Supporting Information for: Engineering the structure and properties of DNA-nanoparticle superstructures using polyvalent counterions Leo Y.T. Chou 1 ǂ, Fayi Song 1 ǂ, Warren C.W. Chan*ǂǁ ǂ Institute of Biomaterials and Biomedical Engineering, Rosebrugh Building, Room 407, 164 College Street, Toronto, Ontario M5S 3G9, Canada ǁ Terrence Donnelly Centre for Cellular and Biomolecular Research, University of Toronto, 160 College Street, Room 230, Toronto, Ontario M5S 3E1, Canada Department of Chemical Engineering, 200 College Street, Toronto, Ontario M5S 3E5, Canada Department of Chemistry, 80 St George Street, Toronto, Ontario M5S 3H6, Canada Department of Material Science and Engineering, Wallberg Building, 184 College Street, Suite 140, University of Toronto, Toronto, Ontario M5S 3E4, Canada *Corresponding author (warren.chan@utoronto.ca) S1
Figure S1. Quantification of DNA grafting density on gold nanoparticles. Oligonucleotidefunctionalized nanoparticles were treated with dithiothreitol to release bound oligonucleotides and quantified using an Oligreen assay. The Y-axis refers to the number of oligonucleotides per nanoparticle. Figure S2. Transmission electron micrographs of DNA-nanoparticle superstructures. Core (15 nm) and satellite nanoparticles (5 nm) were assembled using DNA and stored in 1X PBST (left). Before incubation with polyelectrolytes, nanoparticle assemblies were exchanged into 1 mm MgCl 2 (middle). After incubation with polyelectrolytes, the sample was washed in 1 mm MgCl 2 and stored at 4 o C prior to further use. In all cases, samples remained monodisperse and stable. S2
Figure S3. Optimizing solvent conditions for polyelectrolyte coating of DNA assembled nanoparticles. (A) Chemical structures of three types of cationic polyelectrolytes tested in this study. Molecular weights are listed in Methods. (B) We incubated oligonucleotide-functionalized gold nanoparticles with polyelectrolytes in 1X PBST, which is a solvent we have previously shown to stabilize DNA assembled nanoparticles. However, UV-Vis absorbance measurements of the nanoparticle solution indicated aggregation following incubation with polyelectrolytes, both with and without subsequent isolation by centrifugation at 8000 g for 60 min. Aggregation was assessed by taking the ratio of the UV-Vis absorbance at 520 nm to 700 nm, corresponding to the surface plasmon resonance peaks of monodisperse and aggregated nanoparticles, respectively. The values presented in the graph were normalized to a control that has not been incubated with polyelectrolytes. This result prompted us to test whether exchanging nanoparticles into a different buffer before incubation with polyelectrolytes could eliminate aggregation. (C) We next assayed the stability of DNA duplexes on nanoparticles in solutions of either water, 10 mm NaCl, or 1 mm MgCl 2, with the hypothesis that these lower ionic strength solvents would improve colloidal stability. We assayed dsdna stability by determining the amount of a fluorescently-labeled oligonucleotide that remain hybridized to the nanoparticles following repeated washing in these buffers. Briefly, FAM-labeled oligonucleotide (FAM-Link2) was incubated with Core1-functionalized 13 nm nanoparticles. These nanoparticles were washed to remove unbound oligonucleotides and resuspended in 1X PBST. Nanoparticles were then washed two times in the respective new buffer conditions. Nanoparticles were then treated with dithiothreitol (10 mm) at 60 o C to liberate the oligonucleotides, followed by centrifugation at 16,000 g for 30 minutes to pellet nanoparticle aggregates. The amount of FAM-labeled oligonucleotides in the supernatant was determined using a plate reader. The stability of DNA duplex was reported as the ratio of the fluorescence intensity relative to a sample treated with 1X S3
PBST, which is expected to be stable. As a complementary strategy to stabilize DNA duplexes in these buffers, we also compared whether treating samples by photo-crosslinking with 8- methoxypsoralen (Pso) for varying amount of time further improves duplex DNA stability. We observed that DNA duplexes were unstable in water and 10 mm NaCl, with psoralen crosslinking having modest improvement in stability. On the other hand, 1 mm MgCl 2 quantitatively stabilized the DNA duplex. (D) Finally, we re-tested whether low millimolar concentrations of MgCl 2 could preserve the colloidal stability of oligonucleotide-coated nanoparticles in the presence of various polyelectrolytes (PAH, PLA, PLL). We found that oligonucleotide-coated nanoparticles were stable in the range of MgCl 2 that we tested (1 to 4 mm), whereas they rapidly aggregated in solutions containing 10 to 100 mm NaCl. We therefore conclude that 1 mm MgCl 2 preserved both colloidal stability and DNA duplex stability, and conducted all subsequent experiments with polyelectrolyte coating using this solvent condition. Figure S4. Effect of polyelectrolyte molecular weight on the optimal properties of core-satellite nanoparticle assemblies. (A) UV-Vis absorbance spectrum of 60 nm 30 nm core-satellite nanoparticles before and after coating with poly(l-lysine) of different chain lengths (n) = 5, 10, 30, 100, and 250. The spectrum for 60 nm gold nanoparticles is also included for comparison. (B) Shift in the surface plasmon resonance (SPR) of the core-satellite nanoparticles when coated with poly(l-lysine) of different chain lengths. Note the sharp transition above poly(l-lysine) of chain length n = 10. S4
Zeta Potential (mv) 40 20 0-20 0 1 2 3 4 5 Polyelectrolyte Layer Figure S5. Zeta potential of DNA functionalized core-satellite nanoparticles after sequential deposition with alternating layers of poly(allylamine) (layers 1 and 3) and poly(styrene sulfonate) (layers 2 and 4). Figure S6. Effect of polyelectrolyte coating on the structural rigidity of DNA-metal superstructures. (A) Tilted-TEM images of non-coated 60 nm 30 nm and 60 nm 15 nm coresatellite nanoparticle assemblies. Dotted circles help guide the eye to changes in the relative S5
position between nanoparticles as a function of tilt angle. In general, non-coated assemblies show less change in the relative nanoparticle positions because they lay flat on the TEM grid. (B) Scheme showing the single stranded regions and nicking sites within the DNA-nanoparticle assembly. Nanoparticle assemblies shown in our study are not considered rigid in solution for a number of reasons. First, there are several nicks (indicated by the black arrows) along the DNA duplex linking core and satellite nanoparticles, which allow the DNA duplex to bend in solution. This movement will transiently change interparticle distance and plasmon coupling efficiency. Second, the persistence of double-stranded DNA has been reported to range from 35 to 50 nm depending on salt concentration. The linker used in our study is ~31 nm, which is on the order of the persistence length and hence can be considered to be semi-flexible. Third, there are two single-stranded poly(a) 10 regions in the DNA (indicated by the red arrows). These regions can rotate, swing, and stretch similar to worm-like polymer chains. These motions in turn make the structures flexible and labile in solution. On the other hand, when superstructures are incubated with polyamines, these DNA strands are strongly complexed with the polyvalent cations through electrostatic interactions, as evidenced by DNA condensation. Since nanoparticles are multivalent, these interactions effectively crosslink neighboring nanoparticles as well as between core and satellite nanoparticles. With additional layers deposited by the layer-by-layer approach, these interactions become stronger and much long-lived. Hence, we believe that the nanoparticles must experience much less freedom to move about. Figure S7. Transmission electron microscopy images of core-satellite superstructures encapsulated within four layers of poly(allylamine) and poly(styrene sulfonate). The sample was stored at 4 o C in 1 mm MgCl 2 (left) or deionized water (right) for one month before imaging. S6
Figure S8. UV-Vis absorbance spectra of core-satellite superstructures (shown in Figure 6) coated with poly(l-lysine) and poly(l-glutamic acid), before and following treatment with DNase I and/or Trypsin. Figure S9. UV-Vis absorbance spectra of core-satellite superstructures coated with four layers of the non-biodegradable polymers poly(allyamine) and poly(styrene sulfonate) before and after treatment with 0.1% trypsin. S7
Supporting Table S1. List of materials used in this study Reagent Description Source Gold (III) chloride trihydrate Sigma Aldrich (520918) Cetyl trimethylammonium bromide Sigma Aldrich (855820) Tannic acid Sigma Aldrich (403040) Trisodium citrate Sigma Aldrich (S4641) Hydroquinone Sigma Aldrich (H17902) Tween20 Sigma Aldrich (P1379) Sodium borohydride Sigma Aldrich (452882) Silver nitrate Sigma Aldrich (S6506) Ascorbic acid Sigma Aldrich (255564) Sodium dodecyl sulfate Sigma Aldrich (436143) Phosphate buffered saline tablets Sigma Aldrich (P4417) Magnesium chloride Sigma Aldrich (M4880) Poly(allylamine hydrochloride) Sigma Aldrich (283215) Poly(styrene sulfonate) Polymer Standards Service (PSSpss15k) Poly(L-arginine) Sigma Aldrich (P7762) Poly(L-lysine), MW15,000-30,000 Sigma Aldrich (P7890) Poly(L-lysine), MW100,000 Sigma Aldrich (P2658) Poly(L-lysine) -PLL5, MW 800 Bio Basic Inc (custom synthesis) Poly(L-lysine) -PLL10, MW1600 Bio Basic Inc (custom synthesis) Poly(L-lysine) -PLL30, MW4,900 ALAMANDA (custom synthesis) Poly(L-lysine) -PLL100, MW16,000 ALAMANDA (custom synthesis) Poly(L-lysine) -PLL250, MW41,000 ALAMANDA (custom synthesis) Poly(L-glutamic acid) Sigma Aldrich (P4761) 8-methoxy psoralen Sigma Aldrich (M3501) Dithiothreitol BioShop (DTT001.5) Trypsin Invitrogen (25200-072) DNase I Thermo Scientific (EN0521) Supporting Table S2. Synthesis recipes of 30 nm and 60 nm gold nanoparticles Nanoparticle size (nm) 30 60 Water (ml) 85.6 96.4 1 %w/v HAuCl 4 (ml) 0.88 1.00 4.1 mg/ml trisodium citrate (ml) 0.88 1.00 3.3 mg/ml Hydroquinone (ml) 1.00 1.00 15 nm gold nanoparticle seeds (ml) 12.50 1.60 S8
Supporting Table S3. List of oligonucleotide sequences used in this study Name Sequence (5-3 ) Core1 S-S C6/AAAAAAAAAACCTATCGACCATGCT Sat1 TAACAACGATCCCTCAAAAAAAAAA/C6 S-S Sat2 S-S C6/AAAAAAAAAAATGGCCGATGTATGT Link1 GAGGGATCGTTGTTATACAGTTCAGGCAGTGTCTCGTAGTGGTACAT AGCTAGCTTTACAAGATTTTCTCGCTGGAGCATGGTCGATAGG Link1_FAM FAM/GAGGGATCGTTGTTATACAGTTCAGGCAGTGTCTCGTAGTGGT ACATAGCTAGCTTTACAAGATTTTCTCGCTGGAGCATGGTCGATAGG Link2 AGCCTACTTTCCTCTTGATCGCTCACGGTACTACATACATCGGCCAT Spacer1 CACTGCCTGAACTGT Spacer2 CAGCGAGAAAATCTTGTAAAGCTAGCTATGTACCACTACGA Spacer2_Cy5 CAGCGAGAAAATCTTGTAAAGCTAGCTATGTACCACTACGA/Cy5 * All the oligonucleotides used in this study were purchased from Bio Basic Inc. Colors indicate sequence complementarity. S9