Opportunities with USDA-ARS Locations in South Central Texas Kevin Temeyer Knipling-Bushland U.S. Livestock Insects Research Laboratory, Kerrville, TX 78028
USDA-ARS Locations in Texas Kerrville (Moore Field & Panama), Temple, College Station, Bushland, Lubbock
Pathogenic Landscape Arundo River willows donax Cattle fever tick Infested hosts Cattle Deer 1. Arundo and Guineagrass enhance survival of tick 2. Transition back to native vegetation--better biological barrier to ticks Racelis, A.E., R. B. Davey, J. A. Goolsby, A. A. Pérez de León, K. Varner, and R. Duhaime. 2012. Facilitative ecological interactions between invasive species: Arundo donax (Poaceae) stands as favorable habitat for cattle ticks (Acari: Ixodidae) along the US- Mexico border. Journal of Medical Entomology 49: 410-417. Nilgai
Deployed Warfighter Protection Program Joint program between Dept. of Defense and Dept. of Agriculture
Agricultural Research Service Sand fly AChE Target of organophosphate insecticides Identical residues Non-identical residues Unaligned residues Catalytic triad: Ser336, Glu462, His576 of P. papatasi sequence Constructed rppache1- G119S by targeted mutagenesis containing Gly Ser OP-R substitution (G256S) for biochemical characterization Alignment of PpAChE sequence to Drosophila melanogaster AChE (MMDB 1QO9) Partial PpAChE1 cdna sequence containing G119S codon identified as OP-R in An. gambiae and other insects Ser OP-insensitive TGGATCTTCGGTGGTAGCTTCTACTCAGGAACATCCAC TGGATCTTCGGTGGTGGCTTCTACTCAGGAACATCCAC Gly OP-sensitive
rppache1 containing G119S codon OP-R in An. gambiae and other insects Property a Ser OP-insensitive ATCTTCGGTGGTAGCTTCTACTCAGGAACATCC ATCTTCGGTGGTGGCTTCTACTCAGGAACATCC Gly OP-sensitive (wt) Biochemical properties of rppache1 rppache1 (OP-sensitive) rppache1-g256s (OP-insensitive) K m AcSCh b (μm) 24 98 (4-fold) IC50 Paraoxon (10-7 M) 2.9 3800 (1300-fold) IC50 Malaoxon (10-8 M) 4.4 2000 (455-fold) IC50 Eserine (10-9 M) 4.8 120 (25-fold)
Continuing need for new pest control technologies Genomics Pest physiology Vaccines New, targeted pesticides Strategies for control of pest populations Strategies to prevent pathogen transmission by vectors Host animal resistance to parasites & disease
Tick AChE Phylogram Ixodes scapularis predicted AChEs R. microplus BmAChEs
Acetylcholinesterase - Target Site Insensitivity in R. microplus Three AChEs expresses in synganglion: BmAChE1, K m 4-5 μm BmAChE2, K m 40-50 μm BmAChE3, K m 90-100 μm BmAChE1, BmAChE2 & BmAChE3 are functional complements BmAChE1, BmAChE2 & BmAChE3 are amplified, expressing more than two transcript alleles Multiple amino acid substitutions were associated with resistance for each of the three BmAChEs Individual ticks maintained & expressed multiple alleles for each of the three BmAChEs Acetylcholinesterase target site insensitivity is multigenic in R. microplus
Current studies probable additional BmAChEs Fsg186 (salivary) Tc19987 (gut) possible vaccine candidates? Noteworthy opportunity to investigate host-parasite interaction (nervous/immune integration) External collaborations with Univ. Florida, Virginia Tech., Southwest Research Institute (San Antonio), Mayo Clinic, Iowa State University Ixodes scapularis AChE phylogram R. microplus AChEs: BmAChE2 BmAChE3 BmAChE1
Proposed Role of Tick Salivary AChE Tick Gut AChE: Detoxifies Bloodmeal Parasite factors Host factors Pathogen factors Tick Salivary AChE: Hydrolyzes acetylcholine in host tissues Alters acetylcholine activation of nicotinic and muscarinic receptors Modulates host inflammatory response Modulates host innate immunity Modulates host acquired immunity
Acetylcholinesterase: The Target of AChE function Organophosphates Key synaptic enzyme in CNS Hydrolyzes neurotransmitter AcCh Regulation of Inflammation & Immune Response via local acetylcholine Detoxification of bloodmeal OPs bind to and inhibit AChE Blocking nerve impulse transmission Desensitizes AcCh receptors Mutations in AChE may lead to OP resistance
Thank you for your attention!