Red Sea - Dead Sea Water Conveyance Study Program Additional Studies

Red Sea - Dead Sea Water Conveyance Study Program Additional Studies Red Sea Study Final Report Annex 1 Field and laboratory activities carried out during the study and their results July 213

TABLE OF CONTENTS A1. Subsurface deep currents... 3 A2. Subsurface coastal currents... 17 A3. Monitoring of hydrographic parameters... 6 A4. Bottom sediments... 69 A5. Benthic habitats... 71 A6. Fish fauna... 77 A7. Coral reef larvae... 93 RSS-REL-T5. Annex 1_page 2 of 132

A1. Subsurface deep currents Moored acoustic Doppler current profilers (ADCPs) collected current data during the summer stratified season (August September 21), the fall transition season (October November 21) and the winter well-mixed season (January February 211). Two moorings were deployed near the Israel/Jordan maritime border during each monitoring period. One mooring was located near the north beach at the 2 m isobath and the second mooring was located farther south near the 5 m isobath. Each mooring was equipped with an upward-looking 6 khz RD Instruments (RDI) acoustic Doppler current profiler (ADCP) and a downward-looking RDI 15 khz ADCP. The upwardlooking 6 khz ADCPs measured currents from near surface (5-1 m) to depths of 4-45 m with a vertical resolution of 1 m. The downward-looking 15 khz ADCPs measured currents from 5-6 m to 25-3 m (or the bottom in the case of the 2 m mooring) with a vertical resolution of 5 or 1 m. Additionally, both moorings were equipped with at least one conductivity/temperature/depth (CTD) logger, and several thermistors. The mooring configurations (dates, depths, and measurement intervals) for the three deployments are summarized in Tables A1 A9. Mooring locations are shown in Figure A- 1. The white circles, red squares, and yellow triangles denote the locations of the summer, fall, and winter moorings, respectively. During the October-November 21 deployment the 5 m mooring line was severed, casting the upper part of the mooring adrift. The upper mooring was recovered by the Port Authority in Eilat and transferred to the R/V Sam Rothberg on 14 November 21. Unfortunately three thermistors, a temperature/pressure logger, and an acoustic release remain on the sea floor. The cause of the severed line was not determined. Additional complications include the malfunction of the RBR conductivity sensors on both the XR-62 and the XR-42 CTDs. Table A- 1-a August 2 m mooring: instruments operation details. 2 m Mooring Deployed Retrieved Total Water Depth 29.5253N, 34.9681E 12 August 21 15 September 21 22 m Instrument Variables Measured Approx. Depth (m) Measurement Interval RDI 6 khz ADCP Velocity 1 41 1 min SBE39 5199 Temperature 46.4 6 sec RDI 15 khz ADCP Velocity 5 22 2 min RBR XR-62 18516 Cond./Temp./Depth 67.5 3 sec SBE39 5195 Temperature 88.6 6 sec SBE37 SMP Cond./Temp./Depth 12 6 sec RBR TR-16 15 Temperature 14.5 1 sec RSS-REL-T5. Annex 1_page 3 of 132

Table A- 1-b August 2 m mooring: Thermistors descriptive statistics. The mean (< >), standard deviation (σ), and extreme values, and their respective times and dates, of the temperature data recorded on the 2 m Mooring are summarized. See Table A1-a for instrument depths and sampling intervals. SN <T> ( C) σ ( C) Max. Temp. ( C) Date Min. Temp. ( C) Date 5199 26.348.429 26.8649 2-9-1 12:19: 18516 25.4932.4279 26.798 2-9-1 23::3 5195 24.7859.5663 26.2455 29-8-1 21:55: 37SMP 23.5929.4975 25.2524 15-8-1 2:52:1 15 23.97.461 24.6666 14-8-1 19:57:2 25.1233 9-9-1 12:31: 24.2463 9-9-1 13:21:3 23.3799 9-9-1 12:5: 22.5513 15-8-1 17:52:1 22.3194 22-8-1 14:14:2 Table A- 2-a August 5 m mooring: Instruments operation details. 5 m Mooring Deployed Retrieved Total Water Depth 29.4987N, 34.957E 12 August 21 15 September 21 526 m Instrument Variable(s) Measured Approx. Depth(s) (m) Measurement Interval RDI 6 khz ADCP Velocity 5 45 1 min RBR TR-16 14184 Temperature 5.9 1 sec RDI 15 khz ADCP Velocity 55-255 2 min RBR XR-42 13225 Cond.*/Temp./Depth 71.7 3 sec RBR TR-16 14185 Temperature 92 1 sec SBE39 5187 Temperature 111.4 6 sec SBE39 5277 Temperature 132.5 6 sec RBR TR-16 14186 Temperature 151.7 1 sec SBE39 5271 Temperature 193 6 sec RBR TDR-25 14782 Temperature/Depth 249 3 sec RBR TR-16 14187 Temperature 299.4 1 sec SBE39 5279 Temperature 415.9 6 sec RSS-REL-T5. Annex 1_page 4 of 132

Table A- 2-b August 5 m mooring: Thermistors descriptive statistics. SN <T> ( C) σ ( C) Max. Temp. ( C) Date Min. Temp. ( C) Date 14184 25.9387.3757 26.7872 3-9-1 :2:2 13225 25.3688.3744 26.3376 3-9- :47:3 14185 24.674.4567 25.7287 29-8-1 19:12: 5187 23.844.49 25.642 15-8-1 22:16: 5277 23.176.3587 24.318 15-8-1 22:25: 14186 22.7194.267 23.8381 13-8-1 2:3:2 5271 22.2447.1181 22.7226 12-8-1 22:: 14782 21.8934.117 22.2682 16-8-1 23:17:3 14187 21.4832.1357 21.9116 16-8-1 23:18:4 5279 21.569.193 21.1514 15-8-1 22:5: 25.339 13-9-1 17:1:5 24.2982 13-9-1 17:58:3 23.4597 17-8-1 5:1:1 22.848 22-8-1 13:23: 22.4273 22-8-1 14:4: 22.2773 22-8-1 14::1 21.917 14-8-1 16:34: 21.4798 13-8-1 13:19: 21.1586 13-8-1 13:34:3 21.134 25-8-1 6:25: Table A- 3-a October 2 m mooring: instruments operation details. 2 m Mooring Deployed Retrieved Total Water Depth 29.5234N, 34.9643E 12 October 21 17 November 21 23 m Instrument Variables Measured Approx. Depth (m) Measurement Interval RDI 6 khz ADCP Velocity 12-52 1 min SBE39 5199 Temperature 58 6 sec RDI 15 khz ADCP Velocity 58 2 min RBR XR-62 18516 Cond./Temp./Depth 8 3 sec SBE39 5195 Temperature 11 6 sec SBE37 SMP Cond./Temp./Depth 129 6 sec RBR TR-16 15 Temperature 149 1 sec RSS-REL-T5. Annex 1_page 5 of 132

Table A- 3-b October 2 m mooring: Thermistors descriptive statistics. The mean (< >), standard deviation (σ), and extreme values, and their respective times and dates, of the temperature data recorded on the 2 m Mooring are summarized. See Table A-3-a for instrument depths and sampling intervals. SN <T> ( C) σ ( C) Max. Temp. ( C) Date Min. Temp. ( C) Date 5199 25.7287.3644 26.6281 21-1-21 4:5:59 5195 25.1788.6737 26.2977 2-1-21 15:39:59 24.5984 27-1-21 3:27:59 22.9363 9-11-21 1:19:59 37SMP 18516 25.5679.4566 26.4794 21-1-21 4:1:29 15 23.339 1.66 25.7288 16-11-21 8:4:48 24.115 13-1-21 17:27:59 22.334 8-11-21 11:43:29 Table A- 4 October 5 m mooring: instruments operation details. The retrieval data corresponds to the date the mooring was recovered by the Port Authority and transferred to the R/V Sam Rothberg. Pressure data from the ADCP and CTD suggest that the mooring was severed the afternoon of 13 November 211. 5 m Mooring Deployed Retrieved Total Water Depth 29.4937N, 34.9425E 12 October 21 14 November 21* 533 Instrument Variable(s) Measured Approx. Depth(s) (m) Measurement Interval RDI 6 khz ADCP Velocity 5 45 1 min RBR TR-16 14184 Temperature 5.9 1 sec RDI 15 khz ADCP Velocity 55-255 2 min RBR XR-42 13225 Cond./Temp./Depth 71.7 3 sec RBR TR-16 14185 Temperature 92 1 sec SBE39 5187 Temperature 111.4 6 sec SBE39 5277 Temperature 132.5 6 sec RBR TR-16 14186 Temperature 151.7 1 sec SBE39 5271 Temperature Not recovered RBR TDR-25 14782 Temperature/Depth Not recovered RBR TR-16 14187 Temperature Not recovered SBE39 5279 Temperature Not recovered RSS-REL-T5. Annex 1_page 6 of 132

Table A- 5 October 5 m mooring: Thermistors descriptive statistics. The mean (< >), standard deviation (σ), and extreme values, and their respective times and dates, of the temperature data recorded on the 5 m Mooring are summarized. SN <T> ( C) σ ( C) Max. Temp. ( C) Date Min. Temp. ( C) Date 14184 25.6956.3517 26.4982 21-1-21 15:48:9 13225 25.3973.5411 26.2617 2-1-21 16:23:59 14185 24.8379.7645 26.1941 2-1-21 16:21:19 5187 24.317.9125 26.549 2-1-21 15:3:59 5277 23.2213.8635 25.5159 13-11-21 16:4:59 14186 22.6871.6579 25.5199 13-11-21 16:31:58 24.592 27-1-21 15:14:9 23.774 26-1-21 13:19:29 22.5487 13-1-21 18:38:8 22.3469 8-11-21 12:56:59 22.1281 9-11-21 :25:59 22.169 9-11-21 :27:29 Table A- 6 January 211 2 m mooring: instruments operation details. 2 m Mooring Deployed Retrieved Total Water Depth 29.5241N, 34.9676E January 211 27 February 211 235 Instrument Variables Measured Approx. Depth (m) Measurement Interval RDI 6 khz ADCP Velocity 1 min SBE39 5199 Temperature 62 6 sec RDI 15 khz ADCP Velocity 65 235 2 min SBE39 5195 Temperature 15 6 sec SBE37 SMP Cond./Temp./Depth 138.5 6 sec RBR TR-16 15 Temperature 158.5 1 sec RSS-REL-T5. Annex 1_page 7 of 132

Table A- 7 January 211 2 m mooring: Thermistors descriptive statistics. The mean (< >), standard deviation (σ), and extreme values, and their respective times and dates, of the temperature data recorded on the 2 m Mooring are summarized. See Table A-6 for instrument depths and sampling intervals. SN <T> ( C) σ ( C) Max. Temp. ( C) Date Min. Temp. ( C) Date 5199 22.6364.2292 23.15 22-1-211 13:4:59 5195 22.6432.2292 23.15 22-1-211 8:18:59 37SMP 23.594.276 23.185 22-1-211 8:58:59 15 22.6515.2277 23.1128 22-1-211 9:33:39 22.3519 27-2-211 6:47:59 22.3626 27-2-211 1:5:59 22.9976 24-1-211 2:45:59 22.3697 26-2-211 8::28 Table A- 8 January 211 5 m mooring: instruments operation details. 5 m Mooring Deployed Retrieved Total Water Depth 29.4959N, 34.956E January 211 27 February 211 56 Instrument Variable(s) Measured Approx. Depth(s) (m) Measurement Interval RDI 6 khz ADCP Velocity 9-49 1 min RBR TR-16 14184 Temperature 55 1 sec RDI 15 khz ADCP Velocity 64-34 2 min RBR XR-42 13225 Cond./Temp./Depth 76 3 sec RBR TR-16 14185 Temperature 96 1 sec SBE39 5187 Temperature 115.5 6 sec SBE39 5277 Temperature 135 6 sec RBR TR-16 14186 Temperature 154 1 sec RSS-REL-T5. Annex 1_page 8 of 132

Table A- 9 January 211 5 m mooring: Thermistors descriptive statistics. The mean (< >), standard deviation (σ), and extreme values, and their respective times and dates, of the temperature data recorded on the 5 m Mooring are summarized. SN <T> ( C) σ ( C) Max. Temp. ( C) Date Min. Temp. ( C) Date 14184 22.6482.233 23.1217 22-1-211 17:7:39 13225 22.6524.2292 23.1173 22-1-211 19:55:29 14185 22.6568.2289 23.125 22-1-211 2:48:19 5187 22.6569.2285 23.1211 22-1-211 21:2:59 5277 22.6614.2285 23.1234 22-1-211 22::59 14186 22.6657.2288 23.1265 23-1-211 :46:9 22.3423 27-2-211 7:4:38 22.3511 27-2-211 2:42:29 22.357 27-2-211 8:47:18 22.3673 23-2-211 6:7:59 22.3723 23-2-211 6:19:59 22.3754 23-2-211 6:22:38 Figure A- 1 The white circles, red squares, and yellow triangles indicate the locations of the summer, fall, and winter moorings, respectively. RSS-REL-T5. Annex 1_page 9 of 132

Figure A- 2 12 August 21 deployment of the 2 m Mooring from the R/V Sam Rothberg. The subsurface flotation trails behind the boat while Profs. Hezi Gildor (left) and Amatzia Genin (right) prepare to release the 6 khz ADCP. In the foreground, Igal Berenstein (left) and Eli Biton (right) prepare to move the 15 khz ADCP and additional flotation into position for deployment. Figure A- 3 12 October 21 deployment of the 5 m Mooring from the R/V Sam Rothberg. The RDI 15 khz ADCP is positioned for deployment with the ship s crane. RSS-REL-T5. Annex 1_page 1 of 132

Figure A- 4 The 5 m Mooring was found drifting and was recovered by the Port Authority in Eilat. The mooring line was severed at the attachment point of RBR TR-16 thermistor 14186. The thermistors below this point, acoustic release, and anchor were not recovered. The cause of the mooring failure was not determined. The three deployments provided information about the first-order circulation features present in the deep Gulf of Eilat during three different seasons and under different stratification conditions. Time series of temperature also reveal large amplitude internal waves during the summer and fall and erosion of the stratification in the upper mixed layer during winter. Time series of temperature are shown at the shallowest depths on both moorings and at the deepest depth on the 2 m Mooring and the corresponding depth on the 5 m Mooring. In any case, all thermistors on the 5 m Mooring below ~15 m were lost when the mooring line was severed. During the summer stratified season the circulation is largely affected by internal tides with amplitudes of several tens of meters and current speeds of approximately 2 cm/s (see Figure A- 6). Shallow temperature time series (Figure A- 7) show the transition from warming in late August to cooling in early September. Higher frequency variability was likely due to internal waves. The deep temperature time series (Figure A- 8) do not show a clear long term trend during the summer. However, large amplitude internal waves probably caused the large (1.5 C) fluctuations in temperature. RSS-REL-T5. Annex 1_page 11 of 132

Figure A- 5 Color contours of the north/south velocity component measured at the 5 m Mooring location during the summer deployment. Time is shown on the x-axis and depth is shown on the y-axis. Contours are shown in meters per second with warm colours corresponding to northward flow while cold colours correspond to southward flow. Figure A- 6 Temperature time series of the shallowest thermistors on the 2 m Mooring (red line) and the 5 m Mooring (blue line) from 12 August 21 to 15 September 21. The temperature data during this period are indicative of a transition from atmospheric warming to atmospheric cooling of the surface water. Higher frequency variability is likely due to internal waves of semi-diurnal frequency and the diurnal cycle of atmospheric heating and cooling. RSS-REL-T5. Annex 1_page 12 of 132

Figure A- 7 Temperature time series from the deepest (14 m) thermistor on the 2 m Mooring (red line) and the thermistor at nearly the same depth on the 5 m Mooring (blue line). Unlike Figure A- 9, the data here do not exhibit any clear long-term trend, but do show the presence of internal waves. Internal waves are still observed in the current and temperature data collected during the fall deployment but lower frequency variability is also evident in the measurements, especially in temperature. The strongest currents were observed above about 15 m for the first half of the deployment (Figure A- 8). Stronger currents were observed below 15 m during early November 21. The shallow temperature time series (Figure A- 1) show warming of the surface water by about 1 C during the first week of the deployment and steady cooling thereafter. The deep thermistor data show an interesting transition to large amplitude temperature fluctuations during the last week of the deployment. RSS-REL-T5. Annex 1_page 13 of 132

Figure A- 8 Similar to Figure A- 5, color contours of the north/south velocity component measured at the 5 m Mooring location during the fall (October November 21) deployment show the presence of tidal flows and internal waves. Figure A- 9 Temperature time series measured by the shallowest thermistors on the 2 m Mooring (red line) and the 5 m Mooring (blue line) from 12 October 21 to 13 November 21. RSS-REL-T5. Annex 1_page 14 of 132

Figure A- 1 Temperature time series measured by the deepest thermistor on the 2 m Mooring (red line) and the deepest recovered thermistor on the 5 m Mooring (blue line). The time series show an interesting transition to large amplitude fluctuations during the last week of the deployment. During the winter deployment, the moorings gathered current data during a winter southern storm that occurred 16 February 211. While the storm produced large waves, the strongest currents were observed almost a week later under very calm conditions (Figure A- 12). The mixed layer depth reached approximately 3 m, as evident when comparing the shallow and deep thermistor data (Figure A- 12 - Figure A- 13). RSS-REL-T5. Annex 1_page 15 of 132

Figure A- 11 The north/south component of the flow measured at the 5 m Mooring location from 2 January 211 to 27 February 211. Strong surface currents were observed during the beginning and end of the deployment. A winter southern storm occurred 15 February 211 buffeting the northern shore with large waves. However, the strongest currents were observed the following week under calm conditions. Figure A- 12 Temperature measured by the shallowest thermistors on the 2 m Mooring (red line) and the 5 m Mooring (blue line) show steady cooling of the surface waters during winter (2 January 27 February 211). RSS-REL-T5. Annex 1_page 16 of 132

Figure A- 13 Temperature time series measured by the deepest thermistors on the 2 m Mooring (red) and 5 m Mooring (blue). Comparison with Figure X shows that the shallow and deep thermistors were at nearly the same temperature and exhibited similar variability. A2. Subsurface coastal currents A2.1 Description of activities The subsurface current was carried out at four sites (Northern Intake, Eastern Intake, MSS and IUI) during summer 21, winter 21-211 and spring 211 (Table A- 1). A2.2 Materials and methods The ADCPs (Workhorse 6 khz) were used to measure a continuous profiling of current speed and direction in the coastal water columns at all sites. The coordinates, duration of measurements and deployment setup are shown in Table A- 1. The location map of the Workhorse ADCPs (6 khz) deployments at the four sites is shown in Figure A- 14. RSS-REL-T5. Annex 1_page 17 of 132

Table A- 1 The workhorse ADCP (6 khz) deployment setup at the four sites. SUMMER Northern Intake Eastern Intake MSS IUI Coordinates E34 58.733; N29 32.235 E34 59.16; N29 29.325 E34 58.21; N29 27.293 E34 55.9; N29 3.15 Experiment duration Sep. 2th, - Oct. 16th, 21 Jul. 7 th Sep. 2 nd, 21 Jul. 1 st Aug. 28 th, 21 Aug. 12 th Sep. 15 th, 21 Bottom depth 34 3 34 44 Number of depth cells 17 15 17 21 Depth cell size 2m 2m 2m 2m Time per Ensemble 1 min 1 min 1 min 5 min Pings per ensemble 4 4 4 25 Time per ping 1.5s 1.5s 1.5s 1.2s Transmit length 2.2m 2.2m 2.2m 2.2m Blank after transmit.8m.8m.8m.8m Distance to first bin 3.m 3.m 3.m 2.73m WINTER and SPRING Coordinates E34 58.733; N29 32.235 E34 59.16; N29 29.325 E34 58.21; N29 27.293 E34 55.9; N29 3.15 Experiment duration Jan. 6 th -27 th, 211 Apr. 6 th -May 17 th, 211 Jan. 5 th Feb. 2 th, 211 Apr. 4 th -May 8 th, 211 Dec. 5 th, 21 Jan. 2 nd, 211 Feb. 23 rd -Apr. 4 th, 211 Bottom depth 34 34 34 44 Number of depth cells 17 17 17 21 Depth cell size 2m 2m 2m 2m Time per Ensemble 1 min 1 min 1 min 5 min Pings per ensemble 4 4 4 25 Time per ping 1.5s 1.5s 1.5s 1.2s Transmit length 2.2m 2.2m 2.2m 2.2m Blank after transmit.8m.8m.8m.8m Distance to first bin 3.m 3.m 3.m 2.73m Dec. 17 th, 21 Jan. 7 th, 211 Mar. 23 rd -Apr. 1 th, 211 RSS-REL-T5. Annex 1_page 18 of 132

29.56 29.51 Gulf of IUI Northern Intake Red Sea Eastern Intake Latitude (N) 29.46 MSS 29.41 G U L F O F A Q A B A 1 2 3 4 5 km 29.36 34.78 34.83 34.88 34.93 34.98 35.3 Longitude (E) Figure A- 14 Location map of the Workhorse ADCP (6 khz) deployments at the Northern Intake, Eastern Intake, MSS and IUI sites. RSS-REL-T5. Annex 1_page 19 of 132

A2.3 Results Subsurface current in the in the vicinity of the intakes during summer The first deployments for the ADCPs in the vicinity of the intakes and in front of the IUI and MSS were performed during summer 21. In general, the currents during summer at the four sites (Eastern Intake, Northern Intake, MSS and IUI) had different patterns, which could be attributed to the difference of their geographical features and locations. The current records in the Northern Intake Site during September-October 21 revealed that the general current pattern near the surface (at 3m depth) was southward, where the current between 5-31 m are characterized by a gradual anti-clockwise current rotation of more than 25 that started from east-southward at 5 m depth to west-southward (near the bottom). Besides, there was a manifested feature at each depth in the entire of 5-31 m water column, where a harmonic current reversal along the shoreline was observed (Figure A- 15 and Figure A- 16). The current records in the Eastern Intake Site during July-August 21 were characterized by three major patterns in the water column. The south-southwestward current was dominating in the upper layers (<7 m), the north-northeastward was dominating in the lower layers (>15m), and current reversal along the shoreline in between 7-15 m depth was observed (Figure A- 15 and Figure A- 16). The current records in front of the Marine Science station during July-August 21 revealed two different patterns in the 7-31 water column. A southwestward current (along the coast) dominated above 25 m while a westward current near the bottom was recorded. Also, a slight clockwise rotation of current direction and a decrease of current magnitude with respect to depth were observed (Figure A- 15 and Figure A- 17). In western coastal waters (7-37 m) in front of the IUI, the current pattern during August-September 21 was mainly similar to the current pattern in front of the MSS. The current direction at the IUI site was mainly south-southeastward (parallel to the shoreline) in the entire water column except near the bottom (Figure A- 15 and Figure A- 17). This implies that the coastal current pattern at both MSS and IUI sites mainly southward and parallel to its shorelines. The vertical variations of the current directions at the different stations are quite complex and exhibit various features that are associated with Ekman turning of the currents, a decoupling of the near surface layer and the deeper layer due to the stratification, and possible due to vertical displacement of the isotherms by internal waves. The time series records at all sites reveals that the long shore current component was stronger than the cross shore current component (Figure A- 18). The maximum current speed that was recorded at the Eastern Intake, Northern Intake, MSS and IUI sites were (3 cms -1 at 3 m; 15 cms -1 near the bottom), (3 cms -1 at 3 m; 2 cms -1 near the bottom), (4 cms -1 at 7 m; 3 cms -1 near the bottom) and (4 cms -1 at 7 m; 25 cms -1 near the bottom), respectively. The spectral analysis of time series data of the average current speed in overall entire coastal water column during summer revealed that the common tidal current signals at all sites were the semidiurnal (12.19 h: principle lunar M2) and lunar or/and solar quarter-diurnal harmonics (6.1 h: M4; S4; MS4) except at the Northern Intake site, where only a semidiurnal signal was detected. RSS-REL-T5. Annex 1_page 2 of 132

Besides, another tidal signal of 4.6 h was revealed at the MSS site, which is attributed to lunar and solar sixth diurnal harmonics (2MS6; 2SM6) (Figure A- 19). The percent frequency of the current speed below 1 cms -1 at the Northern Intake site was more than 98%, while it was about 88%, 7% and 59% at the Eastern Intake, MSS and IUI sites, respectively. The current speed at the IUI and MSS site was relatively stronger than the other sites, where the percent frequency of speed stronger than 2 cms -1 was 5%-8% at the MSS and IUI compared to less than 1% at the other sites. The dominant percent frequency of current direction was 29% for 27-33 and 26% for 6-12 at Northern Intake site; 39% for 33-3 and 37% for 15-21 at the Eastern Intake site; 52% for 18-24 and 3% for -6 at the MSS site; and 59% for 18-24 and 27% for -6 (Figure A- 2). In order to remove the tidal effect in the current records, a two days pass filter of the raw data was performed (Figure A- 21). The outcome of the filtered data revealed a longer periodic time of average 2-4 days were found for all sites. This periodic change of current speed and direction represents the current reversal that was detected in the progressive vector diagram (Figure A- 16 and Figure A- 17). Besides, the current speed becomes stronger when the current direction switches to eastward at the Northern Intake site and to southward at the other sites. The average values of current speed and direction during the recording intervals during summer in the entire water column at the Northern Intake, Eastern Intake, MSS and IUI sites were (3.6 ±.23 cms -1 and 356 ± 59.7 ), (4.4 ±.9 cms -1 and 48 ± 19.9 ), (7.3 ± 1.51 cms -1, 27 ± 16.7 ) and (8.7 ±.52 cms -1, 218 ± 36.5), respectively. The statistical summary of current data measurements in the entire coastal water column at all sites during summer are shown in Table A- 11 Table A- 14. RSS-REL-T5. Annex 1_page 21 of 132

Figure A- 15 Cross and long shore current [cms -1 ] components of the raw data in summer at the Northern and Eastern Intake sites and in front of the MSS and IUI. RSS-REL-T5. Annex 1_page 22 of 132

-5-1 3m 5 1 2-2 (A) Northern Intake-SUMMER 3 3 5m 2 7m 2 9m -2 2 4 1-1 -1 1 2 3 1-1 -1 1 2 3-5 -1 3m -15-5 5 1-5 (B) Eastern Intake-SUMMER 5m -1-5 5-5 7m -1-5 5-25 9m -5 25 5 Across shore [km] 3 2 1 3 3 11m 13m 15m 2 2-1 -1 1 2 3 15 1 5-5 -1 1 1 5-5 1-1 -1 1 2 3 5-5 -2-1 1-1 -1 1 2 3 15 1 1 19m 21m 23m 25m 1 5 5 27m -1-2 -1 29m -5-1 -15-2 -2-1 Along shore [km] -5-1 -2-1 -1-2 31m -3-3 -2-1 3 2 1-1 -1 1 2 3-5 17m -1-2 -1 Along shore []km] Along shore [km] 2-2 -4-2 2 4 4 2-2 -2 2 4 5 11m 27m -5-5 5 Across shore [km] 2-2 -4-2 2 4 13m -5-5 5 2 15m -2-4 -2 2 4 5 5 5 19m 21m 23m 25m -5-5 5 Across shore [km] 4 2-2 -2 2 4 17m -5-5 5 Figure A- 16 Progressive vector diagram at different depth layers in summer at the (A) Northern Intake site during the period September 2 th October 16 th, 21 and at the (B) Eastern Intake site during the period July 7 th September 2 nd, 21. RSS-REL-T5. Annex 1_page 23 of 132

-1-2 7m -3-1 1 2-1 -2 9m (A) MSS-SUMMER 11m -5-1 -15 13m -5-1 -15-3 -2-2 -1 1 2-1 1-1 1 5 7m -5-5 5 5 15m 5-5 -5 5 5 9m (B) IUI-SUMMER 5 11m -5-5 5 5 13m -5-5 5 1 1 17m 19m 21m Along shore [km] -5-1 15m -15-5 5 1-5 23m -5-1 17m -5-1 19m -1 21m -15-15 -15-5 5 1-5 5 1-5 5 1-5 25m -5 27m -5 29m -5 Along shore [km] -5-5 5 1-1 -5 5 23m -5-5 5 1-1 -5 5-1 -5 5-5 -1-5 5-1 -5 5 25m 27m 29m 31m 33m 35m -5-1 -5 5 37m -1-5 5 5 31m -1-5 5-1 -5 5 Cross shore [km] -1-5 5-5 -1-5 5-5 39m -5-1 -5 5 1 41m -5-1 -5 5-5 -1-5 5 Across shore [km] -5-5 5 Cross shore [km] -1-5 5-1 -5 5 Across shore [km] Figure A- 17 Progressive vector diagram at different depth layers in summer in front of the (A) MSS during the period July 1 st August 29 th, 21 and in front of the (B) IUI during the period August 12 th September 15 th, 21. RSS-REL-T5. Annex 1_page 24 of 132

Cross shore current [cms -1 ] -15-1 -5 5 1 Cross shore current [cms -1 ]; Site: Northern Intake-SUMMER 7m 17m 27m 15 27 29 1-Oct 3 5 7 Date (year 21) Long shore current [cms -1 ] -15-1 -5 5 1 Long shore current [cms -1 ]; Site: Northern Intake-SUMMER 7m 17m 27m 15 27 29 1-Oct 3 5 7 Date (year 21) Cross shore current [cms -1 ] 15 1 5-5 -1 Cross shore current [cms -1 ]; Site:Eastern Intake-SUMMER 7m 17m 27m -15 11-Jul 12 13 14 15 16 17 18 19 2 21 Date (year 21) Long shore current [cms -1 ] 3 2 1 Long shore current [cms -1 ]; Site:Eastern Intake-SUMMER -1 7m -2 17m 27m -3 11-Jul 12 13 14 15 16 17 18 19 2 21 Date (year 21) Cross shore current [cms -1 ] Cross shore Current [cms -1 ] 15 1 5 Cross shore current [cms -1 ]; Site: MSS-SUMMER -5 7m -1 17m 27m -15 11-Jul 12 13 14 15 16 17 18 19 2 21 Date (year 21) 15 1 5-5 -1 Cross shore Current [cms -1 ]; Site: IUI-SUMMER -15 1-Aug 2 3 4 5 6 7 8 9 1 11 Date (year 21) Long shore current [cms -1 ] Long shore Current [cms -1 ] 4 2-2 Long shore current [cms -1 ]; Site: MSS-SUMMER 7m 17m 27m -4 11-Jul 12 13 14 15 16 17 18 19 2 21 Date (year 21) 4 2-2 Long shore Current [cms -1 ]; Site: IUI-SUMMER -4 1-Aug 2 3 4 5 6 7 8 9 1 11 Date (year 21) Figure A- 18 Cross and long shore current [cms -1 ] components of a partial of the raw data (1 minutes interval) in summer at the Northern and Eastern Intake sites and in front of the MSS and IUI. RSS-REL-T5. Annex 1_page 25 of 132

Power [cm 2 s -2 cpd -1 ] 1 2 1 1 1 1-1 12.19h Northern Intake-SUMMER Power [cm 2 s -2 cpd -1 ] 1 3 1 2 1 1 1 1-1 12.19h 6.1h Eastern Intake-SUMMER 1-2 1-2 1-1 1 1 1 Frequency [cpd] 1-2 1-2 1-1 1 1 1 Frequency [cpd] Power [cm 2 s -2 cpd -1 ] 1 3 1 2 1 1 1 1-1 12.19h 6.1h 4.6h MSS-SUMMER Power [cm 2 s -2 cpd -1 ] 1 4 1 2 1 1-2 12.19h 6.1h IUI-SUMMER 1-2 1-2 1-1 1 1 1 Frequency [cpd] 1-4 1-2 1-1 1 1 1 Frequency [cpd] Figure A- 19 Spectrum of time series of the average current speed in overall entire coastal water column during summer at the Northern Intake, Eastern Intake, MSS and IUI sites. RSS-REL-T5. Annex 1_page 26 of 132

5 SUMMER 4 %Frequency 3 2 1 Northern Intake Eastern Intake MSS IUI 3 3 6 6 9 9 12 12 15 15 18 18 21 21 24 24 27 27 3 3 33 33 36 36 39 39 42 42 45 Current speed [cms 1 ] 5 4 SUMMER %Frequency 3 2 1 Northern Intake Eastern Intake MSS IUI 3 3 6 6 9 9 12 12 15 15 18 18 21 21 24 24 27 27 3 3 33 33 36 Current direction [ ] Figure A- 2 Percent frequency of current speed and direction during summer at the Eastern Intake, Northern Intake, MSS and IUI sites. RSS-REL-T5. Annex 1_page 27 of 132

Figure A- 21 Cross and long shore current [cms -1 ] components of the filtered data (2 days pass filter) in summer at the Northern and Eastern Intake sites and in front of the MSS and IUI. RSS-REL-T5. Annex 1_page 28 of 132

Table A- 11 Statistical summary of current speed (cms -1 ), current direction ( ), cross shore current (cms -1 ), long shore current (cms -1 ) and displacement rate (km day -1 ) in coastal waters at the Northern Intake site during summer (September 2 th October 16 th, 21). Speed (cms -1 ) Direction ( ) Cross shore (cms -1 ) Long shore (cms -1 ) Depth Mean SD Mean SD Mean SD Mean SD count Dis. rate (km/day) 3 6.5 3.92 174 33.8-3.7 4.22 2.5 4.42 3719 3.86 4 5.4 2.84 164 46.5-1.8 2.88 1.8 4.27 3719 2.2 5 4.3 2.69 117 59.9. 2.19 1. 4.46 3719.86 6 4.2 2.54 98 61.4.3 2.3.8 4.3 3719.77 7 4.1 2.53 76 61..6 2.1.7 4.22 3719.79 8 4. 2.41 66 61.9.7 1.97.6 4.12 3719.79 9 4. 2.39 56 61.7.8 1.99.4 4.8 3719.82 1 3.9 2.29 51 62.1.9 1.92.4 4. 3719.8 11 3.9 2.27 45 62.1.9 1.93.3 3.96 3719.79 12 3.8 2.19 41 62.7.8 1.86.2 3.89 3719.75 13 3.8 2.18 36 62.9.8 1.86.1 3.85 3719.72 14 3.7 2.12 31 63.4.8 1.8. 3.79 3719.67 15 3.7 2.11 24 63.5.7 1.81. 3.77 3719.63 16 3.6 2.6 17 64..7 1.75 -.1 3.71 3719.59 17 3.6 2.7 9 63.8.6 1.75 -.2 3.68 3719.56 18 3.5 2.3 1 64.1.6 1.68 -.3 3.65 3719.55 19 3.5 2.6 353 63.8.5 1.67 -.4 3.66 3719.55 2 3.5 2.3 345 63.8.5 1.62 -.4 3.63 3719.56 21 3.5 2.6 338 63.1.4 1.64 -.5 3.63 3719.58 22 3.4 2.3 331 62.7.4 1.62 -.6 3.58 3719.58 23 3.4 2.6 324 61.6.3 1.67 -.6 3.56 3719.6 24 3.4 2.3 316 61..2 1.7 -.7 3.49 3719.59 25 3.4 2.5 37 59.8.1 1.8 -.7 3.44 3719.6 26 3.4 2.2 296 58.9. 1.87 -.7 3.35 3719.61 27 3.3 2.5 286 57.5 -.2 1.99 -.7 3.29 3719.64 28 3.4 2.1 274 56.3 -.3 2.11 -.7 3.19 3719.69 29 3.4 2.4 264 54.7 -.5 2.28 -.7 3.13 3719.77 3 3.4 1.99 251 53. -.7 2.43 -.7 2.94 3719.88 31 3.5 2.5 241 5.7-1. 2.65 -.6 2.79 3719 1.2 RSS-REL-T5. Annex 1_page 29 of 132

Table A- 12 Statistical summary of current speed (cms -1 ), current direction ( ), cross shore current (cms -1 ), long shore current (cms -1 ) and displacement rate (km day -1 ) in coastal waters at the Eastern Intake site during summer (July 7 th September 2 nd, 21). Speed (cms -1 ) Direction ( ) Cross shore (cms -1 ) long shore (cms -1 ) count Dis. rate (km/day) Depth Mean SD Mean SD Mean SD Mean SD 3 6.8 4.8 19 13.4.7 2.88-2.3 7.45 8246 2.7 4 6.5 4.7 186 13.1.8 2.69-1.9 7.29 8246 1.74 5 6.3 4.6 18 13.7.8 2.6-1.4 7.19 8246 1.41 6 6.1 4.5 179 13.3.7 2.51-1.2 7.2 8246 1.18 7 5.9 4.5 177 13.5.6 2.49 -.9 6.9 8246.94 8 5.8 4.3 175 13.3.5 2.42 -.7 6.73 8246.75 9 5.6 4.3 171 13.7.4 2.41 -.5 6.59 8246.56 1 5.5 4.1 166 13.5.3 2.34 -.4 6.41 8246.41 11 5.3 4.1 155 13.9.2 2.32 -.2 6.26 8246.26 12 5.1 3.9 126 13.1.2 2.25. 6.4 8246.16 13 5. 3.9 72 13.5.1 2.26.1 5.86 8246.16 14 4.8 3.8 43 13.2.1 2.2.2 5.67 8246.22 15 4.7 3.7 29 13.6. 2.19.4 5.52 8246.32 16 4.5 3.6 22 13.5 -.1 2.12.5 5.35 8246.42 17 4.4 3.6 17 14.1 -.1 2.1.6 5.22 8246.52 18 4.3 3.5 14 14. -.2 2.2.7 5.5 8246.6 19 4.1 3.4 11 14.6 -.2 2..8 4.92 8246.69 2 4. 3.3 8 14.5 -.3 1.93.8 4.75 8246.74 21 3.9 3.3 5 15. -.4 1.92.9 4.62 8246.8 22 3.7 3.2 4 15.2 -.4 1.83.9 4.41 8246.84 23 3.6 3.1 3 16.1 -.4 1.8.9 4.25 8246.87 24 3.4 3. 2 16.6 -.5 1.73.9 4.3 8246.91 25 3.3 2.9 1 18.1 -.5 1.72 1. 3.86 8246.94 26 3.1 2.7 358 19.1 -.6 1.69 1. 3.56 8246.99 27 3. 2.6 355 21.5 -.7 1.73 1. 3.31 8246 1.3 RSS-REL-T5. Annex 1_page 3 of 132

Table A- 13 Statistical summary of current speed (cms -1 ), current direction ( ), cross shore current (cms -1 ), long shore current (cms -1 ) and displacement rate (km day -1 ) in coastal waters at the MSS site during summer (July 1 st August 28 th, 21). Speed (cms -1 ) Direction ( ) Cross shore (cms -1 ) Long shore (cms -1 ) count Dis. rate (km/day) Depth Mean SD Mean SD Mean SD Mean SD 7 9.6 6.6 199 28.6.8 2. -5. 1.3 844 4.33 8 9.3 6.4 198 28.5.8 1.78-4.5 1.18 844 3.97 9 9.1 6.4 198 28.6.8 1.68-4.1 1.14 844 3.62 1 8.9 6.3 197 28.7.7 1.54-3.8 1.3 844 3.34 11 8.7 6.2 197 28.9.7 1.51-3.5 9.97 844 3.6 12 8.5 6.1 197 29..6 1.41-3.2 9.84 844 2.82 13 8.4 6. 197 29.2.6 1.42-2.9 9.76 844 2.59 14 8.2 5.9 197 29.3.5 1.36-2.7 9.61 844 2.4 15 8.1 5.8 198 29.5.4 1.4-2.5 9.5 844 2.21 16 7.9 5.7 199 29.6.4 1.37-2.4 9.36 844 2.7 17 7.8 5.6 2 29.8.3 1.44-2.2 9.25 844 1.93 18 7.7 5.4 21 29.8.3 1.42-2.1 9.5 844 1.81 19 7.5 5.3 22 29.9.2 1.48-1.9 8.89 844 1.68 2 7.3 5. 23 29.7.1 1.45-1.8 8.58 844 1.57 21 7.1 4.8 25 29.6.1 1.52-1.7 8.32 844 1.45 22 7.1 4.8 28 29.9. 1.51-1.7 8.29 844 1.45 23 7.1 4.9 211 3.3 -.1 1.6-1.7 8.3 844 1.46 24 6.8 4.7 215 3.1 -.2 1.56-1.6 7.94 844 1.42 25 6.6 4.5 219 3.2 -.3 1.63-1.6 7.64 844 1.37 26 6.2 4.2 222 3.5 -.4 1.63-1.4 7.16 844 1.29 27 5.8 4.1 226 31.1 -.4 1.74-1.3 6.74 844 1.2 28 5.5 3.8 232 31.9 -.5 1.77-1.2 6.25 844 1.12 29 5.1 3.7 24 33.2 -.6 1.92-1. 5.85 844 1.4 3 4.5 3. 25 33.7 -.7 1.84 -.8 4.92 844.89 31 3.8 2.6 265 35.2 -.8 1.91 -.5 4.12 844.78 RSS-REL-T5. Annex 1_page 31 of 132

Table A- 14 Statistical summary of current speed (cms -1 ), current direction ( ), cross shore current (cms -1 ), long shore current (cms -1 ) and displacement rate (km day -1 ) in coastal waters at the IUI site during summer (July 28 th, 21 August 2 th, 21). Speed (cms -1 ) Direction ( ) Cross shore (cms -1 ) Long shore (cms -1 ) count Dis. rate (km/day) Depth Mean SD Mean SD Mean SD Mean SD 7 9.6 6.76 22 39.2. 1.9-2.1 11.38 668 1.82 8 9.4 6.63 219 39.2. 1.76-2. 11.18 668 1.74 9 9.2 6.62 218 39.3.1 1.86-1.9 11.5 668 1.67 1 9.1 6.47 218 39.4.1 1.74-1.8 1.84 668 1.59 11 8.9 6.47 217 39.5.1 1.87-1.8 1.72 668 1.52 12 8.9 6.27 218 39.6.1 1.77-1.7 1.54 668 1.51 13 8.8 6.21 218 39.7.1 1.9-1.7 1.46 668 1.51 14 8.8 6.4 219 39.7. 1.8-1.8 1.31 668 1.56 15 8.7 6. 22 39.6. 1.92-1.9 1.25 668 1.61 16 8.7 5.9 221 39.6. 1.8-2. 1.14 668 1.77 17 8.7 5.93 221 39.6. 1.88-2.2 1.11 668 1.92 18 8.7 5.88 221 39.4. 1.74-2.5 1.4 668 2.13 19 8.7 5.97 221 39.4. 1.79-2.7 1.4 668 2.35 2 8.8 5.96 22 39.4. 1.67-3. 1.3 668 2.56 21 8.8 6.7 22 39.4. 1.75-3.2 1.9 668 2.77 22 8.9 6.2 219 39.3.1 1.63-3.4 1.6 668 2.95 23 9. 6.8 218 39.3.1 1.72-3.6 1.1 668 3.12 24 9. 6.3 218 39.2.1 1.59-3.8 1.6 668 3.26 25 9.1 6.8 218 39..1 1.65-3.9 1.7 668 3.39 26 9.1 6. 218 38.8.1 1.55-4. 9.97 668 3.49 27 9.1 6. 218 38.7.1 1.65-4.2 9.91 668 3.6 28 9. 5.92 218 38.3.2 1.53-4.2 9.8 668 3.66 29 9. 5.92 218 38.1.2 1.6-4.3 9.74 668 3.72 3 8.9 5.84 218 37.8.1 1.48-4.3 9.6 668 3.73 31 8.8 5.84 218 37.7.1 1.55-4.3 9.52 668 3.74 32 8.7 5.73 218 37.5.1 1.45-4.3 9.35 668 3.74 33 8.6 5.7 219 37.4.1 1.53-4.3 9.23 668 3.73 34 8.5 5.59 219 37.3.1 1.42-4.3 9.8 668 3.71 35 8.4 5.57 218 37.2.1 1.49-4.3 8.98 668 3.68 36 8.3 5.46 218 37.1.2 1.41-4.2 8.84 668 3.62 37 8.2 5.43 217 37..2 1.51-4.1 8.76 668 3.56 38 8. 5.26 216 37..3 1.46-4. 8.52 668 3.49 RSS-REL-T5. Annex 1_page 32 of 132

Speed (cms -1 ) Direction ( ) Cross shore (cms -1 ) Long shore (cms -1 ) count Dis. rate (km/day) Depth Mean SD Mean SD Mean SD Mean SD 39 7.8 5.16 215 37..4 1.57-3.9 8.34 668 3.41 4 7.4 4.74 212 37.4.5 1.52-3.7 7.81 668 3.2 41 7. 4.43 29 38..7 1.66-3.4 7.34 668 2.99 Subsurface current in the in the vicinity of the intakes during winter The second deployments for the ADCPs in the vicinity of the intakes and in front of the IUI and MSS were performed during winter 21-211. In general, the current pattern during winter at the four sites (Eastern Intake, Northern Intake, MSS and IUI) had different patterns, which could be attributed to the difference of geographical features and locations, as in summer. The current records in the Northern Intake Site during January 211 revealed a similar pattern also in summer in terms of a gradual anti-clockwise current rotation, but here with less total angular rotation of about 12 that started from northward at 15 m depth to southwestward near the bottom (Figure A- 22 and Figure A- 23). Besides, there was a feature at each depth in the entire of 5-31 m water column, where a harmonic current reversal along the shoreline was observed. The current records in the Eastern Intake Site during January-February 211 showed two current patterns in the 3-31 m water column, where south-southwestward current dominated in 7-19 m and west-southwestward below 21 m. The transition layer between the two current patterns occurred around 21 m depth. The current reversal feature along the shoreline is associated with the general pattern at each depth in the coastal waters (Figure A- 22 and Figure A- 23). The current records in front of the Marine Science station during December 21 January 211 had a similar as in summer. Two main patterns were observed in the 7-31 water column. A southwestward current dominated above 19 m water columns, where a west-westward current near the bottom was recorded. Besides, a slight clockwise rotation of current direction and a decrease of current magnitude with respect to depth from southward at 21 m to westward near the bottom were observed. The current reversal feature along the shoreline clearly existed in the coastal waters at the MSS site (Figure A- 22 and Figure A- 24). The current pattern in front of the IUI during December 21 January 211 was mostly opposite in direction compared to the currents in front of the MSS. Two main patterns were observed in the 7-41 water column. A northwestward current dominated above 27 m water columns, while a southeastward current was recorded below 27 m depth. Again, the current reversal was observed at IUI site as it was detected at the other sites (Figure A- 22 and Figure A- 24). Possible explanation for the changes in the current directions were provided above. In winter, the long shore current component was stronger than the cross shore current component at all sites (Figure A- 25). The maximum current speed that was recorded at the Eastern Intake, Northern Intake, MSS and IUI sites were about (4 cms -1 at 5 m; 3 cms -1 near the bottom), (3 cms - RSS-REL-T5. Annex 1_page 33 of 132

1 at 3 m; 2 cms -1 near the bottom), (4 cms -1 at 7 m; 25 cms -1 near the bottom) and (4 cms -1 at 7 m; 3 cms -1 near the bottom), respectively. The spectral analysis of time series data of the average current speed in overall entire coastal water column during winter at all sites revealed that no tidal current signals existed at the Northern Intake site. On the other hand, the common current signals that were detected for all other sites were the semidiurnal (12.19 h: principle lunar M2) and lunar or/and solar quarter-diurnal harmonics (6.1 h: M4; S4; MS4). Besides, another signal of 4.6 and 4.27 was found at the Eastern Intake and MSS sites, respectively, which is attributed to lunar and solar sixth diurnal harmonics (2MS6; 2SM6). Shorter signals (3.16 h and 2.51 h) were detected only at the Eastern Intake site during winter, which assumed to be attributed to the M8 and M1 tidal constituents, respectively (Figure A- 26). The percent frequency of the current speed below 1 cms -1 at the Northern Intake and Eastern Intakes sites were about 85%, while it was about 46% and 6% at the MSS and IUI sites, respectively. The current speed at the MSS and IUI sites was relatively stronger than the Northern and Eastern Intake sites. The percent frequency of speed stronger than 2 cms -1 was 1% at the MSS and IUI sites compared to about 1% at the Eastern and Northern Intake sites. The dominant percent frequency of current direction was 36% for 27-33 and 2% for 9-15 at Northern Intake site; 28% for -6 and 41% for 18-24 at the Eastern Intake site; 46% for 15-21 and 31% for 33-3 at the MSS site; and 3% for 18-24 and 37% for -6 at the IUI site (Figure A- 27). In order to remove the tidal effect in the current records, a two days pass filter of the row data was performed (Figure A- 28). The outcome of the filtered data revealed a longer periodic time of average 2-4 days were found for all sites, which is similar to these results during summer. This periodic change of current speed and direction represents the current reversal that was detected in the progressive vector diagram (Figure A- 23 and Figure A- 24). Besides, the current speed during winter as well as during summer becomes stronger when the current direction switches to eastward at the Northern Intake site and to southward at the other sites. The average values of current speed and direction during the recording intervals during winter in whole entire water column at the Northern Intake, Eastern Intake, MSS and IUI sites were (5.2 ±.32 cms -1 and 312 ± 29.5 ), (5.6 ±.34 cms -1 and 188 ± 59.1 ), (1.3 ±.9 cms -1, 18 ± 65.8 ) and (9.2 ±.54 cms -1, 312 ± 39.5), respectively. The statistical summary of current data measurements in the entire coastal water column at all sites during winter are shown in Table A- 15 - Table A- 18. RSS-REL-T5. Annex 1_page 34 of 132

Figure A- 22 Cross and long shore current [cms -1 ] components of the raw data in winter at the Northern and Eastern Intake sites and in front of the MSS and IUI. RSS-REL-T5. Annex 1_page 35 of 132

(B) Northern Intake-WINTER (B) Eastern Intake-WINTER 5 5 5 5 5m 7m 9m 11m -5-5 5-5 -5-5 -5 5-5 5-5 5 4 2-2 -4 4 4 4 7m 9m 11m 13m 2 2 2-6 -4-2 2 4 6-2 -4-6 -4-2 2 4 6-2 -4-6 -4-2 2 4 6-2 -4-6 -4-2 2 4 6 Across shore [km] 5 5 5 5 13m 15m 17m 19m -5-5 5 5-5 -5 5 2-2 -4-6 21m 29m -8-5 5-5 -5 5 5-5 -5 5 2-2 -4-6 -5-5 5 5 5 23m 25m 27m 31m -8-5 5 Along shore [km] -5-5 5-5 -5 5-5 -5 5 Along shore [km] Along shore [km] 4 4 4 4 15m 17m 19m 21m 2 2 2 2-2 -4-6 -4-2 2 4 6-6 -4-2 2 4 6 5 31m -5-1 -5 Across shore [km] -2-4 -6-4-2 2 4 6-2 -4-6 -4-2 2 4 6 4 4 4 2 23m 25m 27m 29m 2 2 2-2 -2-2 -2-4 -4-4 -4-6 -4-2 2 4 6-6 -4-2 2 4 6 Across shore [km] -2-4 -6-4-2 2 4 6-6 -1-5 Figure A- 23 Progressive vector diagram at different depth layers in winter at the (A) Northern Intake site during the period January 6 th 27 th, 21 and at the (B) Eastern Intake site during the period January 5 th February 25 th, 21. RSS-REL-T5. Annex 1_page 36 of 132

Along shore [km] 4 2-2 -4-6 5 1 2 15m -2-4 -6-8 -5 5 2-2 -4-6 31m -5 7m -8-5 5-1 -1-5 Across shore [km] 4 2-2 -4-6 5 1 2-2 -4-6 -8-5 5-2 -4-6 9m 17m (B) MSS-WINTER -8-5 5 4 11m 2-2 -4-6 5 1 2 19m -2-4 -6-8 -5 5 4 13m 2-2 -4-6 5 1 2 21m 2 2 23m 25m 27m 29m -2-4 -6-8 -5 5 Across shore [km] -2-4 -6-8 -5 5-5 -1-1 -5 Along shore [km] 5 5 5 5 7m 9m 11m 13m -5-5 5-5 -5 5-5 -5 5-5 -5 5 5 5 5 5 15m 17m 19m 21m 5-5 -5 5 5-5 -5 5-5 -5 5-5 -5 5-5 -5 5-5 -5 5 5 5 5 23m 25m 27m 29m -5-5 5 2-2 31m 39m -4 5 1 5 33m -5-5 5 2-2 41m Across shore [km] -4 5 1 (B) IUI-WINTER -5-5 5 5 35m -5-5 5-5 -5 5 2 37m -2-4 5 1 Across shore [km] Figure A- 24 Progressive vector diagram at different depth layers in winter in front of the (A) MSS during the period December 5 th January 2 nd, 21 and in front of the (B) IUI during the period December 16 th, 21 January 7 th, 211. RSS-REL-T5. Annex 1_page 37 of 132

Cross shore current [cms -1 ] 1 5-5 Cross shore current [cms -1 ]; Site: Northern Intake-WINTER 7m 17m 27m -1 13 15 17 19 21 23 Date (year 211) Long shore current [cms -1 ] 2 1-1 -2 Long shore current [cms -1 ]; Site: Northern Intake-WINTER 7m 17m 27m -3 13 15 17 19 21 23 Date (year 211) Cross shore current [cms -1 ] Cross Long shore current [cms -1 ] Cross shore Current [cms -1 ] Cross shore current [cms -1 ]; Site: Eastern Intake-WINTER 1 5-5 -1 13-Jan 14 15 16 17 18 19 2 21 22 23 Date (year 211) Cross Long shore current [cms -1 ]; Site: MSS-WINTER 2 1-1 -2 24 26 28 3 1-Jan Date (year 21-211) Cross shore Current [cms -1 ]; Site: IUI-WINTER 2 1-1 -2 24 26 28 3 1-Jan Date (year 21-211) Long shore current [cms -1 ] Long Long shore current [cms -1 ] Long shore Current [cms -1 ] 3 2 1-1 Long shore current [cms -1 ]; Site: Eastern Intake-WINTER -2 13-Jan 14 15 16 17 18 19 2 21 22 23 Date (year 211) 3 2 1-1 -2-3 3 2 1-1 -2-3 Long Long shore current [cms -1 ]; Site: MSS-WINTER 24 26 28 3 1-Jan Date (year 21-211) Long shore Current [cms -1 ]; Site: IUI-WINTER 24 26 28 3 1-Jan Date (year 21-211) Figure A- 25 Cross and long shore current [cms -1 ] components of a partial of the raw data (1 minutes interval) in winter at the Northern and Eastern Intake sites and in front of the MSS and IUI. RSS-REL-T5. Annex 1_page 38 of 132

Power [cm 2 s -2 cpd -1 ] 1 3 1 2 1 1 1 1-1 Northern Intake-WINTER Power [cm 2 s -2 cpd -1 ] 1 3 1 2 1 1 1 1-1 12.19h 6.1h 4.6h 3.16h 2.51h Eastern Intake-WINTER 1-2 1-2 1-1 1 1 1 Frequency [cpd] 1-2 1-2 1-1 1 1 1 Frequency [cpd] 1 3 1 2 12.19h 6.1h 4.27h MSS-WINTER 1 3 1 2 12.19h 6.1h IUI-W INTER Power [cm 2 s -2 cpd -1 ] 1 1 1 1-1 Power [cm 2 s -2 cpd -1 ] 1 1 1 1-1 1-2 1-2 1-1 1 1 1 Frequency [cpd] 1-2 1-2 1-1 1 1 1 Frequency [cpd] Figure A- 26 Spectrum of time series of the average current speed in overall entire coastal water column during winter at the Northern Intake, Eastern Intake, MSS and IUI sites. RSS-REL-T5. Annex 1_page 39 of 132

4 35 WINTER %Frequency 3 25 2 15 1 5 Northern Intake Eastern Intake MSS IUI 3 3 6 6 9 9 12 12 15 15 18 18 21 21 24 24 27 27 3 3 33 33 36 36 39 39 42 42 45 Current speed [cms 1 ] 4 35 WINTER %Frequency 3 25 2 15 1 5 Northern Intake Eastern Intake MSS IUI 3 3 6 6 9 9 12 12 15 15 18 18 21 21 24 24 27 27 3 3 33 33 36 Current direction [ ] Figure A- 27 Percent frequency of current speed and direction during winter at the Eastern Intake, Northern Intake, MSS and IUI sites. RSS-REL-T5. Annex 1_page 4 of 132

Figure A- 28 Cross and long shore current [cms -1 ] components of the filtered data (2 days pass filter) in winter at the Northern and Eastern Intake sites and in front of the MSS and IUI. RSS-REL-T5. Annex 1_page 41 of 132

Table A- 15 Statistical summary of current speed (cms -1 ), current direction ( ), cross shore current (cms -1 ), long shore current (cms -1 ) and displacement rate (km day -1 ) in coastal waters at the Northern Intake site during winter (January 6 th -27 th, 211). Speed (cms -1 ) Direction ( ) Cross shore (cms -1 ) Long shore (cms -1 ) count Dis. rate (km/day) Depth Mean SD Mean SD Mean SD Mean SD 5 5.4 3.77 356 58.3 1.6 1.93-1. 6.3 2968 1.64 6 5.4 3.73 358 58.6 1.6 1.86-1. 6.2 2968 1.68 7 5.5 3.71 359 58.7 1.7 1.85 -.9 6.4 2968 1.72 8 5.5 3.67 359 58.9 1.7 1.8 -.9 6.1 2968 1.72 9 5.5 3.66 359 58.9 1.7 1.81 -.9 6.1 2968 1.71 1 5.4 3.63 358 59. 1.6 1.76 -.9 5.98 2968 1.67 11 5.4 3.62 358 59.1 1.6 1.77 -.9 5.96 2968 1.63 12 5.3 3.6 356 59.2 1.5 1.72 -.9 5.92 2968 1.55 13 5.2 3.59 355 59.1 1.4 1.72 -.9 5.9 2968 1.47 14 5.2 3.58 353 59.3 1.3 1.67 -.9 5.87 2968 1.4 15 5.2 3.58 351 59.3 1.2 1.66 -.9 5.87 2968 1.32 16 5.1 3.57 347 59.5 1.1 1.61 -.9 5.84 2968 1.25 17 5. 3.58 343 59.6.9 1.6 -.9 5.83 2968 1.17 18 5. 3.56 336 59.9.7 1.55-1. 5.81 2968 1.1 19 5. 3.57 328 6..6 1.55-1. 5.8 2968 1.3 2 4.9 3.52 318 6.2.4 1.51-1. 5.74 2968.98 21 4.9 3.5 36 6.2.1 1.52-1. 5.7 2968.96 22 4.9 3.53 292 6.6 -.1 1.51-1.1 5.7 2968.99 23 4.8 3.5 28 6.6 -.4 1.55-1.1 5.65 2968 1.5 24 4.9 3.43 268 6.7 -.7 1.55-1.1 5.58 2968 1.19 25 4.9 3.46 259 6.9-1. 1.63-1.2 5.58 2968 1.37 26 5. 3.37 25 61.1-1.4 1.68-1.2 5.48 2968 1.62 27 5.1 3.39 245 61.3-1.7 1.81-1.3 5.45 2968 1.89 28 5.3 3.33 239 61.5-2.2 1.93-1.3 5.35 2968 2.24 29 5.5 3.31 235 61.4-2.7 2.12-1.4 5.25 2968 2.61 3 5.8 3.19 23 61.3-3.3 2.38-1.4 4.96 2968 3.12 31 6.1 3.17 227 6.2-4. 2.73-1.4 4.68 2968 3.65 RSS-REL-T5. Annex 1_page 42 of 132

Table A- 16 Statistical summary of current speed (cms -1 ), current direction ( ), cross shore current (cms -1 ), long shore current (cms -1 ) and displacement rate (km day -1 ) in coastal waters at the Eastern Intake site during winter (January 5 th February 2 th, 211). Speed (cms -1 ) Direction ( ) Cross shore (cms -1 ) long shore (cms -1 ) count Dis. rate (km/day) Depth Mean SD Mean SD Mean SD Mean SD 7 6.2 3.99 151 22.6 1.3 2.2 -.9 6.95 6577 1.37 8 6.2 3.93 149 22.6 1.3 2.1 -.8 6.87 6577 1.34 9 6.1 3.9 147 22.8 1.3 2.4 -.7 6.82 6577 1.31 1 6.1 3.88 148 22.7 1.3 2.1 -.7 6.77 6577 1.26 11 6. 3.88 148 22.9 1.2 2.3 -.7 6.74 6577 1.22 12 6. 3.85 149 22.8 1.2 1.99 -.7 6.68 6577 1.17 13 5.9 3.85 15 22.9 1.1 2.1 -.7 6.65 6577 1.11 14 5.9 3.82 152 22.7 1. 1.96 -.7 6.59 6577 1.5 15 5.8 3.81 154 22.8.9 1.96 -.7 6.55 6577 1. 16 5.7 3.78 157 22.5.8 1.91 -.7 6.51 6577.94 17 5.7 3.77 16 22.5.8 1.9 -.7 6.47 6577.88 18 5.6 3.74 167 22.2.6 1.82 -.7 6.44 6577.8 19 5.6 3.73 176 22.1.4 1.8 -.7 6.42 6577.72 2 5.6 3.71 186 21.8.3 1.75 -.8 6.4 6577.7 21 5.6 3.7 196 21.8.2 1.75 -.8 6.39 6577.69 22 5.5 3.6 28 21.5. 1.7 -.9 6.29 6577.74 23 5.5 3.53 219 21.4 -.2 1.7 -.9 6.21 6577.81 24 5.4 3.49 228 21.3 -.3 1.65-1. 6.15 6577.88 25 5.4 3.48 235 21.4 -.5 1.66-1. 6.11 6577.97 26 5.4 3.41 244 21.5 -.7 1.61-1. 6. 6577 1.7 27 5.3 3.37 25 22. -.9 1.63-1. 5.92 6577 1.19 28 5.2 3.2 259 22.4-1.2 1.64-1. 5.69 6577 1.34 29 5.2 3.9 266 23.3-1.5 1.73 -.9 5.48 6577 1.52 3 5.1 2.87 276 24.8-1.9 1.83 -.7 5.11 6577 1.75 31 5. 2.74 285 27.2-2.3 2.2 -.5 4.78 6577 2.3 RSS-REL-T5. Annex 1_page 43 of 132

Table A- 17 Statistical summary of current speed (cms -1 ), current direction ( ), cross shore current (cms -1 ), long shore current (cms -1 ) and displacement rate (km day -1 ) in coastal waters at the MSS site during winter (December 5 th, 21 January 2 nd, 211). Speed (cms -1 ) Direction ( ) Cross shore (cms -1 ) Long shore (cms -1 ) count Dis. rate (km/day) Depth Mean SD Mean SD Mean SD Mean SD 7 11.5 6.21 138 15.1 3.3 4.11-1.2 11.88 3997 2.98 8 11.4 6.21 139 14.3 3.1 3.91-1.2 11.86 3997 2.78 9 11.2 6.24 141 14.5 2.8 3.89-1.2 11.85 3997 2.58 1 11.2 6.24 141 14.4 2.7 3.85-1.2 11.83 3997 2.48 11 11.1 6.26 142 14.6 2.6 3.85-1.1 11.82 3997 2.38 12 11. 6.23 144 14.5 2.4 3.82-1.2 11.77 3997 2.28 13 11. 6.24 145 14.6 2.3 3.82-1.2 11.76 3997 2.18 14 1.9 6.21 149 14.4 2. 3.78-1.2 11.71 3997 2.1 15 1.8 6.21 154 14.4 1.8 3.78-1.3 11.65 3997 1.85 16 1.7 6.17 158 14.4 1.6 3.74-1.3 11.6 3997 1.76 17 1.7 6.16 162 14.5 1.4 3.72-1.4 11.58 3997 1.67 18 1.6 6.8 167 14.5 1.2 3.66-1.4 11.46 3997 1.61 19 1.4 5.99 173 14.6 1. 3.62-1.5 11.34 3997 1.57 2 1.1 5.6 181 14.6.9 3.49-1.7 1.88 3997 1.62 21 9.8 5.3 189 14.8.7 3.39-1.9 1.47 3997 1.71 22 1. 5.47 197 14.8.4 3.39-1.9 1.71 3997 1.64 23 1.2 5.71 26 14.9.1 3.41-1.9 1.99 3997 1.61 24 1. 5.45 215 15. -.2 3.32-2. 1.69 3997 1.74 25 9.8 5.21 223 15.2 -.6 3.25-2.2 1.41 3997 1.91 26 9.7 4.96 231 15.5-1. 3.15-2.3 1.8 3997 2.16 27 9.5 4.73 237 16. -1.4 3.9-2.5 9.76 3997 2.44 28 9.4 4.49 245 16.9-1.9 3.3-2.6 9.4 3997 2.79 29 9.3 4.32 251 18.3-2.5 3.7-2.7 9.7 3997 3.18 3 8.6 3.61 259 2.6-3.1 2.95-2.5 7.84 3997 3.4 31 7.8 3.14 267 24.6-3.7 2.96-2.2 6.66 3997 3.69 RSS-REL-T5. Annex 1_page 44 of 132

Table A- 18 Statistical summary of current speed (cms -1 ), current direction ( ), cross shore current (cms -1 ), long shore current (cms -1 ) and displacement rate (km day -1 ) in coastal waters at the IUI site during winter (December 16 th, 21 January 7 th, 211). Speed (cms -1 ) Direction ( ) Cross shore (cms -1 ) Long shore (cms -1 ) count Dis. rate (km/day) Depth Mean SD Mean SD Mean SD Mean SD 7 9. 6.45 291 41.7-1.7 2.8 -.6 1.53 6223 1.57 8 9.6 6.61 39 39.6-2.1 2.56. 11.1 6223 1.78 9 1.1 6.95 322 37.3-2.4 2.65.5 11.75 6223 2.13 1 1.1 6.9 322 37.5-2.3 2.61.5 11.69 6223 2.4 11 1. 6.88 322 37.6-2.2 2.65.5 11.66 6223 1.96 12 1. 6.87 323 37.6-2.1 2.62.5 11.63 6223 1.87 13 9.9 6.87 323 37.7-2. 2.63.5 11.61 6223 1.79 14 9.9 6.84 323 37.7-1.9 2.58.4 11.57 6223 1.7 15 9.8 6.84 323 37.8-1.8 2.59.4 11.54 6223 1.62 16 9.8 6.82 324 37.9-1.7 2.53.4 11.49 6223 1.52 17 9.7 6.81 324 38. -1.6 2.53.4 11.46 6223 1.42 18 9.6 6.79 325 38. -1.5 2.46.4 11.41 6223 1.3 19 9.5 6.8 325 38. -1.3 2.46.4 11.38 6223 1.19 2 9.5 6.78 326 38. -1.2 2.39.3 11.33 6223 1.7 21 9.4 6.78 326 38.1-1. 2.38.3 11.3 6223.94 22 9.3 6.77 326 38.2 -.9 2.3.3 11.26 6223.82 23 9.3 6.78 327 38.2 -.8 2.29.2 11.23 6223.69 24 9.2 6.75 327 38.3 -.6 2.2.2 11.17 6223.55 25 9.1 6.75 326 38.5 -.5 2.18.1 11.12 6223.42 26 9.1 6.72 325 38.6 -.3 2.12.1 11.7 6223.26 27 9. 6.71 321 38.8 -.1 2.12. 11.2 6223.11 28 8.9 6.68 157 38.9.1 2.6. 1.96 6223.6 29 8.9 6.67 15 39..3 2.7 -.1 1.9 6223.24 3 8.8 6.59 148 39.4.7 1.99 -.2 1.8 6223.6 31 8.8 6.56 147 39.8 1.1 2.7 -.3 1.72 6223.97 32 8.8 6.5 146 4. 1.3 2.5 -.4 1.65 6223 1.2 33 8.8 6.46 145 4.3 1.6 2.11 -.4 1.58 6223 1.42 34 8.8 6.36 144 4.6 1.9 2.1 -.5 1.45 6223 1.67 35 8.8 6.28 143 41. 2.2 2.16 -.5 1.33 6223 1.91 36 8.7 6.9 142 41.4 2.5 2.17 -.5 1.12 6223 2.17 37 8.7 5.93 141 41.9 2.8 2.25 -.6 9.92 6223 2.43 38 8.7 5.66 14 42.6 3. 2.28 -.6 9.59 6223 2.66 RSS-REL-T5. Annex 1_page 45 of 132

Speed (cms -1 ) Direction ( ) Cross shore (cms -1 ) Long shore (cms -1 ) count Dis. rate (km/day) Depth Mean SD Mean SD Mean SD Mean SD 39 8.6 5.42 14 43.4 3.3 2.38 -.6 9.28 6223 2.9 4 8.3 5.2 139 44.2 3.5 2.4 -.5 8.74 6223 3.2 41 8.1 4.66 138 45.1 3.6 2.49 -.5 8.22 6223 3.15 Subsurface current in the in the vicinity of the intakes during spring The last experiment for the subsurface current monitoring for this project using the ADCPs in the vicinity of the intakes and in front of the IUI and MSS were performed during spring 21-211. In general, the current pattern during winter at the four sites (Eastern Intake, Northern Intake, MSS and IUI) almost had different pattern as well as during summer and winter, which could be attributed to the difference of its geographical feature and location. The current records in the Northern Intake Site during April-May 211 revealed the same pattern during summer and winter in term of existing of a gradual anti-clockwise current rotation, but here with larger total angular rotation of about 3 that started from southward (~17 ) at 5 m depth to southwestward (~23 ) near the bottom (Figure A- 22 and Figure A- 23). Besides as well as in the other seasons- there was a manifested feature at each depth in the entire of 5-31 m water column, where a harmonic current reversal along the shoreline was observed. The current records in the Eastern Intake Site during April-May 211 showed two current patterns in the 3-31 m water column, where southward current dominated in 11-23 m and westward below in 25-31 m. The transition layer between the two current patterns occurred around 24 m depth. The current reversal feature along the shoreline associated the general pattern at each depth in the coastal waters (Figure A- 22 and Figure A- 23). The current records in front of the Marine Science station during February-April 211 had mostly the same pattern during other seasons. Two main different patterns were observed in the 3-31 water column. A southward current dominated above 21 m water columns, where a nearly westward current near the bottom was recorded. Besides, a slight clockwise rotation of current direction and a decrease of current magnitude with respect to depth from southward at 21 m to westward near the bottom were observed. The current reversal feature along the shoreline was clearly existed in the coastal waters at the MSS site (Figure A- 22 and Figure A- 24). The current pattern in front of the IUI during March-April 211 was mostly similar during summer; as well it has the same pattern compared to the current in front of the MSS during spring. A stable southward current dominated in the all entire of the water column in front of the IUI during spring. Again, a current reversal phenomenon was observed at IUI site as it was detected at the other sites, but with a clear reduction in recurrence during spring at IUI (Figure A- 22 and Figure A- 24). In spring - as well as in summer and winter-, the long shore current component was stronger than the cross shore current component at all sites (Figure A- 25). The maximum current speed that was recorded at the Eastern Intake, Northern Intake, MSS and IUI sites were about (3 cms -1 at 11 m; 2 RSS-REL-T5. Annex 1_page 46 of 132

cms -1 near the bottom), (35 cms -1 at 3 m; 25 cms -1 near the bottom), (35 cms -1 at 3 m; 15 cms -1 near the bottom) and (4 cms -1 at 9 m; 35 cms -1 near the bottom), respectively. The spectrum analysis of time series data of the average current speed in overall entire coastal water column during winter at all sites revealed that no any tidal current signals existed at the Northern Intake site. On the other hand, the common current signals that were detected for all other sites were the semidiurnal (12.19 h: principle lunar M2). Besides, another signal of 6.1 h (lunar or/and solar quarter-diurnal harmonics (M4; S4; MS4)) was found only at the MSS and IUI sites. The shorter signals (<6.1 h) that were detected during summer and winter, particularly at the Eastern Intake and MSS sites, was absent at all sites during sprin (Figure A- 26). The percent frequency of the current speed below 1 cms -1 at the Northern Intake and Eastern Intakes sites were about 9 and 88%, respectively, where it were about 57%, % and 6% at the MSS and IUI sites, respectively. The current speed at the MSS and IUI sites was relatively stronger than the Northern and Eastern Intake sites. The percent frequency of speed stronger than 2 cms -1 was about 9% at the MSS and 14% at the IUI compared to about 1% at the Eastern and Northern Intake sites. The dominant percent frequency of current direction was 31% for 27-33 and 34% for 9-15 at Northern Intake site; 3% for -6 and 42% for 15-21 at the Eastern Intake site; 51% for 18-24 and 27% for -6 at the MSS site; and 58% for 18-24 and 22% for -6 at the IUI site (Figure A- 27). In order to ignore the tidal effect in the current records, a two days pass filter of the row data was performed (Figure A- 28). The outcome of the filtered data revealed a longer periodic time of average 2-4 days were found for all sites, which is similar to those results during summer and winter. This periodic change of current speed and direction represents the current reversal that was detected in the progressive vector diagram (Figure A- 23 and Figure A- 24). Besides, the current speed during spring as well as during summer and winter becomes stronger when the current direction switches to eastward at the Northern Intake site and to southward at the other sites. The average values of current speed and direction during the recording intervals during spring in whole entire water column at the Northern Intake, Eastern Intake, MSS and IUI sites were (4.8 ±.49 cms -1 and 11 ± 58.8 ), (5. ±.86 cms -1 and 187 ± 19.1 ), (9.1 ± 1.75 cms -1, 27 ± 26.5 ) and (9.6 ±.71 cms -1, 219 ± 38.8), respectively. The statistical summary of current data measurements in the entire coastal water column at all sites during winter are shown in Table A- 15 - Table A- 18. RSS-REL-T5. Annex 1_page 47 of 132

Figure A- 29 Cross and long shore current [cms -1 ] components of the raw data in spring at the Northern and Eastern Intake sites and in front of the MSS and IUI. RSS-REL-T5. Annex 1_page 48 of 132

(A) Northern Intake-WINTER (B) Eastern Intake-WINTER 2-2 5m 2 7m 2 9m 2 11m -2-2 -2 2-2 11m 2-2 13m 2-2 15m 2-2 17m -2 2-2 2-2 2-2 2-4 -2 2-4 -2 2-4 -2 2-4 -2 2 Across shore [km] 2-2 2 13m 2 15m 2 17m 2 19m -2-2 2-2 2-2 -2-2 2-2 2 21m 2 23m 2 25m 2 27m Along shore [km] 2-2 -4 2 2 2 2 19m 21m 23m 25m -2-2 -2-2 2-4 -2 2-4 -2 2-4 -2 2 Across shore [km] 27m 2 2 29m 31m -2-2 -2-2 -2-2 -2 2-2 2 29m 2-2 2 31m -2 2-2 2 Along shore [km] -4-2 2-4 -2 2 Across shore [km] -4-2 2-2 -2-2 2-2 2 Along shore [km] Figure A- 3 Progressive vector diagram at different depth layers in spring at the (A) Northern Intake site during the period April 6 th May 17 th, 211 and at the (B) Eastern Intake site during the period April 4 th May 8 th, 211. RSS-REL-T5. Annex 1_page 49 of 132

1-1 3m 1-1 5m (A) MSS-SPRING 1-1 7m 1-1 9m -5 (B) IUI-SPRING 9m 11m 13m 15m -5-5 -5 Along shore [km] -2-2 -1 1 1-1 -2-2 -1 1 1-1 -2-2 -1 1-1 -2-2 -1 1-2 -2-1 1-2 -2-1 1 1 1 1 11m 13m 15m 17m -2-2 -1 1 1-1 -1-2 -2-1 1-1 1 1 19m 21m 23m -1-2 -2-1 1-1 1 1 27m 29m 31m -2-2 -1 1-1 -1-2 -2-1 1 1-1 25m -2-2 -1 1 Across shore [km] -1-5 5-5 -1-5 5 Along shore [km] -5-1 -5 5-5 -1-5 5-5 -1-5 5-5 -1-5 5-1 -5 5-5 -1-5 5-1 -1-1 -1-5 5-5 5-5 5-5 5 33m 35m 37m 39m -5 17m 19m 21m 23m 25m 27m 29m 31m -5-5 -5-5 -5-2 -2-1 1-2 -2-1 1 Across shore [km] -2-2 -1 1-1 -5 5 41m -1-5 5-1 -5 5 Across shore [km] -1-5 5-5 -1-5 5 Across shore [km] Figure A- 31 Progressive vector diagram at different depth layers in spring in front of the (A) MSS during the period February 23 rd April 3 rd, 211 and in front of the (B) IUI during the period March 23 rd April 1 th, 211. RSS-REL-T5. Annex 1_page 5 of 132

Cross shore current [cms -1 ] 1 5-5 Cross shore current [cms -1 ]; Site: Northern Intake-SPRING 11m 17m 19m -1 7-Apr 9 11 13 15 17 Date (year 211) Long shore current [cms -1 ] 2 1-1 Long shore current [cms -1 ]; Site: Northern Intake-SPRING 11m 17m 19m -2 7-Apr 9 11 13 15 17 Date (year 211) Cross shore current [cms -1 ] 15 1 5 Cross shore current [cms -1 ]; Site: Eastern Intake-SPRING -5 11m -1 17m 27m -15 7-Apr 9 11 13 15 17 Date (year 211) Long shore current [cms -1 ] 3 2 1-1 -2 Long shore current [cms -1 ]; Site: Eastern Intake-SPRING 11m 17m 27m -3 7-Apr 9 11 13 15 17 Date (year 211) Cross shore current [cms -1 ] 15 1 5-5 -1 Cross shore current [cms -1 ]; Site: MSS-SPRING 7m 17m 27m -15 24-Mar 26 28 3 1-Apr 3 Date (year 211) Cross shore current [cms -1 ] 4 2 Cross shore current [cms -1 ]; Site: MSS-SPRING -2 7m 17m 27m -4 24-Mar 26 28 3 1-Apr 3 Date (year 211) Cross shore current [cms -1 ] 15 1 5-5 -1 Cross shore current [cms -1 ]; Site: IUI-SPRING 9m 17m 27m -15 24-Mar 26 28 3 1-Apr 3 Date (year 211) Long shore current [cms -1 ] 3 2 1-1 -2 Long shore current [cms -1 ]; Site: IUI-SPRING -3 24-Mar 26 28 3 1-Apr 3 Date (year 211) Figure A- 32 Cross and long shore current [cms -1 ] components of a partial of the raw data (1 minutes interval) in spring at the Northern and Eastern Intake sites and in front of the MSS and IUI. 9m 17m 27m RSS-REL-T5. Annex 1_page 51 of 132

1 3 1 2 Northern Intake-SPRING 1 3 1 2 12.19h Eastern Intake-SPRING Power [cm 2 s -2 cpd -1 ] 1 1 1 1-1 Power [cm 2 s -2 cpd -1 ] 1 1 1 1-1 1-2 1-2 1-1 1 1 1 Frequency [cpd] 1-2 1-2 1-1 1 1 1 Frequency [cpd] Power [cm 2 s -2 cpd -1 ] 1 3 1 2 1 1 1 1-1 12.19h 6.1h MSS-SPRING Power [cm 2 s -2 cpd -1 ] 1 4 1 2 1 12.19h IUI-SPRING 6.1h 1-2 1-2 1-1 1 1 1 Frequency [cpd] 1-2 1-2 1-1 1 1 1 Frequency [cpd] Figure A- 33 Spectrum of time series of the average current speed in overall entire coastal water column during winter at the Northern Intake, Eastern Intake, MSS and IUI sites. RSS-REL-T5. Annex 1_page 52 of 132

6 5 SPRING %Frequency 4 3 2 1 Northern Intake Eastern Intake MSS IUI 3 3 6 6 9 9 12 12 15 15 18 18 21 21 24 24 27 27 3 3 33 33 36 Current direction [ ] 4 35 SPRING %Frequency 3 25 2 15 1 5 Northern Intake Eastern Intake MSS IUI 3 3 6 6 9 9 12 12 15 15 18 18 21 21 24 24 27 27 3 3 33 33 36 36 39 39 42 42 45 Current speed [cms 1 ] Figure A- 34 Percent frequency of current speed and direction during spring at the Eastern Intake, Northern Intake, MSS and IUI sites. RSS-REL-T5. Annex 1_page 53 of 132

Figure A- 35 Cross and long shore current [cms -1 ] components of the filtered data (2 days pass filter) in spring at the Northern and Eastern Intake sites and in front of the MSS and IUI. RSS-REL-T5. Annex 1_page 54 of 132

Table A- 19 Statistical summary of current speed (cms -1 ), current direction ( ), cross shore current (cms -1 ), long shore current (cms -1 ) and displacement rate (km day -1 ) in coastal waters at the Northern Intake site during spring (April 6 th May 17 th ). Speed (cms -1 ) Direction ( ) Cross shore (cms -1 ) Long shore (cms -1 ) count Dis. rate (km/day) Depth Mean SD Mean SD Mean SD Mean SD 5 5.5 3.84 171 58.7 -.2 2.66.2 6.32 5881.32 6 5.5 3.87 151 59. -.1 2.47.2 6.37 5881.18 7 5.5 3.98 84 58.4.1 2.38.1 6.48 5881.12 8 5.5 3.96 56 58.4.2 2.27.1 6.44 5881.19 9 5.4 3.98 45 58.3.3 2.24.1 6.44 5881.28 1 5.3 3.95 39 58.4.4 2.14.1 6.37 5881.34 11 5.3 3.96 35 58.2.5 2.12.1 6.33 5881.41 12 5.2 3.93 33 58.4.5 2.5. 6.25 5881.44 13 5.1 3.93 31 58.5.5 2.5. 6.21 5881.47 14 5.1 3.87 3 58.8.6 1.98. 6.12 5881.49 15 5. 3.84 29 59..6 1.98. 6.6 5881.51 16 4.9 3.78 27 59.2.6 1.93. 5.98 5881.51 17 4.9 3.76 25 59.3.6 1.93. 5.92 5881.51 18 4.8 3.7 22 59.8.5 1.86 -.1 5.82 5881.48 19 4.7 3.68 2 59.8.5 1.87 -.1 5.75 5881.45 2 4.6 3.65 16 59.9.4 1.83 -.1 5.68 5881.39 21 4.6 3.64 11 59.7.3 1.85 -.1 5.63 5881.34 22 4.5 3.57 4 59.7.3 1.85 -.1 5.54 5881.29 23 4.5 3.54 354 59.5.2 1.9 -.2 5.47 5881.25 24 4.4 3.48 335 59.5.1 1.92 -.2 5.38 5881.2 25 4.4 3.44 31 59.2. 1.99 -.2 5.3 5881.19 26 4.3 3.37 287 59.1 -.1 2.4 -.2 5.18 5881.2 27 4.3 3.33 269 58.7 -.2 2.14 -.2 5.8 5881.24 28 4.2 3.24 254 58.3 -.3 2.21 -.3 4.93 5881.3 29 4.2 3.17 244 57.6 -.4 2.33 -.3 4.8 5881.38 3 4.1 3.1 233 56.7 -.5 2.39 -.2 4.54 5881.47 31 4. 2.89 226 55.5 -.7 2.5 -.2 4.31 5881.58 RSS-REL-T5. Annex 1_page 55 of 132

Table A- 2 Statistical summary of current speed (cms -1 ), current direction ( ), cross shore current (cms -1 ), long shore current (cms -1 ) and displacement rate (km day -1 ) in coastal waters at the Eastern Intake site during spring (April 4 th May 8 th, 211). Speed (cms -1 ) Direction ( ) Cross shore (cms -1 ) long shore (cms -1 ) count Dis. rate (km/day) Depth Mean SD Mean SD Mean SD Mean SD 11 6.1 4.32 179 14.9.8 2.61-1.4 6.8 4855 1.37 12 6. 4.24 178 14.7.8 2.55-1.3 6.7 4855 1.31 13 5.9 4.22 177 14.9.8 2.54-1.2 6.63 4855 1.25 14 5.8 4.13 176 14.9.7 2.46-1.2 6.53 4855 1.21 15 5.7 4.9 176 15.2.7 2.43-1.1 6.45 4855 1.17 16 5.6 3.91 178 15.6.6 2.28-1.1 6.27 4855 1.6 17 5.4 3.81 181 16.4.5 2.23-1. 6.14 4855.96 18 5.3 3.68 182 15.5.5 2.15 -.9 5.96 4855.89 19 5.1 3.61 183 15.5.4 2.13 -.9 5.83 4855.83 2 5. 3.51 184 15.3.4 2.6 -.8 5.69 4855.76 21 4.9 3.45 186 15.6.3 2.4 -.7 5.58 4855.69 22 4.8 3.34 189 15.5.2 1.95 -.7 5.42 4855.63 23 4.6 3.28 192 16.1.2 1.92 -.6 5.29 4855.57 24 4.5 3.16 2 16.6.1 1.82 -.6 5.11 4855.53 25 4.3 3.8 29 17.6. 1.78 -.6 4.95 4855.5 26 4.1 2.92 221 18.8 -.1 1.67 -.6 4.74 4855.49 27 4. 2.82 232 2.7 -.2 1.65 -.5 4.56 4855.51 28 3.9 2.65 245 22.9 -.4 1.59 -.5 4.34 4855.59 29 3.8 2.55 254 25.9 -.6 1.64 -.6 4.16 4855.7 3 3.7 2.4 265 3.2 -.7 1.72 -.5 3.9 4855.76 31 3.6 2.33 274 35.4 -.9 1.92 -.4 3.68 4855.85 RSS-REL-T5. Annex 1_page 56 of 132

Table A- 21 Statistical summary of current speed (cms -1 ), current direction ( ), cross shore current (cms -1 ), long shore current (cms -1 ) and displacement rate (km day -1 ) in coastal waters at the MSS site during spring (February 23 rd April 3 rd, 211). Speed (cms -1 ) Direction ( ) Cross shore (cms -1 ) Long shore (cms -1 ) count Dis. rate (km/day) Depth Mean SD Mean SD Mean SD Mean SD 3 1.8 6.55 183 24.1 2.3 2.3-4.9 11.22 5569 4.69 4 1.8 6.52 185 25.1 1.9 2.8-4.4 11.47 5569 4.17 5 1.8 6.66 188 26.1 1.4 2.7-4. 11.8 5569 3.65 6 1.7 6.61 188 26.2 1.4 2.3-3.9 11.72 5569 3.55 7 1.6 6.59 189 26.3 1.3 2.4-3.8 11.65 5569 3.46 8 1.5 6.57 19 26.3 1.2 2. -3.8 11.59 5569 3.42 9 1.5 6.58 191 26.4 1.2 2. -3.7 11.54 5569 3.39 1 1.4 6.56 192 26.4 1.1 1.96-3.8 11.49 5569 3.38 11 1.3 6.57 193 26.5 1. 1.96-3.8 11.44 5569 3.37 12 1.3 6.54 194 26.5.9 1.9-3.8 11.37 5569 3.35 13 1.2 6.52 196 26.5.8 1.89-3.8 11.31 5569 3.33 14 1.1 6.47 198 26.4.7 1.84-3.7 11.22 5569 3.3 15 1. 6.44 199 26.5.6 1.84-3.7 11.15 5569 3.26 16 9.9 6.37 21 26.4.5 1.81-3.7 11.3 5569 3.23 17 9.8 6.31 23 26.4.3 1.84-3.7 1.92 5569 3.19 18 9.7 6.2 25 26.3.2 1.84-3.6 1.79 5569 3.15 19 9.6 6.12 28 26.4. 1.9-3.6 1.66 5569 3.11 2 9.3 5.67 211 25.9 -.2 1.92-3.3 1.16 5569 2.88 21 8.9 5.3 214 25.7 -.3 2.2-3.1 9.7 5569 2.66 22 8.8 5.13 219 25.6 -.6 2.6-3. 9.48 5569 2.6 23 8.6 4.99 224 25.8 -.8 2.17-2.9 9.27 5569 2.56 24 8.3 4.71 229 25.6-1. 2.25-2.6 8.81 5569 2.4 25 7.9 4.54 235 25.8-1.2 2.41-2.3 8.39 5569 2.26 26 7.5 4.23 242 26.1-1.4 2.51-2.1 7.83 5569 2.17 27 7.1 4.5 25 26.9-1.6 2.69-1.8 7.33 5569 2.12 28 6.9 3.64 253 28.1-1.9 2.79-1.9 6.72 5569 2.31 29 6.6 3.37 256 3.1-2.2 2.97-1.9 6.18 5569 2.5 3 5.4 2.52 257 31.4-1.8 2.61-1.6 4.68 5569 2.13 31 4.1 1.93 258 34.9-1.5 2.36-1.3 3.35 5569 1.75 RSS-REL-T5. Annex 1_page 57 of 132

Table A- 22 Statistical summary of current speed (cms -1 ), current direction ( ), cross shore current (cms -1 ), long shore current (cms -1 ) and displacement rate (km day -1 ) in coastal waters at the IUI site during spring (March 23 rd April 1 th, 211). Speed (cms -1 ) Direction ( ) Cross shore (cms -1 ) Long shore (cms -1 ) count Dis. rate (km/day) Depth Mean SD Mean SD Mean SD Mean SD 8 1.6 7.84 224 36.9 -.4 2.47-5.8 11.54 519 5.6 9 1.6 7.84 224 37. -.4 2.3-5.9 11.56 519 5.7 1 1.6 7.94 224 36.9 -.4 2.28-5.9 11.66 519 5.7 11 1.6 7.93 224 36.9 -.4 2.21-5.9 11.62 519 5.7 12 1.5 7.93 224 37. -.4 2.2-5.8 11.6 519 5.6 13 1.4 7.89 224 37.2 -.4 2.11-5.8 11.48 519 5.6 14 1.3 7.88 224 37.4 -.4 2.1-5.8 11.4 519 5.5 15 1.2 7.85 224 37.5 -.4 2.3-5.8 11.33 519 5.4 16 1.2 7.85 224 37.6 -.4 2.1-5.8 11.28 519 5.3 17 1.1 7.83 224 37.7 -.4 1.94-5.8 11.23 519 5.2 18 1.1 7.83 223 37.9 -.3 1.93-5.8 11.2 519 5. 19 1. 7.81 223 37.9 -.3 1.86-5.8 11.15 519 5. 2 1. 7.81 223 38.1 -.3 1.86-5.8 11.12 519 4.99 21 9.9 7.79 223 38.2 -.3 1.77-5.8 11.7 519 4.99 22 9.9 7.79 222 38.3 -.2 1.75-5.8 11.3 519 4.98 23 9.8 7.77 222 38.5 -.2 1.67-5.8 1.97 519 4.98 24 9.7 7.76 222 38.6 -.2 1.66-5.7 1.92 519 4.97 25 9.7 7.73 221 38.8 -.1 1.55-5.7 1.86 519 4.95 26 9.6 7.72 22 39.. 1.55-5.7 1.82 519 4.92 27 9.6 7.67 22 39.1. 1.51-5.7 1.75 519 4.92 28 9.5 7.65 219 39.2.1 1.54-5.7 1.7 519 4.91 29 9.5 7.59 219 39.3.1 1.51-5.7 1.62 519 4.91 3 9.4 7.54 218 39.4.2 1.55-5.7 1.55 519 4.9 31 9.4 7.47 218 39.5.2 1.54-5.7 1.46 519 4.9 32 9.3 7.42 217 39.6.3 1.6-5.7 1.38 519 4.9 33 9.3 7.31 216 39.8.3 1.61-5.7 1.22 519 4.91 34 9.2 7.23 216 39.9.4 1.7-5.7 1.7 519 4.92 35 9.1 7.13 215 4.1.5 1.73-5.7 9.95 519 4.9 RSS-REL-T5. Annex 1_page 58 of 132

Speed (cms -1 ) Direction ( ) Cross shore (cms -1 ) Long shore (cms -1 ) count Dis. rate (km/day) Depth Mean SD Mean SD Mean SD Mean SD 36 9.1 7.5 214 4.2.6 1.83-5.6 9.84 519 4.89 37 9. 6.9 214 4.4.6 1.88-5.6 9.66 519 4.83 38 8.9 6.76 213 4.6.7 1.99-5.5 9.49 519 4.77 39 8.7 6.49 212 41..8 2.5-5.3 9.19 519 4.63 4 8.5 6.24 211 41.3.8 2.16-5.1 8.91 519 4.49 41 8.1 5.79 21 41.9.9 2.16-4.8 8.38 519 4.2 42 7.7 5.35 29 42.5.9 2.21-4.4 7.87 519 3.91 RSS-REL-T5. Annex 1_page 59 of 132

A3. Monitoring of hydrographic parameters A3.1 Descritpion of activities Four cruises were carried out during the reported period: RSDSC-1 (3/MAY/21), RSDSC-2 (15-16/AUG/21), RSDSC-3 (29-3/NOV/21), and RSDSC-4 (21-22/FEB/211). All of them employed the IUI research vessel. Each cruise consists of two CTD sections (Figure A- 36). There were differences in stations positions X1, X2 and Y4 between the cruises RSDSC-1 and RSDSC-2 due to changes in the wind condition and drifting of the vessel. Stations positions of the RSDSC-3 and RSDSC-4 cruises coincide with stations positions of RSDSC-1 cruise. Figure A- 36 CTD stations position in RSDSC-1, RSDSC-3, RSDSC-4 cruises (left panel) and in RSDSC-2 cruise (right panel). A3.2 Methods All casts were carried out using the IUI CTD (Figure A- 37). SBE 19plus V2 SEACAT Profiler (http://www.seabird.com/products/profilers.htm) with pumpcontrolled T-C duct flow and two additional sensors: Seapoint Chlorophyll Fluorometer (http://www.seapoint.com/scf.htm); Photosynthetically Active Radiation (PAR) (http://www.biospherical.com). The CTD sensors calibration date was 3/JUN/28. The calibration dates of the additional sensors are unknown. RSS-REL-T5. Annex 1_page 6 of 132

In order to check the accuracy of temperature and salinity channels, during the RSDSC-1 cruise, an additional CTD (IOLR SBE 19 SEACAT profiler without pump, calibration date 14/DEC/27) was mounted on the carrousel (Figure A- 37). Figure A- 37 SBE carousel equipped by two CTDs during cruise RSDSC-1. Figure A- 38 Differences between temperature (left panel) and salinities (right panel) measured by two CTDs mounted on the same carousel. (IOLR CTD minus IUI CTD). RSS-REL-T5. Annex 1_page 61 of 132

The data was processed according to the recommendation of the Sea Bird software instructions (http://www.seabird.com ). The maximal differences between the two datasets (Figure A- 38) correspond to layers where high gradient temperature and salinity (2-3m) were observed. Relative low accuracy in layers with high vertical gradients is typical for a CTD without a pump-controlled T-C duct flow. In the vertically homogeneous layers the differences in temperature and salinity are acceptable and within the accuracy range of profilers (about.1 C for temperature and.1 for salinity). Figure A- 39 - Figure A- 42 display vertical profiles for all measured parameters as well as for derived potential density. All casts passed the test for stable potential density. Several vertical profiles of photosyntetically active radiation (PAR) show increase of radiation with depth in layers above 2m. These inversions are probably the result of the vessel s shadow interference. Figure A- 39 Vertical profiles of potential temperature during the spring cruise (3/MAY/21 green lines), summer cruise (15-16/AUG/21, red lines), autumn cruise (29-3/NOV/21, blue lines) and winter cruise (21-22/FEB/211, dark blue lines). RSS-REL-T5. Annex 1_page 62 of 132

Figure A- 4 Vertical profiles of salinity during the spring cruise (3/MAY/21 green lines), summer cruise (15-16/AUG/21, red lines), autumn cruise (29-3/NOV/21, blue lines) and winter cruise (21-22/FEB/211, dark blue lines). Figure A- 41 Vertical profiles of potential density during the spring cruise (3/MAY/21 green lines), summer cruise (15-16/AUG/21, red lines), autumn cruise (29-3/NOV/21, blue lines) and winter cruise (21-22/FEB/211, dark blue lines). RSS-REL-T5. Annex 1_page 63 of 132

Figure A- 42 Vertical profiles of chlorophyll-a (left panel) and photosyntetically active radiation (right panel) during the spring cruise (3/MAY/21 green lines), summer cruise (15-16/AUG/21, red lines), autumn cruise (29-3/NOV/21, blue lines) and winter cruise (21-22/FEB/211, dark blue lines). A3.3 Results Data from all cruises shows stable three layers structure (Figure A- 43 - Figure A- 45). The upper layer, which experience significant seasonal fluctuations, extends to about 2 m. In May 21 this layer already depicted a monotonous decrease of temperature with depth (~.3 C/m) and increase of salinity (.45 m -1 ).The penetration of winter convection during 29-21 was about 2m. The relatively low level of mixing, as well as the relatively high water temperature in the upper layer (22.2-23. C) is typical for mild winter conditions (Gertman and Brenner, 24). Salinity of the upper layer in May 21 was 4.43-4.46. During the August cruise sea surface temperature (SST) fluctuated between 26.4-27.7 C and vertical gradients of temperature within the upper layer had reached.25 C/m. The SST was about 1 C higher than the climatic value (Gertman and Brenner, 24). Due to intensive evaporation within the upper layer an overturned halocline was formed with maximal salinity (~4.5-4.6) on the sea surface and minimal salinity (~4.33) in depth of about 1m. Salinity on that level (1m) was lower than the values observed during May 21 by about.14. Apparently the minimum is caused by advection of less saline water from the Red Sea. In spite of the overturned halocline the summer upper mixed layer was very shallow (5-18m). During the November 21 cruise the upper mixed layer extended until 15-2m due to thermal convection intensified by presence of the overturned halocline. The maximum penetration of the winter convection (3-35 m) was observed in the February 211 cruise when the temperature of the upper layer was about 22.4 C. During the observation period the water temperature in the upper layer was about 1 C warmer (Figure A- 46) than climatic values derived from data observed in the 1975-23 (Gertman, Brenner, 24). The intermediate layer (2-4m) is the layer of permanent pycnocline where stable decrease of temperature and increase of salinity was observed during the all four cruises. RSS-REL-T5. Annex 1_page 64 of 132

The deep water layer (from 4m to the bottom) is quite homogeneous. Potential temperature fluctuated between 2.87 C and 21. C and salinity between 4.65-4.72. During the observation period the water temperature in the deep layer was about.15 -.17 C warmer (Figure A- 47) than climatic values derived from data observed in the 1975-23 (Gertman, Brenner, 24). Figure A- 43 Potential temperature/salinity distribution of data collected during the spring cruise (3/MAY/21 green lines), summer cruise (15-16/AUG/21, red lines), autumn cruise (29-3/NOV/21, blue lines) and winter cruise (21-22/FEB/211, dark blue lines). RSS-REL-T5. Annex 1_page 65 of 132

Figure A- 44 Latitudinal sections of potential temperature and salinity during the summer cruise (15-16/AUG/21, upper panels), autumn cruise (29-3/NOV/21, middle panels) and winter cruise (21-22/FEB/211, dark blue lines, lower panels).. RSS-REL-T5. Annex 1_page 66 of 132

Figure A- 45 Longitudinal sections of potential temperature and salinity during the spring cruise (3/MAY/21 upper panels), summer cruise (15-16/AUG/21, middle panels), autumn cruise (29-3/NOV/21, middle panels) and winter cruise (21-22/FEB/211, dark blue lines, lower panels). RSS-REL-T5. Annex 1_page 67 of 132

Figure A- 46 Comparison of the upper layer water temperature observed during 21-211 (yellow circles) with climatic values (red line) derived from data observed during 1975-23 (Gertman and Brenner, 24). Figure A- 47 Comparison of the deep water temperature observed during 21-211 (yellow circles) with climatic values (red line) derived from data observed during 1975-23 (Gertman and Brenner, 24). RSS-REL-T5. Annex 1_page 68 of 132

A4. Bottom sediments A4.1 Methods Sedimentation rate Sedimentation rates were estimated using locally designed and manufactured simple sediment trap. The traps were deployed through out the water column and were moored to the sea bed at 5 and 15 m depth, in the two candidate intake sites (near the border and the old thermal power station in, Table A- 23). Four glass jars were fixed into the sediment tarp cavities for statistical significance. The first deployment of the sediment traps with the jars was during 2-3/May/21 while the second collection was in 18/May and 2/June 21. The jars in the two runs were collected every other week by SCUBA diving. At each collection, water in the traps was siphoned out until about 5 ml remained. Encrusting organisms (mostly algae) were scraped off, and the remaining water and settled materials were filtered through pre-weighed, pre-ignited 24 mm GF/C Whatman glass fiber filters. The filters with sediments were placed in a drying oven at 6 C for 24 hours and then weighed and the sedimentation rates were calculated as mg.cm 2.day -1. Table A- 23 Coordination of sediment sampling sites (East and North Intake sites). Site Location Longitude Latitude East intake site Old thermal power station in 34.98557 29.4887 North intake site Jordan-Israeli border 34.9838 29.53937 Sedimentological parameters Surface sediment samples were collected from the two candidate intake sites (near the border and near the old thermal power station in, table 1) by SCUBA diving. The first sampling campaign took place in 2-3 May 21 while the second campaign was in 18/May and 2/June/21. From each site, sediments cores (15 cm long) and grab samples were collected at three depths (5, 15, and 3 m). Each core was then sectioned into three sections representing the layers -5 cm, 5-1 cm, and 1-15 cm. The cores were analyzed for: sediment physical properties: grain size analysis and mud content; sediment chemical properties: calcium carbonate, organic carbon, ignition loss, redox potential, total phosphorus, total organic nitrogen, and heavy metals (Cr, Pb, Cu, Cd, Zn). RSS-REL-T5. Annex 1_page 69 of 132

Sediments were collected by diving teams from the two suggested sites for the intake one near the border and one near the old thermal power station in. From each site, sediments were collected at three depths (5 m, 15 m, and 3 m) using the core method (8 cm diameter). The cores were 15 cm long. After fixation they were transported to the laboratory and sliced into three sections representing the layers -5 cm, 5-1 cm, and 1-15 cm. The cores were analyzed as follows: Calcium carbonate content (CaCO 3 ) was measured by complex metric titration of calcium carbonate with.1n of hydrochloric acid as suggested by Muller (1967). The redox potential value for the water above the sediment surface was measured using a Mettler Toledo electrode. Grain size distributions were assessed by a set of calibrated analytical sieves (from 2 mm to 63 μm). The grain size was presented in Q which is equal to log 2 of the grain size diameter in mm. Mud contents were calculated (<63 μm). Organic carbon contents in the sediments were measured following the method of Gaudette and Flight (1974), where.2 g of the sediment was treated with H 2 SO 4 (12 M) and potassium dichromate then titrated with ferrous ammonium sulphate solution. The samples were then treated with 1 N HCL first to remove any inorganic carbon in the samples as suggested by Muller et al. (1994). Ignition loss was determined by weight difference before and after combusting over 24 h in a furnace at 5 C. Total organic nitrogen content was determined by Kjeldahl digestion. Organic nitrogen was then converted to inorganic nitrogen by concentrated H 2 SO 4 (12 M), which was measured as ammonium following the standard method of Strickland and Parson (1972). Total phosphorus content (TP) was determined using the ignition method for particulate phosphate analysis, where.2 g of the sample was combusted in a furnace at 45 C, and the ash was boiled in 1N HCL for 15 min. The sample was then diluted to 1 ml with distilled water, and phosphate was measured spectrophotometrically following the method of Strickland and Parson (1972). Heavy metals a portion of each sediment layer was mixed and dried at 15 C. The dried samples (.2 g) were digested following the method of Wade et al., (1993). The resulting solutions were then analyzed using a Flam atomic absorption spectrophotometer. RSS-REL-T5. Annex 1_page 7 of 132

A5. Benthic habitats The eastern intake site (i.e. the old thermal power station site) was lacking the necessary information regarding its benthic habitat. As described in the inception report, we have decided to carry out this survey for three replicates during the period between May and December, 21. Here we present the results of the three surveys. A5.1 Methods Point intercept method used to survey the biodiversity of the coral reef ecosystem in the Gulf of was done according to the method of English et al (1994) as follows; the lines were prepared and fixed in place underwater at three depths. The first was the reef flat, the second was at 9m depth and the third depth was at 15m depth. For each depth, three transects with a 5m length were prepared as shown in Figure A- 48. Fourteen items were selected in accordance with the survey carried out in26 (Table A- 24). The items were selected in accordance with their importance in the Gulf of coral reef's ecosystem. Table A- 24 Items used in the survey study with their abbreviations. Item Abbreviation Item Abbreviation Hard coral HC Sea grass SG Soft coral SC Sand SD Sea Anemone SA Rock RC Sponges SP Rubble RB Ascidians AS Others OT Clams CL Man Made Objects MM Algae AG Recently died coral RKC RSS-REL-T5. Annex 1_page 71 of 132

Pumps room Transect 3 Transect 2 Transect 1 5m long 5m long 5m long North -------------- South Figure A- 48 Illustration showing the English et al. (1994) method for the biodiversity survey used in this study. Study site and location of transects (survey lines) The eastern intake site was subjected to a field survey for its benthic cover components. The site has concrete facility (pumps room) at the sea front (Figure A- 49 left) and has dumped rocks in front of it (Figure A- 49 right). Our survey transects were laid next to this construction at 3 depths including the reef flat, the 9m and the 15m depths. At each depth we have deployed 3 transects; 1 transect was laid at about 1m distance south to the construction, the second transect was laid at about 1 m north to the pumps room, while the third transect was laid at about 2m north of the second one. The distance between transect 1 and transect 2 was about 35m only (in front of the pumps room). Figure A- 49 Photo of the eastern intake location (the old thermal power station site) showing the pumps room (left) and underwater photo in front of the pumps room (right). RSS-REL-T5. Annex 1_page 72 of 132

The exact location of the study lines at the old thermal power station is shown in Figure A-43. The GPS reading in the centre (in front of the pumps room) is 2 m from the coast line, the readings to the right and left of it, is about 5m away from the reading in the centre. The reef flat line is about 1m from the coastline. The 9m deep transects are about 3m from the coastline, while the 15m deep transects are about 45m from the coastline. Pumps room Transect 3 Transect 2 Transect 1 5m long 5m long 5m long N 29 29 364 E34 59 119 5 m N 29 29 31 E34 59 12 5 m N 29 29 281 E34 59 85 North -------------- South Figure A- 5 Illustration showing the survey transects with regard to the pumps room of the old thermal power station and the GPS reading for 3 points taken to the right, in front and left of the pumps room. A5.2 Results The results of the surveys are presented in Figure A- 51, Figure A- 52, Figure A- 53. The data obtained have shown that there are (on average) about 2%, 18% and 25% coral cover at the reef flat, 9m depth and 15m depth, respectively. There were no significant differences among the results of the three surveys conducted at the eastern intake area. RSS-REL-T5. Annex 1_page 73 of 132

Benthic Habitat at Reef Flat depth/ site 6 5 percent cover 4 3 2 1 HC SC SA SP AS CL AG SG SD RC RB OT MM RKC Benthic habitat component Benthic Habitat at 9m depth/ site 35 3 25 percent cover 2 15 1 5 HC SC SA SP AS CL AG SG SD RC RB OT MM RKC Benthic habitat component Benthic Habitat at 15m depth/ site 4. 3. percent cover 2. 1.. HC SC SA SP AS CL AG SG SD RC RB OT MM RKC Benthic habitat component Figure A- 51 Cover percentage for the benthic cover components at 3 depths (reef flat, 9m and 15m) in the study site (results of the first survey). RSS-REL-T5. Annex 1_page 74 of 132

Benthic Habitat at Reef Flat depth/ site % cover 7. 6. 5. 4. 3. 2. 1.. HC SC SA SP AS CL AG SG SD RC RB OT MM RKC Benthic Habitat at 9m depth/aqa % cover 6. 5. 4. 3. 2. 1.. HC SC SA SP AS CL AG SG SD RC RB OT MM RKC Benthic Habitat at 15m depth/ site 5. 4. % cover 3. 2. 1.. HC SC SA SP AS CL AG SG SD RC RB OT MM RKC Figure A- 52 Cover percentage for the benthic cover components at 3 depths (reef flat, 9m and 15m) in the study site (results of the second survey). RSS-REL-T5. Annex 1_page 75 of 132

Figure A- 53 Cover percentage for the benthic cover components at 3 depths (reef flat, 9m and 15m) in the study site (results of the third survey). RSS-REL-T5. Annex 1_page 76 of 132

A6. Fish fauna A6.1 Northern Intake Site Methods Fish communities in shallow water habitats (4-9m depth) along the northern part of the Jordanian coast (Ayla), were surveyed by visual census technique following English et al. (1994). Line transects of 1m in length and 5m width were deployed at each of the 6 selected survey sites in front of the proposed Ayla location (Figure A- 54). At each site visual census were conducted along three transects to cover a total area of 15m 2 at 4m depth as well as at 9m depth. The distance between transects within one site was about 5m. To avoid bias, two underwater observers were carried out the field investigation simultaneously. During the survey and after laying the transect line, the observer waited for about 1 minutes to allow the fish to resume their normal behaviour. Subsequently, the divers recorded the number of individuals of all fishes encountered within a distance of 2.5m on each side of the line and 3m above it. All fishes exhibited a total length of 3mm or more were identified to the species level and recorded on a plastic slate. The duration of count for each transect lasted about 2-3minutes. At Yacht Club, fish fauna were counted approximately within a 5 m long transect and 5m meter wide transect. The count at this particular site was just to document species succeeded to colonize within the port an artificial area constructed several years ago. The line transects were arranged according to the following pattern at the different survey sites: Sites 1, 3, and 5 representing the transects deployed at 9m deep. Sites 2, 4, and 6 representing the transects deployed at 4m deep. The single site has 3 line transects, each of 1m long. Site 7, represents the count taken at the Yacht Club. Results Abundance of fishes was described using the following parameters; relative abundance (RA) = (the pooled average abundance of species i from each depth and site/ the pooled average abundance of all species from each depth and site) X 1, number of species. Frequency of appearance (FA) = (number of transects in which species i was present /total number of all transects) X 1. Species richness, species diversity and evenness were calculated using PRIMER-5 software (Primer-E 2). Multivariate analysis of data such as cluster analysis, MDS (multi-dimensional scaling), RELATES, BIO-ENV, as well as the ANOSIM (analysis of similarities) significance test were performed using PRIMER-5 software (Primer-E 2). RSS-REL-T5. Annex 1_page 77 of 132

1 2 3 4 5 km Thetis SpA 32.6 5 m 32.4 ST2 ST1 L A N D Latitude 29 min.mmm 32.2 32 31.8 St4 St3 St6 ST5 31.6 G U L F O F A Q A B A 58.4 58.6 58.8 59 59.2 59.4 59.6 59.8 Longitude 34 min.mmm Figure A- 54 Location of the northern tip of the Gulf of showing the biological survey sites along the Hotels area (in front of the North Intake). Filled circles are the sites of the stations at two depths (4 and 9 m) as indicated by the red lines. In the present survey study, a total of 85,348 fishes were counted representing 85 species that belongs to 33 families. All are inhabiting the shallow water with an average of 4741.6 fish per transect. The percent number of species per family showed the following rank: Labridae (11.76%), Pomacentridae and Mullidae (7.6%, each), Apoginidae, Chaetodontidae and Gobiidae (5.88%, each). These six families account for 43.53% of the total population. In terms of relative abundance per family the ichthyofauna showed the following rank: Lethrinidae (55.54%), Carangidae (13.11%), Mullidae (8.79%), Siganidae (5.48%), Nemepteridae (4.15%), Pomacentridae (3.71%), and Labridae (2.98%). These 7 families account for 82.92% of the total population. The most abundant species were Lethrinus borbonicus (38.56%), Lethrinus variegatus (16.97%), Trachurus indicus (8.78%), Siganus rivulatus (5.2%), Decapterus macrosoma (4.33%), Scolopsis ghanam (4.15%), Parupeneus forsskali (3.67%), and Parupeneus macronema (3.28%). These eight species made up 84.94% of the total population. Frequency of appearance suggest that the most common species were Scolopsis ghanam (88.89%), Parupeneus forsskali (77.78%), Upeneus pori (72.22%), Dascyllus trimaculatus, and Pteragogus pelycus (66.67%, each), Gerres oyena, Lethrinus borbonicus, Parupeneus macronema, Heniochus diphreutes, Teixeirichthys jordani, and Oxycheilinus orientalis (55.56%, each). Number of species ranged from two species per transect in Site 3 in transect No.2 at 9 m depth to 34 species at transect No.3 within the same site with an average of 17.8 species per transect (Figure A- 55a). The number of fish individuals was ranged from 71 individuals to 12,54 individuals in Site5 in transect No.3 with an average of 4741.6 fish per transect (Figure A- 55b). The average species richness was ranged from.23 in Site3 in transect No.2 to 4.26 in transect 3 within the same site at 9m depth with an average of 2.7 fish (Figure A- 55c). Shannon-Wiener diversity was ranged from.25 in Site3 in transect No.2 at 9m depth to 2.15 in Site 4 in transect No.1 at 4m depth with an average of 1.3 (Figure A- 55d) see also Table A- 25. RSS-REL-T5. Annex 1_page 78 of 132

I ST6-4m ST5-9m ST4-4m ST3-9m ST2-4m ST1-9m 35 3 25 2 15 1 5 No. of species II ST6-4m ST5-9m ST4-4m ST3-9m ST2-4m ST1-9m 12 1 8 6 4 2 Average abundance III ST6-4m ST5-9m ST4-4m ST3-9m ST2-4m ST1-9m 5 4 3 2 1 Species richness/transect IV 2 ST6-4m ST5-9m ST4-4m ST3-9m ST2-4m ST1-9m 1.5 1.5 Shannon-Wiener Diversity Station Figure A- 55 (a) Number of species, (b) number of individuals, (c) species richness, and (d) Diversity (Shannon-Wiener Index), (average ±SE) of fish assemblages at stations along the northern part of the Jordanian coast in front of the North Intake (Ayla). RSS-REL-T5. Annex 1_page 79 of 132

Table A- 25 Number of species (S), number of individuals (N), species richness (d), and Shannon-Wiener diversity (H') at stations along the northern part of the Jordanian coast in front of the North Intake (Ayla). S N D H' ST2-I-4m 13 278 1.51 1.2 ST2-II-4m 13 174 1.61 1.37 ST2-III-4m 8 166 1.37 1.65 ST1-I-9m 19 8394 1.99 1.6 ST1-II-9m 15 7626 1.57 1.63 ST1-III-9m 11 1244 1.8.89 ST4-I-4m 28 4956 3.17 2.15 ST4-II-4m 5 444.48.7 ST4-III-4m 18 4694 2.1.83 ST3-I-9m 26 735 3.79 1.56 ST3-II-9m 2 71.23.25 ST3-III-9m 34 2322 4.26 1.84 ST6-II-4m 24 2584 2.93 1.1 ST6-I-4m 16 2516 1.92 1.27 ST6-III-4m 15 2747 1.77 1.61 ST5-I-9m 29 923 3.7 1.34 ST5-II-9m 24 8688 2.54 1.98 ST5-III-9m 2 1254 2.2 1.33 Among the 13 chaetodontid fishes reported from the Red Sea, Five species were found during this survey. The zooplanktivore fish, Heniochus diphreutus is the most abundant chaetodontid fish and seen in small aggregations at the studied area. This species form about 1.39% of the total population of fishes within the area. RSS-REL-T5. Annex 1_page 8 of 132

A6.2 Eastern Intake site Methods Three surveys were coducted, the first survey was conducted during May 21, the second was conducted during October 21 and the last was in Febraury 211. The fish communities in shallow water habitats were investigated at the Thermal Power Station site along the Jordanian coast of Gulf for three times. These are same sites used for benthos survey. Visual census technique was used by SCUBA diving as described in English et al (1994). Three replicate transects of 5 m length and 5m width (25 m²) were marked in front of the Thermal Power Station. Census was conducted along three transects at the shallow reef flat, reef slope (8 m) and deep reef slope (15m). The distance between northern transects and the middle ones were about 1 m, while the distance between the middle transects and southern ones were about 4m; this is because the 4m distance is completely destroyed due to previous construction at the area. Fish species were recorded at 2.5 m on each site of the line and 3m above the transect. The duration of the count at each transect was 25-3 minuets. Abundance of fishes was described by relative abundance (RA) calculated as follows: RA= (the pooled average abundance of species i from each depth and site/ the pooled average abundance of all species from each depth and site) X 1 and frequency of appearance (FA), calculated as follows; FA = (number of transects in which species i was present /total number of all transects) X 1 Community indices such as, number of species (S), fish abundance (N), species richness (d), and species diversity (H ) were performed using PRIMER-5 software (Primer-E 2). The following literature was mainly used to confirm the fish identification in the field: Khalaf and Disi (1997), Randall (1993), Smith and Heemstra (1996) and Myers (1991). Results The results indicated in this report include the results and average of the three surveyed conducted during May 21, October 21 and February 211. A total of 34,658 fish individuals were counted during the three survey conducted during the study average of 11,553 individuals per survey; representing 129 shallow-water species. The most abundant species were in the following order, Pseudanthias squamipinnis (25.7%), Paracheilinus octotaenia (16.59%), Neopomacentrus miryae (11.1%), Chromis pelloura (9.54), Pomacentrus trichourus (8.4%) and see Table A- 26. These 5 species made up about eighty one percent of all individuals. In terms of frequency of appearance the most common species were Pomacentrus trichourus (1%) followed by Chaetodon paucifasciatus (92.59%), Dascyllus marginatus and Thalassoma rueppellii (88.89%, each), Chromis dimidiata (85.19%), and Pseudanthias squamipinnis, Parupeneus forsskali, P. Macronema, Amphiprion bicinctus and Anampses twistii (81.48%, each). (Table A- 26). RSS-REL-T5. Annex 1_page 81 of 132

Table A- 26 Frequence of appearance (FA) and Relative fish abundance (RA) Per (25 m²) at Thermal Power Station during (Average of 3 surveys during 21-211). Speceis FA RA Speceis FA RA Speceis FA RA Torpedo panthera 7.41.1 Genicanthus caudovittatus 51.85 1.87 Scarus ferrugineus 14.81.2 Gymnothorax griseus 44.44.4 Amblyglyphidodon flavilatus 14.81.3 Scarus frenatus 7.41.1 Gymnothorax nudivomer 7.41.1 Amblyglyphidodon leucogas 18.52.8 Scarus fuscopurpureus 25.93.6 Gymnothorax sp. 3.7. Amphiprion bicinctus 81.48.58 Scarus genozonatus 11.11.2 Saurida gracilis 4.74.3 Chromis dimidiata 85.19 2.5 Chlorurus gibbus 18.52.2 Synodus variegatus 59.26.6 Chromis pelloura 22.22 9.54 Scarus niger 3.7.1 Myripristis murdjan 3.7.1 Chromis pembae 18.52.12 Parapercis hexophtalma 33.33.4 Sargocentron diadema 62.96.74 Chromis ternatensis 14.81.3 Aspidontus taeniatus 22.22.4 Fistularia commersonii 37.4.11 Chromis viridis 11.11.12 Cirripectes castaneus 14.81.2 Corythoichthys flavofasciatu 22.22.3 Dascyllus marginatus 88.89 3.92 Ecsenius frontalis 25.93.5 Corythoichthys schultzi 25.93.12 Dascyllus trimaculatus 62.96.56 Ecsenius gravieri 29.63.3 Pterois miles 55.56.6 Neopomacentrus miryae 37.4 11.1 Ecsenius towdensi 3.7. Pterois radiata 22.22.2 Neoglyphidodon melas 7.41.1 Exallias brevis 18.52.2 Scorpaenopsis diabolus 3.7. Plectroglyphidodon lacrymat 7.41.2 Meiacanthus nigrolineatu 59.26.14 Cephalopholis hemistiktos 37.4.11 Plectroglyphidodon leucozon 18.52.7 Plagiotremus rhinorhynch 7.41.1 Cephalopholis miniata 29.63.3 Pomacentrus aquilis 14.81.4 Plagiotremus tapeinosom 14.81.1 Cephalopholis sexmaculatu 7.41.1 Pomacentrus sulfureus 22.22.12 Amblyeleotris steinitzi 7.41.1 Epinephelus fasciatus 44.44.5 Pomacentrus trichourus 1. 8.4 Amblygobius hectori 7.41.1 Variola louti 33.33.4 Pomacentrus trilineatus 7.41.1 Gnatholepis anjerensis 33.33.25 Pseudanthias squamipinnis 81.48 25.7 Anampses caeruleopunctatu 7.41.1 Acanthurus nigrofuscus 74.7 1.75 Pseudanthias taeniatus 18.52 3.49 Anampses meleagrides 59.26.12 Ctenochaetus striatus 7.37.61 Pseudochromis fridmani 74.7.79 Anampses twistii 81.48.28 Naso unicornis 18.52.3 Pseudochromis olivaceus 37.4.4 Bodianus anthioides 55.56.14 Zebrasoma xanthurum 14.81.3 Pseudochromis springeri 51.85.24 Cheilinus diagrammus 7.41.1 Siganus argenteus 7.41.3 Apogon aureus 11.11.2 Cheilinus mentalis 51.85.12 Siganus luridus 14.81.5 Apogon cyanosoma 7.41.1 Cheilinus trilobatus 29.63.5 Siganus rivulatus 18.52.14 Cheilodipterus lachneri 11.11.2 Coris aygula 44.44.4 Pardachirus marmoratus 3.7. Cheilodipterus novemstriatu 22.22.8 Coris caudimacula 77.78.26 Bothus pantherinus 3.7. Caesio lunaris 22.22.74 Gomphosus caeruleus 51.85.6 Balistapus undulatus 29.63.3 Caesio varilineata 18.52 1.28 Hologymnosus annulatus 14.81.1 Pseudobalistes fuscus 3.7. Parupeneuscy clostomus 7.41.1 Labroides dimidiatus 4.74.5 Rhicanthus assasi 18.52.3 Parupeneus forsskali 81.48.34 Larabicus quadrilineatus 48.15.8 Sufflamen albicaudatum 55.56.11 Parupeneus macronema 81.48.28 Macropharyngodon bipariyu 3.7.2 Amanses scopas 25.93.4 Parupeneus rubescens 7.41.1 Paracheilinus octotaenia 66.67 16.59 Cantherhines pardalis 59.26.7 Pempheris vanicolensis 7.41.2 Pseudocheilinus evanidus 51.85.12 Pervagor randalli 51.85.8 Chaetodon auriga 14.81.2 Pseudocheilinus hexataenia 62.96.12 Ostracion cubicus 44.44.4 Chaetodon austriacus 37.4.8 Pteragogus cryptus 7.41.1 Ostracion cyanurus 29.63.3 Chaetodon fasciatus 4.74.9 Stethojulis albovittata 37.4.17 Arothron diadematus 7.41.1 Chaetodon melannotus 33.33.5 Thalassoma rueppellii 88.89 3.17 Arothron hispidus 14.81.1 Chaetodon paucifasciatus 92.59.4 Thalassoma lunare 25.93.4 Canthigaster coronata 62.96.9 Heniochus intermedius 51.85.1 Calotomus viridescens 77.78.17 Canthigaster margaritata 25.93.5 Apolemichthys xanthotis 22.22.2 Chlorurus sordidus 25.93.7 Canthigaster pygmaea 7.41.1 Centropyge multispinis 77.78.16 Leptoscarus vaigiensis 7.41.1 Cyclichthys spilostylus 29.63.2 RSS-REL-T5. Annex 1_page 82 of 132

The highest average number of species (S) per 25 m² was found at 15 m transects (average=48.9) followed by 8m (average=4.9) and lowest at reef flat (average=36.9). The average number of species at all depths was (42.2). (Figure A- 56). 6. Number of species 5. 4. 3. 2. 1.. RF 8m 15m Depth Figure A- 56 Average number of species (S) for the three surveys at reef flat (RF), 8m, and 15m depths at the Thermal Power Station during 21-211. The highest number of individuals was recorded at 15m depth (average=1518) followed by 8m (average=1219.) and lowest was at RF (average=1113.6). Whereas the average of all transects was (average=1283.6). (Figure A- 57). 2. number of individuals 16. 12. 8. 4.. RF 8m 15m Depth Figure A- 57 Average number of individual (N) for the three surveys at reef flat (RF), 8m, and 15m depths at the Thermal Power Station during 21-211. The highest diversity was recorded at 15m depth (average=2.2) followed by 8m and RF (average=1.9, each). Whereas the average of all transects was (average=1.9). (Figure A- 58). Shannon-Wiener Diversity Index (H`) was highest at 15m deep transects (average=2.1), followed by 8m (1.8) and lowest at reef flat (average=1.5). RSS-REL-T5. Annex 1_page 83 of 132

Shannon-Wiener Diversity Index 2.5 2. 1.5 1..5. RF 8m 15m Depth Figure A- 58 Shannon-Wiener Diversity Index (H`) for the three surveys at reef flat (RF), 8m, and 15m depths at the Thermal Power Station during 21-211. The northern transects of the eastern intake site host more number of species (average of 3 surveys=42.7), followed by middle transects (average of 3 surveys=42.7) and lowest was at the southern transects (average of 3 surveys=33.2). Similar pattern was indicated for the number of individuals; the northern transects host highest number (average of 3 surveys=2191.1), followed by middle transects (average of 3 transcts=837.) and lowest was at the southern transects (average of 3 surveys=821.9). (Table A- 27). Table A- 27 Average number of species (S), average number of individuals (N), average species richness (d) and average Shannon-Weiner Diversity Index Per (25 m²) at Thermal Power Station during (Average of 3 surveys during 21-211). S N d H'(loge) RF N 47.7 ± 8.1 288.7 ± 637. 6.3 ± 1.3 1.6 ±.3 RF M 43. ± 3.8 1. ± 22.6 6.1 ±.5 2.1 ±.1 RF S 2. ± 1.2 252. ± 23.6 3.4 ±.2 1.8 ±.1 8m N 47.3 ± 8.6 2394.3 ± 65.7 5.9 ± 1.1 1.5 ±.1 8m M 41. ± 7. 777. ± 84.2 6. ±.9 2. ±.2 8m S 34.3 ± 5.9 485.7 ± 12.1 5.4 ±.7 2.3 ±.1 15m N 57. ± 7.1 29.3 ± 475.7 7.4 ±.8 1.9 ±.1 15m M 44. ± 9.1 736.7 ± 152.8 6.6 ± 1.4 2.3 ±.2 15m S 45.7 ± 1.8 1728. ± 147.3 6. ±.3 2.3 ±. RSS-REL-T5. Annex 1_page 84 of 132

Table A- 28 Average fish abundance (AA) and relative abundance (RA) and frequency of appearance (FA) per (5m2) at stations along the northern part of the Jordanian coast (Ayla), Gulf of. Station Station 2 Station 1 Station 4 Station 3 Station 6 Station 5 Depth 4m 9m 4m 9m 4m 9m Total Species AA RA AA RA AA RA AA RA AA RA AA RA AA RA FA Torpaenidae. Torpedo panthera.....33.1.......6. 5.56 Muraeindae.1 Siderea grisea.....67.1.33.3.. 2..2.5.1 22.22 Ophichthidae. Pisodonophis cancrivorous Callechelys marmoratus...33........33..11. 11.11.....33.1...33.1...11. 11.11 Synodontidae.1 Synodus variegatus...33....33.3.. 1.33.1.33.1 22.22 Trachinocephalus myops.33.2.......33.1...11. 11.11 Holocentridae. Sargocentron diadema.......33.3.....6. 5.56 Fistulariidae. Fistularia commersoni...... 1..1.....17. 5.56 Scorpaenidae.4 Pterois miles.... 1.33.3...67.3...33.1 27.78 RSS-REL-T5. Annex 1_page 85 of 132

Station Station 2 Station 1 Station 4 Station 3 Station 6 Station 5 Depth Dendrchirus brachypterus 4m 9m 4m 9m 4m 9m Total 1..6...33.1.. 2..8 1.67.2.83.2 33.33 Inimicus filamentosus...33..33.1.....33..17. 16.67 Scorpionopsis barbatus.........33.1 2.67.3.5.1 22.22 Serranidae.3 Epinephelus areolatus.......33.3.....6. 5.56 Epinephelus fasciatus.....33.1 3.33.32.. 2..2.94.2 33.33 Pseudanthias squamipinnis...... 1.67.16.....28.1 5.56 Pseudochromidae. Continued, Station Station 2 Station 1 Station 4 Station 3 Station 6 Station 5 Depth 4m 9m 4m 9m 4m Depth 4m 9m 4m Species AA RA AA RA AA RA AA RA AA Species AA RA AA RA AA Pseudochromis olivaceous.........33.1...6. 5.56 Apogonidae 2.7 Apogon aureus...... 1.67.16.....28.1 5.56 Apogbifa.......33.3.....6. 5.56 Apogon cyanosoma 1.33.9.. 1. 2.19.. 5..19 36.67.37 23.83.5 27.78 RSS-REL-T5. Annex 1_page 86 of 132

Station Station 2 Station 1 Station 4 Station 3 Station 6 Station 5 Depth Cheilodipterus novemstriatus 4m 9m 4m 9m 4m 9m Total 226.67 14.62.. 166.67 3.65.. 1.33.5.. 65.78 1.39 27.78 Cheilsp... 25..29...... 25..25 8.33.18 22.22 Carangidae 13.11 Decapterus macarellus.. 616.67 7.4...... 616.67 6.2 25.56 4.33 22.22 Trachurus indicus.... 25. 54.77...... 416.67 8.78 11.11 Caesionidae.94 Caesio varilineata...... 266.67 25.58.... 44.44.94 11.11 Nemipteridae 4.15 Scolopsis ghanam 343.33 22.15 313.33 3.58 1..22 6.33.61 228.33 8.73 28. 2.82 196.89 4.15 88.89 Gerriedae.97 Gerres oyena 2.33.15 18. 1.23 23.67.52 33.67 3.23.. 18. 1.9 45.94.97 55.56 Sparidae.58 Acanthopagrus bifasciatus.......67.6.....11. 5.56 Diplodus noct.... 29.33.64 116.67 11.19.... 24.33.51 22.22 Sparus aurata...... 18.67 1.79.... 3.11.7 11.11 Haemullidae. Pomadasys stridens...... 1..1.....17. 5.56 Lethrinidae 55.54 Lethrinus borbonicus 575. 37.1 521. 59.41.... 3.33.13 521. 52.32 183.6 38.56 55.56 RSS-REL-T5. Annex 1_page 87 of 132

Station Station 2 Station 1 Station 4 Station 3 Station 6 Station 5 Depth 4m 9m 4m 9m 4m 9m Total Lethrinus mahasena...... 1.33.13.....22. 5.56 Lethrinus variegates 166.67 1.75 1733.33 19.8.... 11. 42.5 1833.33 18.44 85.56 16.97 5. Mullidae 8.79 Continued, Station Station 2 Station 1 Station 4 Station 3 Station 6 Station 5 Depth 4m 9m 4m 9m 4m Depth 4m 9m 4m Species AA RA AA RA AA RA AA RA AA Species AA RA AA RA AA Mulloides flavolineatus.... 54.33 1.19...... 9.6.19 11.11 Mulloides vanicolensis........ 4..15...67.1 11.11 Parupeneus forsskali 9..58.67.1 222. 4.86 49. 4.7 486.67 18.61 276.67 2.78 174. 3.67 77.78 Parupeneus macronema 93.33 6.2.33. 1. 2.19 3..29 27. 1.32 466.67 4.69 155.56 3.28 55.56 Parupeneus rubescens.......33.3 3.33.13...61.1 11.11 Upeneus pori 91.33 5.89 1.33.12 195. 4.27 5..48 1. 3.82 37..37 77.41 1.63 72.22 Chaetodontidae 1.4 Chaetodon auriga.......33.3.....6. 5.56 Chaetodon fasciatus.......67.6.....11. 5.56 Chaetodon paucifasciaus...... 1..1.....17. 5.56 Heniochus diphreutus 4.33.28.. 1.67.23 7. 6.71 174. 6.65 137.33 1.38 66.6 1.39 55.56 RSS-REL-T5. Annex 1_page 88 of 132

Station Station 2 Station 1 Station 4 Station 3 Station 6 Station 5 Depth 4m 9m 4m 9m 4m 9m Total Heniochus intermedius.......67.6.67.3...22. 11.11 Pomacentridae 3.71 Abudefduf vaigensis...... 1.67.16.....28.1 5.56 Amphiprion bicinctus...........67.1.11. 5.56 Species AA RA AA RA AA RA AA RA AA RA AA RA AA RA FA Dascyllus trimaculatus 5.33.34.33. 9.33.2 28.33 2.72 5.67.22 23.33.23 12.6.25 66.67 Neopomacentrus miryae Pomacentrus trichourus.... 45. 9.86 4. 38.36.... 141.67 2.99 22.22...... 3.33.32.....56.1 11.11 Teixeirichthys jordani 16. 1.3 1.33.2 111. 2.43.... 1.33.1 21.61.46 55.56 Labridae 2.98 Cheilinus abudjubbe.........33.1...6. 5.56 Cirrilabrus rubiventralis.. 342.33 3.91.... 3.33.13 342.33 3.44 114.67 2.42 38.89 Coris caudimaculatus.. 1.33.2 1.33.3.. 1.33.5 1.33.1.89.2 22.22 Labriodes dimidiatus.......33.3.....6. 5.56 Oxychelinus orientalis.. 9.33.11 4..9.. 2.67.1 19.67.2 5.94.13 55.56 Paracheilinus octotaenia...... 3..29.. 46.67.47 8.28.17 11.11 Pteragogus pelycus 13..84 16.67.19.67.1.. 11..42 21..21 1.39.22 66.67 Continued, RSS-REL-T5. Annex 1_page 89 of 132

Station Station 2 Station 1 Station 4 Station 3 Station 6 Station 5 Depth 4m 9m 4m 9m 4m 9m Total Station Station 2 Station 1 Station 4 Station 3 Station 6 Station 5 Depth 4m 9m 4m 9m 4m Depth 4m 9m 4m Species AA RA AA RA AA RA AA RA AA Species AA RA AA RA AA Thalassoma klunzingeri...... 1.33.13.....22. 5.56 Xyrichtys melanopus.........67.3...11. 11.11 Xyrichtys pentadactylus.33.2...67.1 2..19.67.3...61.1 22.22 Scaridae.5 Calatomus viridescens.....67.1 1..1.....28.1 11.11 Scarus psittacus........ 3.33.13 1..1 2.22.5 16.67 Pinguipedidae. Parapercis hexophtalma.........33.1...6. 5.56 Blenniidae. Meiacanthus nigrolineatus.......33.3.....6. 5.56 Gobiidae.1 Amblygobius albimaculatus Asteropterix semipunctatus.. 3.33.4.67.1 1.33.13.. 3.33.3 1.44.3 44.44.. 2.33.3...... 2.33.2.78.2 22.22 RSS-REL-T5. Annex 1_page 9 of 132

Station Station 2 Station 1 Station 4 Station 3 Station 6 Station 5 Depth 4m 9m 4m 9m 4m 9m Total Istigobius decortatus...... 1..1.....17. 22.22 Valenciennea puellaris.............. 16.67 Vanderhorstia sp...33....67.6.33.1.33..28.1 22.22 Acanthuridae.3 Acanthurus nigricans.....67.1 1.33.13.....33.1 16.67 Acanthurus nigrofuscus.... 1..2 5.67.54.... 1.11.2 16.67 Ctenochaetus striatus............... Zebrasoma veiliferum.......67.6.....11. 5.56 Siganidae 5.48 Siganus luridus...... 1.67.16 34.33 1.31 44..44 13.33.28 27.78 Siganus rivulatus.. 366.67 4.19 566.67 12.41 3.33.32 168.33 6.44 375. 3.77 246.67 5.2 44.44 Balistidae. Pseudobalistes fuscus.....33.1.......6. 5.56 Suflamen albicaudatus.........67.3...11. 5.56 Monacanthidae. Continued, Station Station 2 Station 1 Station 4 Station 3 Station 6 Station 5 Depth 4m 9m 4m 9m 4m Depth 4m 9m 4m Species AA RA AA RA AA RA AA RA AA Species AA RA AA RA AA RSS-REL-T5. Annex 1_page 91 of 132

Station Station 2 Station 1 Station 4 Station 3 Station 6 Station 5 Depth Paramonacanthus falcatus 4m 9m 4m 9m 4m 9m Total.....33.1.......6. 5.56 Bothidae.1 Bothus pantherinus.67.4.33..33.1.. 1.33.5.33..5.1 44.44 Ostraciidae. Ostracion cubicus.......33.3.....6. 5.56 Tetraodontidae.2 Arothron hispidus...33....33.3...67.1.22. 22.22 Arothron stellatus...33..33.1.33.3...33..22. 22.22 Canthiagaster coronata Canthiagaster margaritata.....67.1.......11. 5.56.....67.1.33.3.67.3...28.1 16.67 Diodontidae. Chiloimycterus spilostylus...........33..6. 5.56 Sum 155. 1. 8754.67 1. 4564.67 1. 142.67 1. 2615.67 1. 9921.67 99.81 4745.86 1. RSS-REL-T5. Annex 1_page 92 of 132

A7. Coral reef larvae The planktonic larvae of fish and invertebrates (collectively defined coral reef larvae ) were sampled using a Multiple Opening-Closing Net and Environmental Sensing System (MOCNESS), with a 1 m 2 mouth opening and equipped with a CTD, and a flow meter. Mesh sizes used were 6 µm for the fish larvae (towed at 1.7-2.3 knots) and 1 µm for the invertebrate larvae (towed at 1.4-2 knots). MOCNESS nets of 6 µm mesh-size are well within the range used for studies of fish larvae. Since plankton net tows (of all types) rarely report trapping of coral larvae ( planulae ), we experimentally tested the suitability of the 1 µm mesh net for their sampling. Several hundreds planulae were collected overnight from individual colonies of the coral Stylophora pistillata, using standard planulae traps (shaped like an upside-down funnel with a collecting jar at the top, positioned overnight above the coral). In the next morning, 1 planulae were separated under the microscope, transferred to a jar, taken to a boat, and inserted into a plankton net (1 µm mesh, single mouth) which was rapidly lowered to the water and towed under the same conditions (speed and duration) as our MOCNESS tows. At the end of the tow the planulae remaining in the net were collected and brought to the laboratory for microscopic screening. This experiment was repeated 2 times, with the result of both replicates showing that the planulae survived the tow with no apparent morphological damage, with some of the larvae being alive and active. Additional control tows with the MOCNESS were carried out to verify accuracy of discrete sampling (lack of contamination by plankton from non-targeted depths) and overall performance. Rare gaps in the data occurred due to equipment failure (see Table A-22). Each sampling expedition took 2 consecutive days. Figure A- 59 shows the sampling sites and depths. The dates and types of all sampling expeditions are listed in Table A-22. Fish larvae were collected twice a month (starting in June), whereas invertebrate larvae were sampled once a month (starting in July). For fish larvae the upper 1 m were sampled at a resolution of 25 m, whereas the water-column between 1 and 18 m was sampled at 4 m resolution. For invertebrate larvae, the upper 18 m of the water column was divided into three layers, each 6 m wide (except the shallowest station, where the bottom depth was 5 m and the sampled layer was -25 m). Note that in order to minimize the rist of hitting the bottom (which could damage both the reef and the MOCNESS), an elevation threshold of 25 m was set. That is, the closest distance from the bottom in which larvae were sampled was 25 meters above bottom (25 mab). Following the project meeting in Venice in March 211, a request to extend the sampling depths to 21 m and a corresponding reduction of the total stations sampled was submitted to the World Bank. Following the WB approval of that request, the MOCNESS sampling of invertebrate larvae in March, April and May 211 was extended to 21 m depth, using 3 m resolution in the lower part so that the sampling layers were 21-18-15-12-9-6- m depth, at the MSS, North Beach and MG station at distances from shore where the bottom depth reaches > 24 m (that is, no sampling was carried out along the coral reef of Eilat and at the shallow ). RSS-REL-T5. Annex 1_page 93 of 132

Figure A- 59 Map showing a schematic chart of the MOCNESS sampling stations of coral-reef larvae. Triplicates of full circles along full lines indicate the path of consecutive samples at different depths. For the invertebrate larvae, at stations where the bottom was deeper than 25 or 4 2 m the sampled layers were 18 to 12, 12 to 6, and 6 to m. At intermediate stations (bottom depth of 15 m) only the two shallower layers (12-6 and -6) were sampled, whereas at the shallowest stations (bottom depth of 5 m) only a single layer ( to 25 m) was sampled. Thereby, 25 m above bottom was the closest distance the MOCNESS reached to the bottom. For fish larvae the upper 1 m were sampled at a resolution of 25 m, whereas the water-column between 1 and 18m was sampled at 4 m resolution. An additional transect was regularly carried out for fish larvae (only) at the Israeli side of the north beach (with sampling locations being a mirror image of those along the Jordanian side). RSS-REL-T5. Annex 1_page 94 of 132

Table A- 29 List of MOCNESS cruises during which the larvae of fish and benthic invertebrate were collected at stations and depth shown in the above Figure. Date Fish larvae Invertebrate 16.6.21 + l 17.6.21 + 4.7.21 + 5.7.21 + 21.7.21 + + 22.7.21 + + 4.8.21 + 18.8.21 + + 19.8.21 + + 2.9.21 + + 21.9.21 + + 6.1.21 + 7.1.21 + 19.1.21 + + 7.11.21 + + 8.11.21 + + 24.11.21 + 25.11.21 + 6.12.21 + + 7.12.21 + + 9.1.211 + + 1.1.211 + + 7.2.211 + + 8.2.211 + + 29.3.211 + + 6.4.211 + 26.4.211 + + 28.4.211 + + 25.5.211 + + 26.5.211 + + RSS-REL-T5. Annex 1_page 95 of 132

Samples of fish larvae were preserved on board in 8% buffered ethanol, whereas invertebrate samples were preserved in 4% buffered formalin. In the lab, fish samples were scanned in their entirety under a dissecting microscope. Invertebrate larvae were counted in sub-aliquots withdrawn from the preserved samples using a Stempel Pipette. The number of aliquots counted per sample was 3 to 4, so that the CV value between aliquots would not exceed 25%. Larger CV values were accepted for samples where the total number of animals was exceedingly low. The total number of larvae counted in samples with normal density usually exceeded 5 individuals, with many samples reaching counts of 8-9. The total number of larvae counted by the time this report is written is 8,7 in 89 samples. Counts were corrected for the volume of water sampled per net, and absolute abundance estimates are presented as larvae per 1 and 1 m 3, for invertebrate and fish larvae, respectively. Invertebrate larvae were sorted into 12 taxonomic groups, defined based on the certainty in their microscopic identification as larvae of benthic animals ( meroplankton ), rather than holoplanktonic species. Therefore, at least one group of presumably abundant larvae, that of decapod larvae (e.g., crabs), for which such separation is complex, were excluded from our counts. A comparison of the distribution and abundance between invertebrate larvae and holoplanktonic animals was made based on concurrent counts in our samples of Chaetognaths (arrow warms) - a classical holoplanktonic taxon. Fish larvae were pooled in a single taxonomic group. For the MSS and NR samples, the proportion of fish larvae belonging to taxa with a benthic adult phase (i.e. coral-reef associated) was estimated using depth-specific conversion factors. These factors ( percent benthic ) were derived in an independent study, in which larvae collected along the NR site were identified to the family level and separated from larvae of pelagic fishes. This analysis showed ranges of 6-8% and 2-9% of larvae of benthic species in the near- and far-stations, respectively. The microscopic sorting of plankton is a slow and laborious process. A total of 19,958 individual invertebrate larvae and 22,292 fish larvae were sorted under the microscope in all the samples combined. RSS-REL-T5. Annex 1_page 96 of 132

A7.1 Genetic connectivity By using two types of molecular markers (polymorphic alleles on microsatellite loci and AFLP), this study suggests elucidating profiles of population genetics of selected reef organisms along both, Israeli and Jordanian coasts. Since developing any new set of microsatellite loci should take at least two years of work, which is unfeasible, we have used here sets of microsatellite loci that have already been developed for two important Red Sea coral species (Pocillopora and Seriatopora). We further used AFLP markers for an important reef organism residing along the Jordanian and the Israeli coasts (the coral-pest snail Drupella). By employing above molecular markers, we sampled DNA from organisms belonging to different populations of each selected species and elucidated their population genetics properties. These microsatellites and AFLP markers are also used to fill in the gaps in knowledge on population genetics profiles of the selected reef species in the northern Gulf of Eilat/, providing the necessary background information for future monitoring and conservation measures. A7.2 Drupella cornus It has been documented for nearly four decades that populations of the corallivorous snail Drupella cornus in the central Indo-Pacific and western Australia exhibit 'outbreaks' (>1 snails/m2) that result in loss of coral colonies, usually acroporid and pocilloporid corals (Moyer et al., 1982; Turne, 1994; McClanahan, 1997; Shafir et al,. 28 and literature therein). The same phenomenon appears in the Red Sea and Gulf of Eilat reefs (Al-Moghrabi, 1997; Antonius and Riegl, 1998; Hassan et al., 22; Zuschin and Stachowitsch, 27; Shafir et al., 28). This species, while exhibiting small variations in allelic frequencies (Holborn et al., 1994), has been given numerous names in the taxonomic literature (Johnson et al., 1993; Johnson and Cumming, 1995). As other gastropods, Drupella cornus has widespread planktotrophic larvae with a larval stage lasting about 3 days (Turner, 1992; Holborn et al., 1994), sexual maturity between 2.5 and 3.5 years, and longevity of individuals can reach up to 45 years (Black and Johnson, 1994). Very little is known on Drupella cornus population genetics. Past studies (Johnson et al., 1993) performed on nine polymorphic allozyme loci revealed relatively large genetic subdivisions among groups of Drupella cornus recruits within sites over distances of <8 m, measured as Fst of.44, despite low levels of geographic subdivisions, all suggesting a larval patchiness, i.e., larvae from relatively few mattings being transported as cohesive groups (Johnson et al., 1993).Working on Drupella cornus at Ningaloo Reef, Western Australian 1 polymorphic allozyme loci, Holborn et al. (1994) found along 117 km small variations in allelic frequencies (average Fst=.7), indicating that a high degree of planktonic dispersal is the norm. Drupella cornus is an important coral predator species in the northern Gulf of Eilat (van Treeck and Schuhmacher, 1997; Zuschin and Stachowitsch, 27; Shafir et al., 28). More than a decade after its first outbreak in the Red Sea (Al-Moghrabi, 1997; Antonius and Riegl, 1998) and its wide distribution on its reef flats, fringing reefs and fore reefs(ismail et al., 2; Schoepf et al., 21), RSS-REL-T5. Annex 1_page 97 of 132

position this species as one of the prime candidates for studying biological connectivity routes in the northern Gulf. Materials and methods Animal collections and DNA extracts. Live individuals of Drupella cornus were collected from five locations along the Israeli coast and from three along the Jordanian coast (Table 1).Following collections, snail shells were cracked to allow removal of the animal s pedal area with industrial razor blades. Upon collection, each isolated foot was divided into two parts, each homogenized separately in plastic vial containing 2µl of lysis buffer(.25m Trisborat ph 8.2,.1 EDTA, 2% SDS,.1M NaCl)mixed with 4µl of sodium perchlorate [NaClO4]. Vials were shipped to the laboratory in Haifa for further analyses. In the laboratory, 24µl of Phenol/Chloroform/Isoamyl alcohol (25:24:1) were added to each vial, vortexed for 1 min and centrifuged for 1 min at 14,g, 4ºC. The aqueous phase was further extracted with chloroform/isoamyl alcohol (24:1). The DNA was precipitated with absolute ethanol, washed with 7% ethanol, dried and re-suspended in water. Table A- 3 Drupella cornus: Sites, number of collected specimens in the northern Red Sea (Is.= Israel; Jr.= Jordan) and specimen used for COI and AFLP analyses. See also Figure A-53. 1 for further details on collection sites. Location Sampled specimen COI (n) AFLP (n) GPS Is. Taba 3 27 29 29 º 29'32.8"N 34 54'14.77"E Is. IUI 3 9 19 29 º 3'3.11"N 34 54'59.1"E Is. Dekel 35 27 19 29 º 32'22.6"N 34 56'5.52"E Is. Kisoski 3 27 15 29 º 32'5."N 34 57'13.56"E Is. Nursery 3 12 24 29 º 32'32.76"N 34 58'21.78"E Jr. Marine lab 3 13 21 29 º 27' 58. "N 34 58' 31.85"E Jr. North 3 21 18 29 º 28'5.5"N 34 58'51.7"E Jr. South 3 21 23 29 º 25'54.5"N 34 58'37.5"E AFLP assays The amplified fragment length polymorphism (AFLP; Voset al,. 1995) is a highly variable DNA marker, one of the best genetic techniques recently developed for evaluating all genetic aspects for individuals and species analyses. AFLP technology generates DNA fingerprints and requires no prior sequence information or probe collections (Micketet al., 23). High quality genomic DNA (.5µg) was digested with a pair of restriction enzymes (EcoRI/MseI) at 37ºC for 3 hrs, then ligated to double stranded EcoRI and MseI adaptors. The resulting fragments were pre-amplified with non-selective primers, the ligated adaptors, serving as target sites for primer RSS-REL-T5. Annex 1_page 98 of 132

annealing. Three selective primer combinations were used for AFLP amplification as follows: E- ACG/M-CAA, E-ACA/M-CAC, and E-ACT/M-CTT. The selective EcoRI (E-) primers were labelled with fluorescent (NED-E-ACG, FAM-E-ACA, and VIC-E-ACT). PCR reactions were carried out in a total volume of 2l. PCR amplification cycles were started at annealing temperature of 65ºC, after which the annealing temperature was lowered by.7ºc per cycle for 12 cycles (a touch down phase of 13 cycles) and then 23 cycles at annealing temperature of 56ºC. The fluorescent labeled PCR productswas analyzed in an automated sequence analysis system (Applied Biosystems ABI PRISM 31 Genetic Analyzer) as follow:.5μl of each selective amplification product was mixed with.5μl of the LIZ 5-5 size standard (Applied Biosystems) and 13μl of Formamide (bio-lab Israel), denatured and loaded on 16-capillary system. Fluorescent amplification products were analyzed using Genotyper version 3.7 NT (Applied Biosystems). Amplification products were scored as discrete character states (present/absent) and transformed into band frequencies. All samples were amplified and ran in duplicates to validate repeatability. The similarities between duplicated fingerprints should be higher than 98%. Samples that exhibited unclear band formations (<5% of all amplification products), suggesting contamination, were excluded from the analysis. Diversity values were based on phenotype frequency (phenotypes being the band patterns produced by individual primer pairs). Data were analyzed by POPGENE software version 1.31 (Yehet al., 1997), Tools for Population Genetic Analyses (TFPGA) software version 1.3 (Miller, 1997) and GENALEX 6 (Peakall and Smouse, 26). These programs consider AFLP bands as diploiddominant markers, in which the estimated allele frequencies are based on the square root of the frequency of the null (recessive) genotype. Population differentiations were tested by exact tests (1 dememorization steps, 1 batches, 2 permutations per batch: Raymond & Rousset 1995). Bayesian clustering for population structures was performed with STRUCTURE 2.3 (Pritchard et al., 2) and BAPS 5.4 (Corander et al., 28). COI analyses. COI genes of 192 Drupella cornus samples were amplified using the universal primers according to Folmer et al. (1994) using the COI marine invertebrates universal primers (HCO2198r, 5 TAAACTTCAGGGTGACCAAAAAATCA3 and LCO149f, 5 GGTCAACAAATCATAAAGATATTGG3. One µl of diluted DNA (1:5) from each sample was added to a reaction mixture containing 5µM of each primers and DreamTaq DNA polymerase (Green PCR Master Mix 2 ; Fermentas) in a total solution volume of 5µl. Reaction conditions were as followed: 74ºC for 1sec and 95ºC for 5 min followed by 35 cycles of 95ºCfor 1 min, 45ºC or 1 min and 72ºC for 1 min and additional elongation step of 72ºC for 1 min. The PCR products were screened on 1.2% agarose gel. The same PCR primers also been used for direct sequencing of the PCR products (Macrogen Inc, South Korea). All sequences were aligned and corrected using BIOEDIT software and 157 good quality sequences were used for further analysis (Table A- 3). Haplotype analysis was performed using GeneAlex 6.3. Maximum likelihood and Neighbour joining trees were constructed using Topali V2.5 software and TFPGA. Bayesian clustering for population structures was performed as above. RSS-REL-T5. Annex 1_page 99 of 132

Results COI analysis Drupella cornus COI sequences (Appendix 1) did not match any known COI sequence in databases, BOLD and NCBI. Best homologies were yielded by Ergalatax margariticola(a scavenger mollusk distributed on tropical rocky shores along the Red Sea, the Indian Ocean and in the Western Pacific Ocean and Japan)and Ergalatax junionae(a Red Sea mollusk, now invaded into shallow waters of the eastern Mediterranean; Karhan & Yokes 29) COI sequences, both belong to the family Muricidae. Haplotype analysis of 157 COI sequences using GenAlex 6.4 revealed 84 haplotypes (Figure A- 6) arranged in 3 main families (termed clades), named according to the haplotype containing the largest number of sequences: clade 43, including 89 sequences, encompassing of 25 identical sequences of haplotype 43 (this clade also encompassed a small group of five individuals which branched separately from the main group, but still, were closer to clade 43 then to any other clade [Figure A- 61]); clade 9 with 42 sequences including 15 sequences of haplotypes 9; clade 3 with 26 sequences containing 8 haplotype 3 identical (Figure A- 61). Clade 43 snails were recorded in all eight Israeli and Jordanian locations (these include only 5/84 haplotypes in this clade; 31 and 48 haplotypes appear only in Jordan and in Israel, respectively), while the vast majority of the 68 specimen belonging to clades 9 and 3 appeared only in the Israeli samples (except for one specimen of clade 9 sampled in north). Taba showed the lowest number of haplotypes (9) in 21 animals analyzed, while site Kisoski (12 haplotypes in 13 animals analyzed) was highly polymorphic (Table A- 31). Dekel Beach showed the highest number of unique COI haplotypes. In most sampled sites, unique haplotypes were the most common, ranging 69.2-91.6% of all haplotypes (Table A- 31). A phylogenetic tree and Nei genetic distance between the 3 clades showed that clades 43 and 9 were more closely related to each other genetically than clade 3 (Table A- 32; Figure A- 62). The genetic identity ranged between.448 and.658 (Table 3) revealing that each clade significantly differed from each other. Phylogenetic COI analyses of Drupella cornus with other GeneBank sequences available for members of the family Muricidae, showed that clades 4 and 9 were closely related to Ergalatax margariticola, while clade 3 was more related to Ergalatax junionae (Figure A- 63), a mollusc species migrated into the Mediterranean Sea. Both Ergalatax species are not coral associated molluscs (all Drupella snails were collected from alive coral species). Clearly, COI analyses of the Muricidae is not yet completed and the different COI clades should warrant further analyses. Analysis of all COI sequences, according to their collecting sites, showed that the Drupella cornus populations from were different from the population sampled along Eilat coast, except for the Inter-University Institute (IUI) population which was genetically more related to the populations (Figure A- 64 and Table A- 33). For further study of the Jordanian-Israeli shared clade (clade 43 snails were recorded in all 8 Israelis and Jordanians locations), population analysis of Drupella cornus COI sequences were performed only on this snail s clade collected from and Eilat (Figure A- 65). Results showed clearly that all North Gulf populations were related with the Israeli IUI population closely relating to south, and lab and Dekel Beach population closely related to north population, with the Nursery population relating to above populations (Figure A- 65). RSS-REL-T5. Annex 1_page 1 of 132

Table A- 31 COI haplotypes in each site. Abbreviations: AL Lab; AN North; AS South; DB Dekel Beach; IUI Inter University Institute; KIS Kisosky Beach; NUR Nursery; TABA Taba beach. Percentages reveal the proportions of unique haplotypes out of the total haplotypes/site. Specimen analyzed AL AN AS DB IUI KIS NUR TABA 27 9 27 27 12 13 21 21 Haplotypes (n) 18 8 18 19 7 12 15 13 Unique haplotypes 14 (77.8%) 7 (87.5 %) 15 (83.3 %) 17 (89.5 %) 6 (85.7 %) 11 (91.6 %) 12 (8. %) 9 (69.2 %) Table A- 32 Nei's (1972) distance (upper) and identity (lower) between Drupella cornus clades. Clade 3 Clade 9 Clade 43 Clade 3 *****.5696.826 Clade 9.5658* *****.4182 Clade 43.4482*.6582* ***** * = Significant p<.1 (exact test) Table A- 33 Nei's (1972) distance (upper) and identity (lower) between Drupella cornus populations. Abbreviations: AL Lab; AN North; AS South; DB Dekel Beach; IUI Inter University Institute; KIS Kisosky Beach; NUR Nursery; TABA Taba beach. AL AN AS DB IUI Kis NUR TABA AL *****.6.2.229.3.373.274.293 AN.994 *****.6.177.7.326.225.235 AS.998.994 *****.235.1.384.282.31 DB.796*.838*.79* *****.241.76.22.8 IUI.998*.993.999.786 *****.39.288.37 Kis.689*.722*.681*.927*.677* *****.2.42 NUR.76.798*.754.978*.75*.981* *****.8 TABA.746.791.74*.993.736*.959*.992* ***** * = Significant p<.1 (exact test) RSS-REL-T5. Annex 1_page 11 of 132

1, 8%, %, % 1, 8%, %, %, %, %, % 1, 8% 1, 8%, %, %, %, % 1, 8%, % 1, 8%, % 6, 5% Thetis SpA 1, 8%, % 1, 8%, % 1, 8%, % 1, 8%, % 1, 8%, % 1, 8%, % %1, 4% 1, 4%, % 1, 4%,, % 1, 4%,, %1, 4%,, % 1, 4%, % 1, 4% 1, 8%, % 2, 15% 1, 8%, % 1, 8%, % %1, 5% 1, 5%, 1, % 5% 1, 5%, % 1, 5%, % 1, 5%, % 3, 14%, % 1, 4%, % 1, 4%, % 8, 3%, % 1, 8% 1, 8% 4, 19% 1, 5%, % 1, 5% 2, 7%, % 1, 4%, % 1, 4% 1, 4% 1, 4% 1, 4% 1, 4%, % 1, 4%, % 1, 4%, % 1, 5% 1, 5% 2, 1%, % 1, 5%, % 1, 5%, % %1, 5%, % 1, 5%,, %1, 5%, 1, 5%, %, % 1, 5%, % 1, 5% 3, 14%, % 1, 5% 4, 19% 1, 5%, % 1, 11%, % 1, 11%, % 2, 1%, %, % 3, 14%, %, % 1, 11%, % 1, 5%, % 2, 22% 1, 11%, %, % 1, 11% 1, 11%, %, % 1, 11% 2, 7%, % 2, 7% 1, 4%, 1, % 4%1, 4%, % 1, 4% 1, 4%, % 1, 4%, % 1, 4%, % 1, 4%, % 1, 4% 1, 4%, 1, %, 4% % 1, 4% 2, 7% 1, 4%, %, 1, % 4% 7, 26% 2, 7% %1, 4% 1, 4%, % 1, 4%, 1,, % 4% % 1, 4%, %1, 4%,, % 1, 4% 1, 4%, %, % 1, 4%, % 1, 4%, % 1, 4%, % 1, 4%, % 1, 4% 8, 3% Figure A- 6 COI haplotype frequencies of Drupella cornus and their distributions in the 8 collecting sites (marked by green circles. Yellow lines delineate the borders between Israel/Jordan and between Israel/Egypt. 1,, 4% % 2, 7% 1, 4%, %, % RSS-REL-T5. Annex 1_page 12 of 132

NUR16 Thetis SpA AL21 AS1 AS21 AL29 AL5 AS11 AL14 IUI13 IUI5 AS13 AN2 AS25 IUI1 IUI9 Clade 43 (n=89) AS12 AS15 AL18 AS5 AS7 AL2 AS2 KIS2 AN4 AS27 AL16 AS28 AL8 NUR15 DB14 AS19 AS2 TABA13 AS1 IUI1 AL6 IUI15 AS8 AL1 AS29 DB15 AS18 AN9 IUI6 IUI11 IUI2 AL11 AL1 AL9 DB2 AL25 AS16 AL3 DB3 DB4 AL24 AS9 AN6 IUI8 AL13 AL15 AS23 AN8 AS3 TABA5 AL28 AL3 AS22 Clade 3 (n=26) NUR1 TABA6 AL26 AN1.2 AS3 IUI16 NUR22 KIS11 KIS14 KIS15 AN7 TABA24 TABA22 DB3 KIS5 AN5 NUR21 TABA9 NUR24 DB1 AL19 NUR2 NUR18 TABA17 KIS3 NUR17 DB22 NUR1 IUI19 DB16 KIS16 KIS6 AL7 TABA25 DB1 TABA23 NUR11 TABA8 DB25 AS4 AL23 NUR12 AS26 AL22 KIS9 AL4 AN3 NUR4 DB6 TABA21 DB12 KIS13 KIS12 NUR8 TABA7 NUR23 DB28 TABA12 DB2 TABA2 TABA15 KIS1 TABA31 DB27 TABA16 DB24 NUR25 TABA3 TABA28 DB8 NUR3 DB7 DB26 DB13 DB11 NUR5 TABA29 DB18 NUR6 DB17 DB29 KIS1 NUR19 NUR7 DB21 TABA11 DB23 AS6 AL12 Clade 9 (n=42) Figure A- 61 Maximum likelihood tree of Drupella cornus COI sequences. Abbreviations: AL Lab; AN North; AS South; DB Dekel Beach; IUI Inter University Institute; KIS Kisosky Beach; NUR Nursery; TABA Taba beach. Clade 9 Clade 43 Clade 3 Figure A- 62 Phylogenetic tree of the three Drupella cornus clades. RSS-REL-T5. Annex 1_page 13 of 132

TABA13 NUR12 KIS2 AS1 AS18 AL3 IUI11 DB1 AN2 AL1 IUI1 DB14.2 Morula mutica Morula granulata Morula musiva Morula anaxares Morula marginalba isolate RA4 Muricodrupa fiscella Morula rumphiusi Pascula ochrostoma Morula spinosa Ergalatax contracta Ergalatax junionae DB16 TABA22 NUR1 TABA17 AN1 KIS14 TABA5 NUR1 KIS9 DB1 Ergalatax margariticola NUR11 KIS11 TABA11 KIS1 DB11 NUR4 AN3 KIS1 TABA12 DB12 NUR3 Figure A- 63 Maximum likelihood tree of representative sequences of Drupella cornus COI from northern Gulf of Eilat (only representatives from each clade were included to simplify the figure) with other Muricid COI sequences from the GeneBank. RSS-REL-T5. Annex 1_page 14 of 132

Nursery Taba beach Dekel Kisosky South Inter University Institute Lab North Figure A- 64 Population analysis of Drupella cornus COI sequences from and Eilatneighbour- joining tree for all populations. Figure A- 65 Population analysis of Drupella cornus Clade 43 COI sequences from and Eilat- neighbor- joining tree for all populations. Bayesian analysis of population structure using the 157 individuals through the clustering with linked loci approach in a population mixture analysis, with PABS 5.4, revealed optimal partition in 4 clusters (Log (marginal likelihood) of optimal partition: -1928.837) with probabilities for the number of clusters, n=1.. (Figure A- 66, Table A- 34). Each cluster contains individuals from several collecting sites, further attesting to the existence of COI mixed Drupella population in the northern Gulf, while COI patchiness can also be revealed. RSS-REL-T5. Annex 1_page 15 of 132

Figure A- 66 graphical presentation of the Bayesian clustering of all individuals, each individual is represented by a thin vertical line, each colour represent a different cluster. All lines between two black thick vertical lines represent individuals collected at the same location. Table A- 34 Best Partition of individuals using BAPS and their original locations. Cluster 1 (red) Cluster 2 (green) Cluster 3 (Blue) Cluster 4 (Yellow) List of individual colony in each cluster 71, 77, 82, 85, 9, 15, 16, 17, 11, 113, 114, 115, 123, 124, 128, 129, 131, 132, 133, 135, 141, 147, 15, 151, 152, 153 1, 2, 3, 5, 6, 7, 8, 9, 1, 11, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 4, 41, 43, 44, 45, 46, 47, 48, 49, 5, 51, 52, 53, 54, 55, 56, 57, 58, 59, 6, 61, 62, 63, 64, 65, 66, 67, 75, 76, 91, 92, 93, 94, 95, 96, 97, 98, 99, 1, 11, 12, 14, 116, 125, 126, 127, 137, 138, 144 3, 68, 69, 7, 72, 73, 74, 78, 79, 8, 81, 83, 84, 86, 87, 88, 89, 13, 19, 111, 112, 117, 118, 119, 12, 121, 122, 13, 134, 136, 139, 14, 142, 143, 145, 146, 148, 149, 154, 155, 156, 157 4, 12, 2, 42, 18 RSS-REL-T5. Annex 1_page 16 of 132

AFLP analysis DNA was extracted from 245 Drupella cornus specimens, in duplicates (total of 49 DNA samples), out of which 384 DNA samples were in good quality for the AFLP procedure. Only 336 samples showed good quality for both duplicates/specimen ending up with 168 snails available for analyses (Table A- 3). All statistical analyses were performed on a single sample from each duplicate. In total, 453 loci were scored in all Red Sea populations, revealing similar distributions of loci in the Israeli and Jordanian populations (Table A- 35). The percentage of polymorphism loci range 6.71% - 95.81% (mean 78.48% + 5.24%). The highest percentages of polymorphism were found in the Nursery site (Israel) and the Marine Lab (Jordan). Population analysis of Drupella cornus AFLP loci from and Eilat (Figure A- 67) revealed high similarities between the Israeli and the Jordanian populations, comparably to the Drupella cornus Clade 43 COI analyses from and Eilat (Figure A- 65). The Neighbour- joining tree of Drupella cornus AFLP readings for individual snails (Figure A- 68) showed a similar outcome of possible high biological connectivity between the north Gulf Drupella populations. Table A- 35 Number and percentage of polymorphic AFLP loci. Population ID Polymorphic AFLP loci numbers % Jr. Marine lab 414 91.39% Jr. North 284 62.69% Jr. South 33 66.89% Is. Dekel 43 94.92% Is. IUI 384 84.77% Is. Kisoski 275 6.71% Is. Nursery 434 95.81% Is. Taba 32 7.64% Total Jordan 447 98.68% Total Israel 453 1.% All populations 453 1.% Nei's (1972) distance and identity between Drupella cornus populations (Table A- 36) reveal that the different 8 snail populations in the northrn Gulf are closely related to each others, representing a possible single genetrically homogeneous population. This is further supported by the joining tree for all populations (Figure A- 67) showing that the Jordanian populations are intemingled with the Israeli populations. RSS-REL-T5. Annex 1_page 17 of 132

Table A- 36 Nei's (1972) distance (upper) and identity (lower) between Drupella cornus populations. Abbreviations: AL Lab; AN North; AS South; DB Dekel Beach; IUI Inter University Institute; KIS Kisosky Beach; NUR Nursery; TABA Taba beach. AL AN AS DB IUI KIS NUR TABA AL ****.952.9682.976.9746.9467.9691.951 AN.51* ****.9749.9479.9675.9825.9761.9852 AS.323*.255* ****.9538.9712.9739.9752.9734 DB.298*.535*.473* ****.9755.9489.9778.955 IUI.257.33*.292.248 ****.9733.985.9741 KIS.548*.176.264.524*.27* ****.9776.992 NUR.314*.242*.251*.225*.151.226 * ****.9792 TABA.512*.149.27*.58*.262*.98.211* **** * = Significant p<.1 (exact test) lab Dekel beach IUI Nursery north Kisosky beach Taba beach south.2 Figure A- 67 Population analysis of Drupella cornus AFLP loci from and Eilatneighbor- joining tree for all populations. RSS-REL-T5. Annex 1_page 18 of 132

Taba1 Thetis SpA Dekel beach19 Dekel beach18 Dekel beach8 north24 lab17 Dekel beach4 Dekel beach3 Dekel beach17 Dekel beach16 IUI5 Nursery9 IUI1 Nursery16 Nursery7 Nursery14 Nursery13 Nursery3 IUI2 Nursery5 Nursery6 Nursery4 Dekel beach7 Dekel beach21 Dekel beach5 Nursery2 north1 lab18 IUI15 Nursery22 Nursery23 Kisosky9 south6 south5 Taba9 Taba12 IUI 9 south14 south9 Nursery25 south2 Kisosky16 Kisosky8 IUI7 IUI6 Nursery24 Taba21 Nursery21 north7 IUI17 Taba3 Taba5 Taba18 Kisosky4 Taba8 south28 Taba17 south27 IUI 12 IUI 8 IUI16 Taba31 IUI13 Kisosky3 Taba32 Dekel beach9 IUI 19 IUI18 Taba29 Kisosky2 Kisosky1 Nursery19 Taba15 south29 Taba26 Taba14 Taba23 Taba13 1 Taba25 lab1 Taba19 Dekel beach2 Taba7 lab2 Taba6 lab11 Kisosky5 Dekel beach2 lab1 north22 north17 north26 south12 south22 south15 south8 south23 south24 south25 south4 Kisosky19 Taba2 IUI4 Nursery2 IUI3 north6 north15 north8 north9 north14 north18 north25 north23 Taba1 north1 Nursery1 south3 south7 Dekel beach1 south1 south18 south2 Nursery12 IUI14 Nursery18 IUI 1 Kisosky22 Nursery11 IUI 2 lab15 lab2 Dekel beach15 lab4 lab12 Dekel beach14 lab9 lab8 north12 Kisosky7 Kisosky21 Kisosky6 Taba2 Taba22 Taba27 Nursery1 north13 Nursery8 Dekel beach12 Dekel beach13 lab13 Dekel beach1 lab5 Taba16 lab16 north16 Kisosky2 Taba3 Taba11 Kisosky1 south1 south13 lab3 lab6 lab7 lab19 lab14 lab21 Nursery15 Figure A- 68 Neighbor joining tree for individual Drupella cornus snails using AFLP. Abbreviations: AL Lab; AN North; AS South; DB Dekel Beach; IUI Inter University Institute; KIS Kisosky Beach; NUR Nursery; TABA Taba beach. #No. indicate the COI haplotype number. Analysis of molecular variance showed very little difference among the studied populations and no difference between regions (Israel and Jordan), as most of the variance (88%) was accounted to the within population factor (Figure A- 69; only 12% of the differences was assigned to among populations). RSS-REL-T5. Annex 1_page 19 of 132

Among Regions % Percentages of Molecular Variance Among Pops 12% Within Pops 88% Source df SS MS Est. Var. % Among Regions 1 278.65 278.65.361 % Among Pops 6 1468.76 244.679 8.699 12% Within Pops 16 1193.243 63.78 63.78 88% Total 167 11939.384 72.767 1% Stat Value P(rand >= data) PhiRT.5.24 PhiPR.12.1 PhiPT.124.1 Figure A- 69 Analysis of molecular variance for Drupella snails in the northern Gulf. Bayesian analysis of population structure using of 157 individuals through the clustering with linked loci in a population mixture analysis with PABS 5.4, revealed optimal partition to 5 clusters (Log (marginal likelihood) of optimal partition: -2841.1399) with probabilities for the number of clusters, n=.9927 (Table A- 37, Figure A- 7). While some populations were more homogeneous ( north, Taba Beach; Israeli and a Jordanian sites representing a single shared cluster), all other 6 sites contained animals of several clades). RSS-REL-T5. Annex 1_page 11 of 132

Table A- 37 Best Partition of individuals using BAPS and their original locations. Cluster 1 15 Cluster 2 76, 77 Cluster 3 Cluster 4 Cluster 5 List of individual colony in each cluster 1, 2, 3, 4, 5, 6, 7, 9, 1, 11, 12, 13, 14, 16, 18, 19, 2, 21, 4, 42, 43, 46, 47, 49, 5, 51, 53, 54, 55, 56, 57, 58, 59, 63, 65, 66, 74, 75, 84, 85, 92, 93, 99, 127, 129, 13 8, 22, 23, 24, 25, 26, 27, 28, 29, 3, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 44, 45, 48, 52, 6, 61, 62, 64, 87, 88, 9, 91, 1, 11, 12, 13, 14, 15, 16, 17, 18, 19, 11, 111, 112, 113, 114, 116, 117, 133, 134, 135, 137, 138, 139, 14, 141, 142, 143, 144, 145, 146, 147, 148, 149, 15, 151, 152, 153, 154, 155, 156, 157, 158, 159, 16, 161, 162, 163, 164, 165, 166, 167, 168 17, 67, 68, 69, 7, 71, 72, 73, 78, 79, 8, 81, 82, 83, 86, 89, 94, 95, 96, 97, 98, 115, 118, 119, 12, 121, 122, 123, 124, 125, 126, 128, 131, 132, 136 Figure A- 7 Graphical presentation of the Bayesian clustering of all individuals, each individual is represented by a thin vertical line, each color represent a different cluster. All lines between two black thick vertical lines belong to individuals collected at the same location Seriatopora hystrix The branching coral Seriatopora hystrix, a geographically widespread Pocilloporid species, is commonly found in Indo-Pacific reefs from the Red Seato the Western Pacific (Veron, 2), usually revealing a highly structured populations across habitats on a single reef (Ayre and Dufty, 1994; Ayre and Hughes, 2; Bongaerts et al., 21). Almost two decades ago, Ayre and Dufty (1994) first demonstrated that a significant proportion (16%) of the genetic variability of Seriatopora hystrix within reefs could be explained by distributions among five shallow reef habitats (reef slope, reef crest, reef flat, lagoon, back reef). Occupying similar reef habitats as Pocillopora damicornis, S. hystrix however, differs notably in its population genetic structures, showing populations that are often more closed, with higher levels of genetic subdivision (Ayre and Dufty, 1994; Ayre and Hughes, 2, RSS-REL-T5. Annex 1_page 111 of 132

24), suggesting lower effective dispersal in S. hystrix than in P. damicornis (Starger et al., 21). This outcome is further supported by Maier et al. (25) who showed in populations from the Red Sea, isolation by distance effects on a small geographic scale (> 2 km), indicating limited dispersal of larvae as was recorded in different Great Barrier Reef populations that showed high F ST values (Ayre and Dufty, 1994; Ayre and Hughes, 2). S. hystrix has been the subject of several genetic studies (Ayre and Dufty, 1994; Ayre and Hughes, 2, 24; Maier et al., 25, 29; Underwood et al., 27; Sherman, 28; van Oppen et al., 28; Bongaerts et al., 21; Starger et al., 21), a factor that can be used for comparative analyses. S. hystrix is a brooding species that vertically transmits its associated zooxanthellae (Ayre and Resing, 1986; Sherman, 28). Studies that revealed small-scale patterns of larval dispersal (e.g., Maier, 25), are consistent with laboratory observations which implied that the majority of S. hystrix planulae settle shortly after release (Atoda, 1951). This Red Sea common species is also highly suitable for population genetic analyses in this study as representing different biological characteristics than its closely related species Pocillopora damicornis, the second coral species studied here. Materials and methods Animal collections and DNA extracts: Coral samples were collected in seven locations along the Israeli and the Jordanian coasts (in three Israeli locations, Kisoski, IUI and Taba, no single alive colony was found in shallow waters), by Scuba, from 222 S. hystrix colonies, of which 195 were used for microsatellites analyses (Table A- 38, Figure A- 71). One branch was removed from each adult colony to ensure minimal detrimental impact. Table A- 38 S. hystrix - Collection sites and numbers of samples. Location GPS site Collected Analyzed Running nos Is. Dekel 29 32'22.6"N 34 56'5.52"E 35 31 1-31 Is. Dolphin reef 29 31'33.78"N 34 56'13.76"E 35 32 32-63 Is. Satil wreck 29 3'51.47"N 34 55'38.13"E 35 32 64-95 Is. Nursery 29 32'32.76"N 34 58'21.78"E 12 12 96-17 Jr. North 29º28' 5.5"N 34º58' 51.7"E 4 32 18-139 Jr. South 29 25' 54.5"N 34 58' 37.5"E 4 32 14-171 Jr. Marine lab 29º27' 58."N 34º58'31.85"E 25 24 172-195 Is. Kisoski 29 32'5."N 34 57'13.56"E Not found - Is. IUI 29 3'3.11"N 34 54'59.1"E Not found - Is. Taba 29 29'32.8"N 34 54'14.77"E Not found - RSS-REL-T5. Annex 1_page 112 of 132

Figure A- 71 Map of the northern Gulf with collection sites. DNA extraction DNA was isolated from all samples according to Graham (1978). From each branch, small tissue samples containing few polyps were cut by fine pliers analysed, separately, within 1.5 ml vials containing 24 µl lysis buffer homogenized. Than, coral s DNA was partly extracted by adding, to each vial, 24 µl of phenol/chloroform solution. The material was transferred to the laboratory at Haifa where DNA extraction was completed by additional phenol/chloroform and chloroform extractions. DNA samples were precipitated in ethanol, re-suspended in water and kept in a cold room until used. Microsatellite analysis: Microsatellites amplifications were performed on 6 microsatellites according Maier et al., 21, 25 and Underwood et al., 26 (Table A- 39). RSS-REL-T5. Annex 1_page 113 of 132

Table A- 39 List of fluorescent primers. Sh2.15F CGTGCCACTGTGATTTCTTC FAM Sh2.15R AACAAAAACGTCTCCATTACCC Sh3.32F CCAAAACCCTGCATTTTGAG VIC Sh3.32R CCCCCTGTAAAAGTGTACCC Sh4.24F TCCTCCAGATGAATTTGAACG NED Sh4.24R TTCAGGGAAGATTTGCCG Sh2 2F GTGAATAAGAACGACGGA NED Sh2 2R AAATACTAATTACAGGCATGAC Sh2 6F CAAATACCAATCAGTGTAGCA FAM Sh2 6R GGCCTAATATCTGTCTCCTTC Sh4.28F TGTGGTCTACAGTATATCTTTTGTG VIC Sh4.28R CAAATTTGAATCTACAGTGGGG Data analysis Data analysis was performed using the software Microcheker (van Oosterhout et al., 24) for scoring errors and potential null alleles. Excel toolkit (Park, 21) was used to identify identical multilocus genotypes that were likely to be a result of asexual reproduction within each population. Weighted observed heterozygosity (Ho), gene diversity (expected heterozygosity, He) and unbiased estimates of Hardy-Weinberg exact P-values were computed by the Markov chain method using GENEPOP (Raymond and Rousset, 1995) and GenAlex6.4 (Peakall and Smouse, 26). The significance level was determined after 1, dememorization, and 1 batches of 5, interactions each. GenAlex 6.4 also was used to calculate allele frequencies, and inbreeding coefficients partitioned among individuals within sample (F IS ), sites within total (F ST ), and individuals within total (F IT ), according to Weir and Cockerham (1984) for all population pairs. SMOGD program (http://www.ngcrawford.com/django/jost/) was used to estimate actual differentiation (Dest; Jost, 28). Genetic identity, genetic distance and their graphical representation (Neighbor-Joining) were calculated following (Nei, 1978), using POPGENE software version 1.32 (Yeh et al., 1997). The significance level for population differentiation (pairwise analysis of all populations; Exact tests - Raymond and Rousset, 1995) were determined after 1, dememorization steps and 2 batches of 2, permutations per batch, using TFPGA software version 1.3 (Miller, 1997). The analysis of molecular variance (AMOVA) procedure followed the methods of Michalakis and Excoffier (1996) using GenAlEx6.4 software (999 permutations). Bayesian clustering for population structure was studied using STRUCTURE 2.3 (Pritchard et al., 2) and BAPS 5.4 (Corander et al., 28). Population Assignment tests based on frequencies base method of Paetkau et al. (1995) were performed using GenAlex6.4 and GeneClass 2 (Piry et al., 24). RSS-REL-T5. Annex 1_page 114 of 132

Results We studied 195 genotypes of Seriatopora hystrix from the seven northern Gulf sites using 6 sets of florescence primers. In 5 microsatellites (Table A- 4), the number of alleles per loci ranged between 7 and 4 (average 21.2±5.945 SE). Locus sh2.2 has emerged as non-polymorphic (only 2 alleles were scored) and was excluded from the analysis. F-statistics over the five loci (F is ; Table A- 4) and seven Seriatopora hystrix populations (F; Table A- 41), showed a significant deviation from Hardy Weinberg equilibrium with homozygote excess over all loci and all populations (mean ± SE Fis over loci was.451±.172 and mean ± SE of the Fixation index F over all Seriatopora hystrix populations was.472±.69). The average of inbreeding coefficient within subpopulations Fst indicated moderated to low genetic differentiation among populations, and ranged between.55 to.178 (Mean±SE.13±.22). Similar outcomes were revealed by the Dest (Jost, 28) index which is based on the actual relative degree of allele frequencies differentiation, calculating the differentiation between sampling sites on a specific locus (.24 to.473; Mean ± SE,.29±.75). Table A- 4 Locus specific statistics: F-Statistics and estimates of Nm and Dest- actual differentiation over all populations for each locus. Locus No. alleles Ht Mean He Mean Ho Fis Fit Fst Nm D est Sh2 6 2.299.279.23.175.23.66 3.525.24 Sh3.32 11.721.641.8.876.889.11 2.23.224 Sh4.24 4.887.795.55.365.431.13 2.167.473 Sh2.15 28.753.712.7.17.71.55 4.258.122 Sh4.28F 7.563.462.81.824.855.178 1.153.23 Mean±SE 21.2± 5.945.645±.11.578±.93.319±.123.451±.172.495±.164.13±.22 2.625±.558.29±.75 Fis = (Mean He - Mean Ho) / Mean He; Fit = (Ht - Mean Ho) / Ht; Fst = (Ht - Mean He) / Ht; Nm = [(1 / Fst) - 1] / 4 (Number of Migrants); Key: Mean He = Average He across the populations. Mean Ho = Average Ho across the populations. Ht = Total Expected Heterozygosity = 1 - Sum tpi^2 where tpi is the frequency of the ith allele for the total & Sum tpi^2 is the sum of the squared total allele frequencies. D est = estimator of actual differentiation (Jost, 28). RSS-REL-T5. Annex 1_page 115 of 132

Table A- 41 Pocillopora damicornis: Population genetics parameters in the 8 studied populations at the northern Gulf. Pop N Na Ne I Ho He UHe F Dekel Beach 28.6±.98 9.6± 1.86 2.782±.354 1.381±.153.338±.84.618±.46.629±.46.451±.122 Dolphin Reef 28.8± 1.772 11.4 ±3.586 5.146± 1.781 1.73±.369.391±.165.69±.1.72±.12.455±.181 Satil wreck 29.4± 1.77 11.8 ±2.437 4.28± 1.165 1.68±.258.339±.94.687±.73.699±.75.492±.142 Nursery 11.2±.374 4.8± 1.497 3.14±.829 1.45±.38.33±.185.488±.17.51±.178.462±.251 north 28.4± 1.166 4.8±.663 2.32±.271.989±.16.281±.127.535±.68.544±.69.42±.247 south 27.6± 2.561 4.4± 1.3 2.281±.554.897±.251.239±.12.459±.11.468±.113.52±.233 lab 23.±.548 7.8± 3.153 4.362± 1.66 1.347±.459.316±.176.57±.16.583±.163.531±.22 Grand Mean 25.286± 1.148 7.8±.929 3.442±.418 1.292±.117.319±.48.578±.41.591±.42.472±.69 N= Average number of colonies for all loci; Na = No. of Different Alleles; Ne = No. of Effective Alleles = 1 / (Sum pi^2); I = Shannon's Information Index = -1* Sum (pi * Ln (pi)); Ho = Observed Heterozygosity = No. of Hets / N; He = Expected Heterozygosity = 1 - Sum pi^2; UHe = Unbiased Expected Heterozygosity = (2N / (2N-1)) * He; F = Fixation Index = (He - Ho) / He = 1 - (Ho / He); Grand Mean and SE - over loci and populations. Shannon's Information Index (I; Table A- 41) show high allele diversity, ranging between.897 to 1.73. In the same way, the number of alleles on all microsatellites/site (Na) was also very diverse, the highest in the Satil and Dolphin reef, lowest in south, north and the Nursery (11.8 to 4.4, average 7.8; Table A- 41). Pairwise analysis of population differentiation was diverse and ranged between.8 (Satil and Dolphin reef) to.124 (the Nursery and north) of population differentiation (F ST ) and as well as for actual differentiation (D est,. to.228; Table A- 42). The pairwise population F st values (below diagonal) and harmonic mean of D est across loci (above diagonal) are summarized in Table A- 42. RSS-REL-T5. Annex 1_page 116 of 132

Table A- 42 Pairwise population Fst values (below diagonal) and harmonic mean of D est across loci (above diagonal). Dekel Beach Dolphin Reef Satil wreck Nursery north south lab Dekel Beach #####.5.26.92.88.137.74 Dolphin Reef.23* #####..51.11.22.47 Satil wreck.21*.8 #####.95.87.19.76 Nursery.7*.82*.95* #####.228.116.123 north.54*.43*.44*.124* #####.13.95 south.8*.1*.12*.84*.96* #####.127 lab.51*.33*.42*.1*.62*.94* ##### * Significant p<.1 (Exact tests for population differentiation, Raymond and Rousset 1995) Analysis of molecular variance showed no significant different between populations and between regions (Israel and Jordan), as most of the variance (98%) was accounted to the within population factor (Figure A- 72; only 8% of the differences was assigned to among populations and 2% between Israel and Jordan). Percentages of Molecular Variance Among Regions 2% Among Pops 8% Within Pops 9% Source df SS MS Est. Var. % Among Regions 1 17.44 17.44.41 2% Among Pops 5 42.654 8.531.13 8% Within Pops 383 574.27 1.499 1.499 9% Total 389 633.726 1.669 1% Stat Value P(rand >= data) Frt.24.1 Fsr.8.1 Fst.12.1 Figure A- 72 Analysis of molecular variance. RSS-REL-T5. Annex 1_page 117 of 132

Pairwise population genetic distance and identity were calculated according to Nei (1972), and are summarized in Table A- 43 and illustrated in Figure A- 73 as neighbor- joining tree. The Satil and the Dolphin reef (1.47 km apart) as well as Dekel beach and the Satil wreck (1.8km apart) showed the highest genetic identity (.963 and.912 respectively) and north and the Nursery showed the highest genetic distance. Table A- 43 Nei's genetic identity (above diagonal) and genetic distance (below diagonal). Dekel Beach Dolphin Reef Satil wreck Nursery north south lab Dekel Beach ****.916.921.85.836.816.854 Dolphin Reef.88 ****.963.822.85.746.912 Satil wreck.82.38 ****.786.857.745.88 Nursery.163.197.241 ****.689.812.796 north.18.163.155.372 ****.783.825 south.23.293.295.29.245 ****.812 lab.158.92.127.228.192.28 **** Dekel Beach Dolphin Reef Satil lab north Nursery south 2 Figure A- 73 neighbour- joining tree of all populations. As seen by the pairwise population genetic distance results, The Satil, Dolphin reef and Dekel beach are grouped together with lab and north as one genetic group. The newly formed Nursery site and the south populations branched outside to this group, as a separate group. Distance tree was also calculated for all individuals (Figure A- 74). The results indicated that each branch was typically consisted with Seriatopora hystrix colonies sampled from different sites within each zone (Israel and Jordan) as from both zones, further showing that all population sampled in this study belong to a single large Seriatopora hystrix population residing in the northern Gulf. RSS-REL-T5. Annex 1_page 118 of 132

Satil15 Thetis SpA north28 north18 north17 north1 north5 Satil31 Dekel13 lab13 Satil32 DF25 Satil3 Dekel1 lab22 lab2 lab8 south21 DF2 DF1 Dekel27 north6 north31 north1 south29 south26 south17 south6 south3 south32 south28 south16 north27 north19 south2 DF23 Dekel24 Dekel14 Satil2 south1 Nursery8 lab19 south19 Dekel26 Satil1 south15 south7 DF22 Nursery7 south4 Nursery1 south5 Nursery5 DF11 Satil2 Dekel22 Dekel2 Dekel11 lab7 lab16 Satil1 DF3 Satil22 south3 south27 south11 south9 south13 south1 south31 north15 north3 north2 DF24 south25 south24 north7 north3 south23 lab2 Dekel25 south22 Satil13 south12 Dekel6 Satil14 Nursery1 DF15 Nursery6 DF8 DF21 lab23 1 Nursery2 Dekel1 north9 Dekel8 Dekel23 north16 Dekel18 north32 DF5 lab24 Dekel12 Dekel4 Dekel28 Dekel29 Dekel19 Satil3 Satil16 lab17 Dekel9 Satil27 Satil9 Nursery11 Satil25 DF16 north13 Dekel7 Nursery9 south18 Dekel2 Nursery4 lab14 DF7 lab15 DF6 lab11 Dekel3 Satil18 Satil8 Satil11 north12 north8 north21 DF12 lab18 north2 lab12 south2 DF26 DF19 DF2 lab1 lab3 lab1 lab9 lab4 lab6 DF14 Satil4 DF27 Satil23 Dekel17 Dekel21 DF17 south8 DF9 DF18 Satil12 Satil26 north4 north11 north14 north22 north23 north25 north26 north29 south14 north24 DF29 lab21 Satil24 Satil21 DF4 DF13 Satil5 Satil28 DF28 Nursery12 Satil7 DF31 lab5 Satil29 Dekel15 Dekel3 Satil19 DF1 DF3 Dekel5 DF32 Nursery3 Dekel32 Dekel31 Satil17 Satil6 Figure A- 74 NJ tree of all samples as individuals (Abbreviations: lab Marine lab; DF- Dolphin reef; Dekel Dekel Beach, Satil Satil wreck). Clustering methods may provide the best solution for demarcating geographical populations of a species. A commonly used program is STRUCTURE, developed by Pritchard et al. (2), inferring the number of clusters (populations) by comparing the posterior probability for different numbers of putative populations specified by the user. We, however, used BAPS, implementing a stochastic optimization procedure rather than a Markov chain Monte Carlo, and therefore generally performing quickly than the STRUCTURE program, with similar results (Starger et al. 21). This program clusters local populations, each possessing a characteristic set of allele polymorphisms, on the basis of the genotyping data from microsatellite alleles. Bayesian analysis of population structure using of 227 individuals in a population mixture analysis with PABS 5.4 revealed optimal partition to 29 clusters (Log (marginal likelihood) of optimal partition: -2317.852) with probabilities for the number RSS-REL-T5. Annex 1_page 119 of 132

of clusters, n= 29.5359 (n= 28.47132). Each cluster contains individuals from different collecting sites (Table A- 44, Figure A- 75a; see also Table 1), showing, again, the genetic mixture of corals genotypes in all northern Gulf localities. Table A- 44 Best cluster partition of individuals using BAPS and their original numbers (locations may be deduced following Table A-23). Clusters List of individual colony in the cluster (numbers-following Table 1) Cluster 1 85, 18, 113, 138, 19, 191 Cluster 2 3, 43, 57, 71, 74, 147, 159, 18, 189, 195 Cluster 3 48, 88, 89, 111, 118, 12, 121, 123, 129, 13, 131, 132, 133, 136, 153 Cluster 4 32, 36, 41, 47, 79, 82 Cluster 5 66 Cluster 6 37, 73 Cluster 7 29, 35, 4, 6, 68, 75, 91 Cluster 8 14, 49, 5, 51, 58, 67, 81, 86, 127, 183 Cluster 9 7, 63 Cluster 1 1, 12, 16, 2, 3, 31, 38, 44, 45, 59, 62, 7, 92, 17, 173 Cluster 11 13, 15 Cluster 12 8, 25, 27, 9 Cluster 13 69, 172, 174, 175, 177, 181 Cluster 14 19, 21, 24, 33, 96, 12, 13, 178 Cluster 15 34, 78, 112, 116, 117, 124, 125, 126, 134, 135 Cluster 16 23, 65, 14, 141, 142, 143, 145, 146, 154, 156, 158, 16, 165, 168 Cluster 17 179, 193 Cluster 18 77, 182, 184, 194 Cluster 19 9, 19, 11, 114, 119, 122, 137, 176 Cluster 2 1, 52, 56, 83 Cluster 21 84, 87, 185, 186, 192 Cluster 22 4, 6, 11, 17, 22, 26, 28, 72, 97, 188 Cluster 23 94 Cluster 24 2, 46, 53, 93, 95, 99, 14, 15, 16, 157 Cluster 25 42, 64, 1, 144, 148, 15, 166 Cluster 26 39, 54, 61, 98, 11, 187 Cluster 27 8 Cluster 28 5, 18, 76 Cluster 29 55, 115, 128, 139, 149, 151, 152, 155, 161, 162, 163, 164, 167, 169, 17, 171 RSS-REL-T5. Annex 1_page 12 of 132

Figure A- 75 Graphical presentation of the Bayesian mixture clustering of all individuals (a) and admixture clustering of groups (b), each individual is represented by a thin vertical line, each color represent a different cluster. All lines between two black thick vertical lines represent individuals collected at the same location. (c) Gene flow plot between the clusters. RSS-REL-T5. Annex 1_page 121 of 132