J 2007, 1, (5), 385-393. (7) Tsushima, I.; Kindaichi, T.; Okabe, S., Quantification of anaerobic ammonium-oxidizing bacteria in enrichment cultures by real-time PCR. Water Res 2007, 41, (4), 785-94. (8) Rotthauwe, J. H.; Witzel, K. P.; Liesack, W., The ammonia monooxygenase structural gene amoa as a functional marker: Molecular fine-scale analysis of natural ammonia-oxidizing populations. Appl Environ Microb 1997, 63, (12), 4704-4712. (9) Poly, F.; Wertz, S.; Brothier, E.; Degrange, V., First exploration of Nitrobacter diversity in soils by a PCR cloning-sequencing approach targeting functional gene nxra. FEMS Microbiol Ecol 2008, 63, (1), 132-40. (10) Wertz, S.; Poly, F.; Le Roux, X.; Degrange, V., Development and application of a PCRdenaturing gradient gel electrophoresis tool to study the diversity of Nitrobacter-like nxra sequences in soil. FEMS Microbiol Ecol 2008, 63, (2), 261-71. (11) Throbäck, I. N.; Enwall, K.; Jarvis, A.; Hallin, S., Reassessing PCR primers targeting nirs, nirk and nosz genes for community surveys of denitrifying bacteria with DGGE. FEMS Microbiol Ecol 2004, 49, (3), 401-17. S8
(12) Philippot, L.; Piutti, S.; Martin-Laurent, F.; Hallet, S.; Germon, J. C., Molecular analysis of the nitrate-reducing community from unplanted and maize-planted soils. Appl Environ Microb 2002, 68, (12), 6121-6128. (13) Hallin, S.; Lindgren, P. E., PCR detection of genes encoding nitrile reductase in denitrifying bacteria. Appl Environ Microb 1999, 65, (4), 1652-1657. (14) Henry, S.; Bru, D.; Stres, B.; Hallet, S.; Philippot, L., Quantitative detection of the nosz gene, encoding nitrous oxide reductase, and comparison of the abundances of 16S, narg, nirk, and nosz genes in soils. Appl Environ Microb 2006, 72, (8), 5181-5189. S9