Supporting Information Ultrasensitive Label-Free Resonance Rayleigh Scattering Aptasensor for Hg 2+ Using Hg 2+ -Triggered Exonuclease III-Assisted Target Recycling and Growth of G-Wires for Signal Amplification Wang Ren, a, b Ying Zhang, a, b Hong Guo Chen, a Zhong Feng Gao, a Nian Bing Li a, * and Hong Qun Luo a, * a Key Laboratory of Eco-environments in Three Gorges Reservoir Region (Ministry of Education), School of Chemistry and Chemical Engineering, Southwest University, Chongqing 400715, People s Republic of China b College of Chemistry and Pharmaceutical Engineering, Sichuan Provincial Academician (Expert) Workstation, Key Laboratory of Green Catalysis of Higher Education Institutes of Sichuan, Sichuan University of Science and Engineering, Zigong 643000, People s Republic of China * Corresponding Author, E-mail: luohq@swu.edu.cn (H. Luo), linb@swu.edu.cn (N. Li) S-1
Supporting Tables: Tables S1 to S2 Supporting Figures: Figures S1 to S6 Supporting Information (SI) Contents Table S1 Sequence of Oligomers..... 3 Table S2 Comparison of the Proposed Approach with Other Reported Methods for the Detection of Hg 2+...........4 Figure S1 Atomic Force Microscopy... 5 Figure S2 Optimum Concentrations of Exo-Ш Catalysis 6 Figure S3 Optimum Temperature for the Exo-Ш Catalysis...7 Figure S4 Optimum Time of Exo-Ш Catalysis.8 Figure S5 Optimum Concentration of Mg 2+ for the G-Wire Formation... 9 Figure S6 Optimum Incubation Time of Mg 2+.......10 References....11 S-2
1. Table S1 Table S1 Sequence of Oligomers Oligomer Sequence (from 5 to 3 ) H 1 (c-myc) H 2 (c-myc) H 3 (c-myc) H 4 (c-myc) H 5 (c-myc) H 6 (PS2.M) H 6 (i-motif) H 7 (normally) TTTTAGGGTGGGGAGGGTGGGGCCCCACCCTTTTT CTTTAGGGTGGGGAGGGTGGGGCCCCACCCTTTAG CTTTAGGGTGGGGAGGGTGGGGCCCCACCCTTAAG TTTAGGGTGGGGAGGGTGGGGCCCCACCCTTTT CTTTAGGGTGGGGAGGGTGGGGCCCCACCCTTTTG CTTTGTGGGTAGGGCGGGTTGGCCTACCCACTTTG CTTTCCCTAACCCTAACCCTAACCCGGGTTAGGGTTTG CTTTCGAACAGC AA GCAGACTG TTGCTGTTCGTTTG c-myc: parallel-stranded G-quadruplex topology; PS2.M: antiparallel-stranded G-quadruplex topology; i-motif: i-motif topology. S-3
2. Table S2 Comparison of the Proposed Approach with Other Reported Methods for the Detection of Hg 2+ SERS: Surface-enhanced Raman scattering; PDDA: Poly (diallyldi-methylammonium chloride); AuNPs: gold nanoparticles; ABTS 2- : 2,2 -azino-bis(3-ethylbenzothiazo-line-6-sulfonate) disodium salt. Method Label or signal reagent Linear range (nm) LOD (pm) Ref. Electrochemistry AuNPs and methyl blue 0.000001-100 0.000001 S1 Electrochemistry Ru(NH 3 ) 6 Cl 3 0.0002-35 0.12 S2 Electrochemistry Ferrocene 5.0-1000 2500 S3 Electrochemistry Methylene blue 0.5-80 200 S4 Electrochemistry Methylene blue 0.2-100 100 S5 Luminescence Iridium(III) complex 0-10000 173000 S6 Fluorescence Phosphorothioate RNA 2-50 17000 S7 SERS Cyanine 5 0.001-100 0.73 S8 Fluorescence Mn:CdS/ZnS and AuNPs 0.2-1000 180 S9 Fluorescence Polymer Carbon Nanoribbons 2.0-60000 680 S10 Fluorescence Ag nanoclusters 10-300 10000 S11 Fluorescence Thioflavin T 10-5000 5000 S12 Fluorescence Ag nanoclusters 0.1-200 33 S13 Colorimetry PDDA 0.25-500 150 S14 Colorimetry AuNPs 10-100000 10000 S15 Colorimetry Ag nanowire 0.05-3.0 45 S16 Colorimetry AuNPs 10-1000 2900 S17 Colorimetry AuNPs 0.001-100 1 S18 Colorimetry ABTS 2-0.05-20 10 S19 RRS Free 0.05-500 20 This work S-4
3. Atomic Force Microscopy Figure S1. AFM images of the resultant products in buffer solution containing (A) 10.0 µm H 5 + 50.0 U Exo-Ш; (B) 10.0 µm H 5 + 50.0 U Exo-Ш + 1.0 µm Hg 2+. S-5
4. Optimum Concentrations of Exo-Ш Catalysis 2500 I RRS 2000 1500 1000 500 5 10 15 20 25 30 35 C Exo-III / U Figure S2 Effect of different concentrations of Exo-III on the RRS intensity responding to the Exo-Ш catalysis process. (The concentration of DNA and Mg 2+ were 0.2 µm and 0.15 M, respectively. Reaction temperature and time were 30 C and 30 min, respectively; Incubation time: 2 h). The error bars represent the standard deviation of three parallel measurements (the same below). S-6
5. Optimum Temperature for the Exo-Ш Catalysis 3000 2500 I RRS 2000 1500 1000 Without Hg 2+ 10 nm Hg 2+ 500 20 25 30 35 40 45 50 T / o C Figure S3 Effect of different reaction temperatures on the RRS intensity responding to the Exo Ш catalysis process. (The concentration of DNA and Mg 2+ were 0.2 µm, 0.15 M, respectively. Reaction time was 30 min; Incubation time: 2 h; Exo-III: 25 U) S-7
6. Optimum Time of Exo-Ш Catalysis 3000 2500 I RRS 2000 1500 1000 500 10 20 30 40 50 60 70 t / min Figure S4 Effect of different reaction time on the RRS intensity responding to the Exo-Ш catalysis process. (The concentration of DNA and Mg 2+ were 0.2 µm, 0.15 M, respectively. Reaction temperature was 35 C; Incubation time: 2 h; Exo-III: 25 U) S-8
7. Optimum Concentration of Mg 2+ for the G-wire Formation 4000 I RRS 3000 2000 1000 Without Hg 2+ 10 nm Hg 2+ 0.0 0.1 0.2 0.3 0.4 0.5 C Mg 2+ / M Figure S5 Effect of different concentrations of Mg 2+ on the RRS intensity responding to G-wire formation process in the presence of Hg 2+ (upper line) and in the absence of Hg 2+ (under line) under the optimal conditions. (The concentration of DNA was 0.2 µm. Reaction temperature and time were 35 C and 50 min, respectively; Incubation time: 2 h; Exo-III: 25 U) S-9
8. Optimum Incubation Time of Mg 2+ 4000 I RRS 3000 2000 1000 0 30 60 90 120 150 180 t / min Figure S6 Effect of incubation time on the RRS intensity responding to 10.0 nm Hg 2+ in the presence of 0.2 M Mg 2+. (The concentration of DNA was 0.2 µm. Reaction temperature and time were 35 C and 50 min, respectively; Exo-III: 25 U) S-10
References S1) Zhang, Y.; Zeng, G. M.; Tang, L.; Chen, J.; Zhu, Y.; He, X. X.; He, Y. Anal. Chem. 2015, 87, 989 996. S2) Bao, T.; Wen, W.; Zhang, X.; Xia, Q.; Wang, S. Biosens. Bioelectron. 2015, 70, 318 323. S3) Zhuang, J.; Fu, L.; Tang D.; Xu, M.; Chen, G.; Yang, H. Biosens. Bioelectron. 2013, 39, 315 319. S4) Xuan, F.; Luo, X.; Hsing, I. M. Anal. Chem. 2013, 85, 4586 4593. S5) Tortolini, C.; Bollella, P.; Antonelli, M. L.; Antiochia, R.; Mazzei, F.; Favero, G. Biosens. Bioelectron. 2015, 67, 524 531. S6) Ru, J.; Chen, X.; Guan, L.; Tang, X.; Wang, C.; Meng, Y.; Zhang, G.; Liu, W. Anal. Chem. 2015, 87, 3255 3262. S7) Huang, P. J.; Wang, F.; Liu, J. Anal. Chem. 2015, 87, 6890 6895. S8) Sun, B.; Jiang, X.; Wang, H.; Song, B.; Zhu, Y.; Wang, H.; Su, Y.; He, Y. Anal. Chem. 2015, 87, 1250 1256. S9) Huang, D.; Niu, C.; Wang, X.; Lv, X.; Zeng, G.. Anal. Chem. 2013, 85, 1164 1170. S10) Wang, Z.; Ding, S. Anal. Chem. 2014, 86, 7436 7445. S11) Deng, L.; Zhou, Z.; Li, J.; Li, T.; Dong, S. Chem. Commun. 2011, 47, 11065 11067. S12) Ge, J.; Li, X.; Jiang, J.; Yu, R. Talanta 2014, 122, 85 90. S13) Wang, G.; Xu, G.; Zhu, Y.; Zhang, X. Chem. Commun. 2014, 50, 747 750. S14) Zhu, Y.; Cai, Y.; Zhu, Y.; Zheng, L.; Ding, J.; Quan, Y.; Wang, L.; Qi, B. Biosens. Bioelectron.2015, 69, 174 178. S15) Gao, Y.; Li,X.; Li,Y.; Li, T.; Zhao,Y.; Wu, A. Chem. Commun. 2014, 50, 6447 6450. S16) Tang, S.; Tong, P.; Wang, M.; Chen, J.; Li, G.; Zhang, L. Chem. Commun., 2015, 51, 15043 15046. S17) Sener, G.; Uzun, L.; Denizli, A. Anal. Chem. 2014, 86, 514 520. S18) Chen, J.; Zhou, S.; Wen, J. Anal. Chem. 2014, 86, 3108 3114. S19) Ren, W.; Zhang, Y.; Huang, W. T.; Li, N. B.; Luo, H. Q. Biosens. Bioelectron. 2015, 68, 266 271. S-11