No.37 (2002) pp.209-216 Sasaella ramosa On the Inter-Generic Hybrid Sasaella ramosa Yoshiyuki HOSOYAMA, Kazuko HOSHIDA, Sonoe TAKEOKA and Shohei MIYATA (Received November 30, 2001) Until several ten years ago, the genus Sasaella consisted of about 140 species. Sasaella has been believed to be an inter-generic hybrid of Sasa and Pleioblastus. Recently a taxonomist rearranged these species into ten. One of them is Sasaella ramosa. In the neighborhood of Tokyo, we have two groups growing wild in this species, named before Sasaella hannouensis and S. Sawadai. Sequencing parts of chloroplast DNA of these two groups revealed the maternal genus of the former Sasa and the latter Pleioblastus. 1. Sasa 10 Sasaella 1 SasaellaSasa Pleioblastus 2 140 Sasaella 10 3 4 Sasa megalophylla Nobilis Pleioblastus disticus Pleioblastus Simonii Heterophyllus 5 DNA 2. 2. 1 156 8550 3 25 40 Department of Chemistry, College of Humanities and Sciences, Nihon University: 3-25-40, Sakurajousui, Setagaya-ku Tokyo 156-8550 Japan 209 1
1 83 Sasaella Sasa Pleioblastus 3 Sasaella ramosa Sasa veitchii Pleioblastus chino Sasaella Sawadai Sasa Tokugawana Pleioblastus Chino var. vaginatus Sasa nipponica 2. 2 CTAB 6 DNA 2 Polymerase Chain Reaction PCR 1 trnl UAA 3 trnf GAA2 atp rbcl IGS PCR 2 1 5 3 5 3 72 5 3 5 3 PCR EX Taq TaKaRa 9430 50 6030 7230 25 30 724 4 PCR QIAquick PCR Purification kit QIAGEN DNA ABI 3100 American Biochemical Instruments 3. 120 190 kbp 2 DNA 100 ORF 8 9 10 DNA 11 2 ORF 2 Intergenic spacer, IGS 12 13 14 2 trna trnl UAA 3 trnf GAA IGS 7 5 8 9 15 2 210
Sasaella ramosa 13 14 Oryza sativa 16 1 2 Sasaella 1 3 1 Section 5 1 3 17, 2, Sasaella 2 IGS Sasaella Sasa 1km Sasa 1 2 trnl3 trnf IGS 1 atp rbcl IGS 2 IGS trnl3 trnf IGS 3 AtprbcL IGS 3 Sasa Pleioblastus 18 atprbcl IGS 4 IGS Sasaella DNA Pleioblastus,, Sasa,,,, 19 Sasaella Sasa Pleioblastus Sasa Pleioblastus 211 3
Sasaella 1 Makino, T (1929) : A contribution to the knowledge of the flora of Japan; Sasaella. J. Japan. Bot. 6, 15. 21960 115 123. 31996. 245 246. 41972 17, 11 14. 51991 1 25, 107 117. 6 Doyle, J. J. & Doyle, J. L. (1990) : Isolation of plant DNA from fresh tissue. Focus, 12, 13 15. 7 Taberlet, P. Gielly, L. Pautou, J. & Bouvet, J. (1991) : Universal primers for amplication of three non-coding regions of chloroplast DNA. Plant Mol. Biol., 17, 1105 1109. 8 Shinozaki, K. & Sugiura, M. (1982) : Sequence of the intercistronic region between the riburose 1, 5-bisphosphate carboxylase/oxygenase large subunit and the coupling factor subunit gene. Nucleic Acids Res., 10, 4923 4934. 9 Shinozaki, K. & Sugiura, M. (1986) : Organization of chloroplast genomes. Adv. Biophys., 21, 57 78. 101992 37 1067 1076. 11 Moon, E., Kao, T.-H. & Wu, R. (1987) : Rice chloroplast DNA molecules are heterogeneous as revealed by DNA sequences of a cluster genes. Nucleic Acids Res., 15, 611 630. 12 Zurawski, G. & Clegg, M.T. (1987) : Evolution of higher plant chloroplast DNA-enclosed genes : Implications for structure-function and phylogenetic studies. Ann. Rev. Plant Physiol., 38, 391 418. 13 Fujii, N., Ueda, K., Watano, Y. & Shimizu, T. (1997) : Intraspecific sequence variation of chloroplast DNA in Peducularis chamissonis Steven Scrophulariaceae and geographic structuring of the Japanese alpine plants. J. Plant Res., 110, 195 207. 14 Fujii, N., Ueda, K., Watano, Y. & Shimizu, T. (1999) : Further analysis of intraspecific sequence variation of chloroplast DNA in Primula cuneifolia Ledeb. (Primulaceae) : Implication for biogeography of the Japanese alpine flora. J. Plant Res., 112, 87 95. 151993 14, 138 148. 16 Hiratsuka, J., Shimada, H., Wittier, R., Ishibashi, T., Sakamoto, M., Mori, M., Kondo, C., Honji, Y., Sun, C. R., Meng, B. Y., Li, Y. Q., Kanno, A., Nishizawa, Y., Hirai, A., Shinozaki, K. & Sugiura, M. (1989) : The complete sequence of the rice (Oryza sativa) chloroplast genome; intermolecular recombination between distinct trna genes accounts for a major plastid DNA inversion during the evolution of cereals. Mol. Gen. Genet., 217, 185 194. 17 Suzuki, S (1987) : New or noteworthy plants of Japanese Bambusaceae (5). J. Jpn. Bot., 62, 274 280 181978 368. 19 Tashiro,Y., Oyama,T., Iwamoto, Y., Noda,R. & Miyazaki,S. (1995) : Identification of maternal and paternal plants of Allium wakegi Arai by RFLP analysis of chloroplast DNA. J. Jpn. Soc. Hort. Sci., 63, 810 824. 4 212
Sasaella ramosa 1 trnl3 trnf 1 2 1 2 1 70 1 2 71 136 1 2 137 202 1 2 203 270 213 5
1 2 271 339 1 2 340 350 trnf 6 214
Sasaella ramosa 2 Atp rbcl atp rbcl 50 agtagtaggattggttctcat 50 120 120 190 190 260 260 330 330 400 215 7
400 470 470 540 540 610 610 680 680 750 750 780 atgtca ccacaaacag aaacta 3 780 8 216