Kamran Ghalili, M.D. Rosamund Irwin, M.D.

Size: px
Start display at page:

Download "Kamran Ghalili, M.D. Rosamund Irwin, M.D."

Transcription

1 Giffen, Todd Michael (29 yrs [3/13/1985]) Sex.M Procedure Notes Procedures filed by Ghalili, Kamran, MD at 10/08/ Author: Ghalili, Kamran, MD Service: (none) Author Physician Type: Filed: 10/08/ Note 09/22/ Trans ID: D Time: Trans Available Status: Procedure Orders: 1. HOLTER MONITOR [ ] ordered by liavin, Rosamund, MD at 09/18/ DATE OF STUDY: PATIENT NAME: Giffen, Todd Michael PATIENT AGE: 23 PATIENT LOCATION: CARL REFERRING PHYSICIAN: REFERRING PHYSICIAN: Rosamund Irwin, M.D. TYPE OF STUDY: HOLTER MONITOR INDICATIONS: Palpitations. FINDINGS: 1. Underlying rhythm is normal sinus rhythm. Average rate was 106 beats per minute. Sinus tachycardia. Minimum rate was 76 beats per minute at 1044 hours. Maximal rate was 160 beats per minute at 1656 hours. 2. No ventricular premature beats noted. 3. No significant ectopic beat noted. No obvious supraventricular tachycardia noted. IMPRESSION: Essentially during this Holter monitor recording patient is mostly in sinus tachycardia. No evidence of supraventricular or ventricular tachycardia noted. S I G N E D B Y K a m r a n Ghalili, M. D. 1 0 / 0 8 / : 2 9 P K a i s e r # ( I f A p p l i c a b l e ) : cc: Kamran Ghalili, M.D. Rosamund Irwin, M.D. Consult Notes Page 1 of 8

2 Consult Notes (continued) Initial Assessment Notes H&P Summary Notes Discharge Summary Notes ER RECORDS ED Arrival Information Patient not seen in ED Diagnosis None ED Disposition None ED Notes Clinical Lab Results Lab Results No matching s found No matching s found HOLTER MONITOR [ ] Ordering Provider: Transcription Cardiac Lab-Stress Tests Document Text Resulted: 09/26/ , Result Status: Final Irwin, Rosamund, MD 09/18/ Order Status: Completed ID C^te and Time Author D /22/ :46 PM Ghalili, Kamran, MD Page 2 of

3 HOLTER MONITOR [ ] (continued) Resulted: 09/26/ , Result Status: Final DATE OF STUDY: PATIENT NAME: PATIENT AGE: PATIENT LOCATION: REFERRING PHYSICIAN: Giffen, Todd Michael 23 CARL REFERRING PHYSICIAN: Rosamund Irwin, M.D. TYPE OF STUDY: HOLTER MONITOR INDICATIONS: Palpitations. FINDINGS: 1. Underlying rhythm is normal sinus rhythm. Average rate was 106 beats per minute. Sinus tachycardia. Minimum rate was 76 beats per minute at 1044 hours. Maximal rate was 160 beats per minute at 1656 hours. 2. No ventricular premature beats noted. 3. No significant ectopic beat noted. No obvious supraventricular tachycardia noted. IMPRESSION: Essentially during this Holter monitor recording patient is mostly in sinus tachycardia. No evidence of supraventricular or ventricular tachycardia noted. S I G N E D B Y K a m r a n Ghalili, M. D. 1 0 / 0 8 / : 2 9 P K a i s e r # ( I f A p p l i c a b l e ) : cc: Kamran Ghalili, M.D. Rosamund Irwin, M.D. ECHOCARDIOGRAPH [ ] Resulted: 09/18/ , Result Status: Final Ordering Unlisted, Provider, PA 09/18/ Order Status: Completed Provider: Specimen Resulting Lab: SALEM ECHO LAB [XECHO- 09/18/ ] Narrative: Ordered by Rosamund Irwin MD Page 3 of 8

4 ECHOCARDIOGRAPH [ ] (continued) Resulted: 09/18/ , Result Status: Final Component Value Flag INTERPRETATION SUMMARY PATIENT HEIGHT PATIENT WEIGHT BSA LEFT VENTRICLE RIGHT VENTRICLE ATRIA MITRAL VALVE TRICUSPID VALVE AORTIC VALVE I n t e r p r e t a t i o n Summary A t w o - d i m e n s i o n a l t r a n s t h o r a c i c e c h o c a r d i o g r a m w i t h M- mode a n d D o p p l e r was p e r f o r m e d. T h i s was e s s e n t i a l l y a n o r m a l s t u d y. T h e r e i s r n i l d t r i c u s p i d r e g u r g i t a t i o n. 74 in 179 lbs 2.1 m L e f t V e n t r i c l e The l e f t v e n t r i c l e i s n o r m a l i n s i z e. T h e r e i s n o r m a l l e f t v e n t r i c u l a r w a l l t h i c k n e s s. E j e c t i o n F r a c t i o n = %. P v i g h t V e n t r i c l e The r i g h t v e n t r i c l e i s n o r m a l s i z e. A t r i a The l e f t a t r i a l s i z e i s n o r m a l. R i g h t a t r i a l s i z e i s n o r m a l. The JVC i s n o r m a l i n s i z e a n d c o l l a p s e s w i t h i n s p i r a t i o n. M i t r a l V a l v e The m i t r a l v a l v e l e a f l e t s a p p e a r n o r m a l. T h e r e i s no e v i d e n c e o f s t e n o s i s, f l u t t e r i n g, o r p r o l a p s e. T h e r e i s no m i t r a l r e g u r g i t a t i o n n o t e d. T r i c u s p i d V a l v e The t r i c u s p i d v a l v e i s n o t w e l l v i s u a l i z e d, b u t i s g r o s s l y n o r m a l. T h e r e i s m r l d t r i c u s p i d r e g u r g i t a t i o n. PULMONIC VALVE PERICARDIUM/PLEURAL A o r t i c V a l v e The a o r t i c v a l v e i s t r i l e a f l e t. The a o r t i c v a l v e o p e n s w e l l. Mo a o r t i c r e g u r g i t a t i o n i s p r e s e n t. P u l m o n i c V a l v e The p u l m o n i c, v a l v e i s n o t w e l l s e e n, b u t i s g r o s s l y n o r m a l. T h e r e i s no p u l m o n i c v a l v u l a r r e g u r g i t a t i o n. P e r i c a r d i u m. / P1 e u r a 1 T h e r e i s no p e r i c a r d i a l e f f u s i o n. Page 4 of 8

5 ECHOCARDIOGRAPH [ ] (continued) MMODE 2D MEASUREMENTS & CALCULATIONS RVDD IVSD IVSS LVIDD LVIDS LVPWD LVPWS EF (EST.) MV EXCURSION MV E-F SLOPE AO ROOT DIAM ACS LA DIMENSION LVLS AP4 DOPPLER MEASUREMENTS & CALCULATIONS MVV2 MAX MV MAXPG MV V2 MEAN MV MEAN PG MV V2 VTI AO V2 MAX AO MAX PG AO V2 MEAN AO MEAN PG AO V2 VTI TV V2 MAX TV MAX PG TV V2 MEAN TV MEAN PG PA V2 MAX PA MAX PG PA V2 MEAN PA MEAN PG PA V2 VTI TR MAX VEL TR MAX PG RVSP RAP SYSTOLE INTERPRETING PHYSICIAN Resulted: 09/18/ , Result Status: Final MMode 2D Measurements & Calculations 3.0 cm 0.89 cm 1.2 cm 4.9 cm 3.5 cm 0.93 cm 1.6 cm 56 % 2.5 cm 20 cm/sec 2.8 cm 1.8 cm 2.9 cm 6.2 cm Doppler Measurements & Calculations 67 cm/sec 1.8 mmhg 45 cm/sec 0.90 mmhg 12 cm 93 cm/sec 3.5 mmhg 63 cm/sec 1.8 mmhg 15 cm 89 cm/sec 3.2 mmhg 45 cm/sec 0.95 mmhg 69 cm/sec 1.9 mmhg 51 cm/sec 1.2 mmhg 18 cm 221 cm/sec 20 mmhg 25 mmhg 5.0 mmhg I n t e r p r e t i n g P h y s i c i a n : James W a s e n m i l l e r, e l e c t r o n i c a l l y s i g n e d on :44:37 Procedure Notes Page 5 of 8

6 Consult Notes MRN: CSN: Initial Assessment Notes H&P Summary Notes Discharge Summary Notes ER RECORDS ED Arrival Information Patient not seen in ED Diagnoses.DysjDhagia, ^sogha^eam^/sn^^ Obstruction esophagus ED Disposition None ED Notes Clinical Lab Results Lab Results No matching s found Resulted: 05/19/ , Result Status: Final Resultedby: Farthing. David G., MD Performed: 05/19/ /19/ Resulting Lab: EPIC RADIANT Specimen: 05/19/11 Narrative: ESOPHAGRAM (Fluoroscopy time: 0 min. 36 sec. Room: 1) HISTORY: Dysphagia. FINDINGS: With the oral ingestion of contrast, the esophagus was examined. There is normal antegrade peristalsis. There is suggestion of a minimal sliding-type hiatal hernia. No reflux was elicited. 13 mm Page 6 of 8

7 MRN: CSN: (continued) Resulted: 05/19/ , Result Status: Final pressed barium tablet passes normally down the esophagus. The fluoroscopic procedure was performed by Kevin Hutchins, RPA under direct supervision. Impression: IMPRESSION: Suggestion of a potential minimal sliding-type hiatal hernia but no reflux was seen. No other abnormalities are identified. Reading Dr.: Farthing, M.D., David G This report has been electronically signed by: Farthing, M.D., David G Resulted: 05/19/ , Result Status: Resultedby: Farthing, David G., MD Performed: Resulting Lab: EPIC RADIANT Specimen: Narrative: ESOPHAGRAM (Fluoroscopy time: 0 min. 36 sec. Room: 1) HISTORY: Dysphagia. FINDINGS: With the oral ingestion of contrast, the esophagus was examined. There is normal antegrade peristalsis. There is suggestion of a minimal sliding-type hiatal hernia. No reflux was elicited. 13 mm pressed barium tablet passes normally down the esophagus. 05/19/ /19/ /19/11 Preliminary Impression: IMPRESSION: Suggestion of a potential minimal slidmg-type hiatal hernia but no reflux was seen. No other abnormalities are identified. Reading Dr.: Farthing, M.D., David G Resulted: 05/19/ , Result Status: In Resulted by: Farthing, David G., ID Resulting Lab: EPIC RADIANT Resulted by: Farthing, David G., MD Specimen: 05/19/11 Performed: Specimen: 05/19/ /19/ /19/11 process Result Status: In process Performed: 05/19/ /19/ Testing Performed By Lab - Abbreviation Name Director Address Valid Date Range 54 - Unknown EPIC RADIANT Unknown Unknown 03/11/ Present Order Status: Completed Performed: 05/19/ /19/ Specimen: 05/19/11 [ ] Narrative: ESOPHAGRAM (Fluoroscopy time: 0 min. 36 sec. Room: 1 HISTORY: Dysphagia. Resulted: 05/19/ , Result Status: Final Resulted by: Resulting Lab: Farthing, David G., MD EPIC RADIANT Page 7 of 8

8 MRN: CSN: (continued) Resulted: 05/19/ , Result Status: Final FINDINGS: With the oral ingestion of contrast, the esophagus was examined. There is normal antegrade peristalsis. There is suggestion of a minimal sliding-type hiatal hernia. No reflux was elicited. 13 mm pressed barium tablet passes normally down the esophagus. The fluoroscopic procedure was performed by Kevin Hutchins, RPA under direct supervision. Impression: IMPRESSION: Suggestion of a potential minimal sliding-type hiatal hernia but no reflux was seen. No other abnormalities are identified. Reading Dr.: Farthing, M.D., David G This report has been electronically signed by: Farthing, M.D., David G Page 8 of 8

Test Date Job Number Referring Site

Test Date Job Number Referring Site hr Holter Analysis ECG On-Demand Black Barn, Cornwells Farm Sheephurst Lane, Marden Kent T S Details Patient ame Patient umber Patient D.O.B. Jane Smith // ( Years) Test Date Job umber Referring Site //

More information

Technical Publications. Vivid i / Vivid q. Reference Manual. GE Medical Systems. GEMS #: Rev. 02

Technical Publications. Vivid i / Vivid q. Reference Manual. GE Medical Systems. GEMS #: Rev. 02 GE Medical Systems Technical Publications Vivid i / Vivid q Reference Manual GEMS #: 2-1 Rev. 2 Copyright 211 By General Electric Co. Reference Documentation Regulatory Requirements This product complies

More information

Systems Models of the Circula4on BENG 230C Lecture 2

Systems Models of the Circula4on BENG 230C Lecture 2 Systems Models of the Circula4on BENG 230C Lecture 2 Why modeling Enhance insight in physiology Hypothesis genera5on Clinical applica5ons diagnosis training pla7orms for surgeons predict outcomes of surgical

More information

BIOE 110: Biomedical Physiology for Engineers Spring 2013 Midterm I Solutions Key

BIOE 110: Biomedical Physiology for Engineers Spring 2013 Midterm I Solutions Key BIOE 110: Biomedical Physiology for Engineers Spring 2013 Midterm I Solutions Key QUESTION 1 Consider a chamber (at 25 C) consisting of two 1L solutions of mannose (MW 180 g/mol) separated by a semipermeable

More information

Parameter Identification Methods in a Model of the Cardiovascular System

Parameter Identification Methods in a Model of the Cardiovascular System Parameter Identification Methods in a Model of the Cardiovascular System Antoine Pironet Thomas Desaive Pierre C. Dauby J. Geoffrey Chase Paul D. Docherty GIGA-Cardiovascular Sciences, University of Liège,

More information

Basic mechanisms of arrhythmogenesis and antiarrhythmia

Basic mechanisms of arrhythmogenesis and antiarrhythmia EHRA EDUCATIONAL REVIEW AND PREPARATORY COURSE ON INVASIVE CARDIAC ELECTROPHYSIOLOGY EUROPEAN HEART HOUSE, February 2011 Basic mechanisms of arrhythmogenesis and antiarrhythmia Antonio Zaza Università

More information

Determination of pressure data in aortic valves

Determination of pressure data in aortic valves Determination of pressure data in aortic valves Helena Švihlová a, Jaroslav Hron a, Josef Málek a, K.R.Rajagopal b and Keshava Rajagopal c a, Mathematical Institute, Charles University, Czech Republic

More information

Cairns Hospital: Suspected Acute Coronary Syndrome Pathways. DO NOT USE if a non cardiac cause for the chest pain can be diagnosed

Cairns Hospital: Suspected Acute Coronary Syndrome Pathways. DO NOT USE if a non cardiac cause for the chest pain can be diagnosed Cairns Hospital: Suspected Acute Coronary Syndrome Pathways DO NOT USE if a non cardiac cause for the chest pain can be diagnosed Clinical pathways never replace clinical judgement. Care outlined on this

More information

Mathematical Modelling of the Cardiovascular System Haemodynamics

Mathematical Modelling of the Cardiovascular System Haemodynamics Mathematical Modelling of the Cardiovascular System Haemodynamics Anabel Hernández-Ramírez 1 Andrés Fraguela-Collar 1 Rafael Lemuz-López 2 1 Benemérita Universidad Autónoma de Puebla Physical and Mathematical

More information

NOVEL TECHNIQUES FOR CARDIAC ARRHYTHMIA DETECTION

NOVEL TECHNIQUES FOR CARDIAC ARRHYTHMIA DETECTION NOVEL TECHNIQUES FOR CARDIAC ARRHYTHMIA DETECTION By Eng. Mohamed Ibrahim Ismail Owis Systems and Biomedical Engineering Department Faculty of Engineering, Cairo University A Thesis Submitted to the Faculty

More information

CARDIAC METASTASIS MASQUERADE AS STEMI D R S R E E K A N T H K O D U R

CARDIAC METASTASIS MASQUERADE AS STEMI D R S R E E K A N T H K O D U R CARDIAC METASTASIS MASQUERADE AS STEMI D R S R E E K A N T H K O D U R MR OR, 68 YRS Smoker No prior cardiac hx Lives near Muswellbrook area Called ambulance 3 am Atypical chest pain Life net ecg transmitted

More information

Numerical methods for cardiovascular problems: computational electrocardiology and fluid dynamics in moving domains

Numerical methods for cardiovascular problems: computational electrocardiology and fluid dynamics in moving domains POLITECNICO DI MILANO Dipartimento di Matematica F. Brioschi Ph. D. course in Mathematical Engineering XXII cycle Numerical methods for cardiovascular problems: computational electrocardiology and fluid

More information

Noninvasive Estimation of Pulmonary Artery Pressure Using Heart Sound Analysis

Noninvasive Estimation of Pulmonary Artery Pressure Using Heart Sound Analysis Brigham Young University BYU ScholarsArchive All Theses and Dissertations 009-1-07 Noninvasive Estimation of Pulmonary Artery Pressure Using Heart Sound Analysis Aaron W. Dennis Brigham Young University

More information

Harmonic Regression in the Biological Setting. Michael Gaffney, Ph.D., Pfizer Inc

Harmonic Regression in the Biological Setting. Michael Gaffney, Ph.D., Pfizer Inc Harmonic Regression in the Biological Setting Michael Gaffney, Ph.D., Pfizer Inc Two primary aims of harmonic regression 1. To describe the timing (phase) or degree of the diurnal variation (amplitude)

More information

10 0 = 1 1 second. Chapter 1

10 0 = 1 1 second. Chapter 1 Chapter 1 10 0 = 1 1 second The word second is derived from the Latin word secundus or gradus secundus, which means second step or next step. The Romans divided the daylight time into 12 hours. As a further

More information

GLR-Entropy Model for ECG Arrhythmia Detection

GLR-Entropy Model for ECG Arrhythmia Detection , pp.363-370 http://dx.doi.org/0.4257/ijca.204.7.2.32 GLR-Entropy Model for ECG Arrhythmia Detection M. Ali Majidi and H. SadoghiYazdi,2 Department of Computer Engineering, Ferdowsi University of Mashhad,

More information

Simulating ventricular elastance with a heart-arterial interaction model

Simulating ventricular elastance with a heart-arterial interaction model Simulating ventricular elastance with a heart-arterial interaction model Anita Gerstenmayer 1, Bernhard Hametner 2, Stephanie Parragh 1,2, Thomas Weber 3, Siegfried Wassertheurer 2 1 Department for Analysis

More information

Pulsatile Aortic Pressure-Flow Analysis using Fractional Calculus for Minimally-invasive Applications

Pulsatile Aortic Pressure-Flow Analysis using Fractional Calculus for Minimally-invasive Applications Avestia Publishing Journal of Biomedical Engineering and Biosciences Volume, Year 204 ISSN: TBD DOI: TBD Pulsatile Aortic Pressure-Flow Analysis using Fractional Calculus for Minimally-invasive Applications

More information

= (, ) V λ (1) λ λ ( + + ) P = [ ( ), (1)] ( ) ( ) = ( ) ( ) ( 0 ) ( 0 ) = ( 0 ) ( 0 ) 0 ( 0 ) ( ( 0 )) ( ( 0 )) = ( ( 0 )) ( ( 0 )) ( + ( 0 )) ( + ( 0 )) = ( + ( 0 )) ( ( 0 )) P V V V V V P V P V V V

More information

BENG 186B Winter 2014 Quiz 3. March 5, NAME (Last, First): This quiz is closed book and closed notes. You may use a calculator for algebra.

BENG 186B Winter 2014 Quiz 3. March 5, NAME (Last, First): This quiz is closed book and closed notes. You may use a calculator for algebra. BENG 186B Winter 2014 Quiz 3 March 5, 2014 NAME (Last, First): This quiz is closed book and closed notes. You may use a calculator for algebra. Circle your final answers in the space provided; show your

More information

EGD (Upper Endoscopy)

EGD (Upper Endoscopy) Gastroenterology EGD (Upper Endoscopy) REMINDER FOR: ON THE DAY OF YOUR PROCEDURE Bring a list of all your medications (over-the-counter and prescription) You must have a driver to take you home following

More information

Ê 7, 45 Ê 7 Ë 7 Ë. Time: 100 minutes. Name: Class: Date:

Ê 7, 45 Ê 7 Ë 7 Ë. Time: 100 minutes. Name: Class: Date: Class: Date: Time: 100 minutes Test1 (100 Trigonometry) Instructor: Koshal Dahal SHOW ALL WORK, EVEN FOR MULTIPLE CHOICE QUESTIONS, TO RECEIVE FULL CREDIT. 1. Find the terminal point P (x, y) on the unit

More information

MASSACHUSETTS INSTITUTE OF TECHNOLOGY

MASSACHUSETTS INSTITUTE OF TECHNOLOGY Harvard-MIT Division of Health Sciences and Technology HST.54J: Quantitative Physiology: Organ Transport Systems Instructors: Roger Mark and Jose Venegas MASSACHUSETTS INSTITUTE OF TECHNOLOGY Departments

More information

8/2/2012. Outline. Dr M. Mahesh MS, PhD, FAAPM, FACR, FACMP, FSCCT. Fluoroscopy Training and Compliance Experience of a Large Academic Institution

8/2/2012. Outline. Dr M. Mahesh MS, PhD, FAAPM, FACR, FACMP, FSCCT. Fluoroscopy Training and Compliance Experience of a Large Academic Institution Fluoroscopy Training and Compliance Experience of a Large Academic Institution Mahadevappa Mahesh, MS, PhD, FAAPM, FACR, FACMP, FSCCT. Associate Professor of Radiology and Cardiology School of Medicine

More information

Bayesian Networks for Cardiovascular Monitoring

Bayesian Networks for Cardiovascular Monitoring Proceedings of the 8th IEEE EMBS Annual International Conference New York City, USA, Aug 3-Sept 3, 6 WeC5.3 Bayesian Networks for Cardiovascular Monitoring Jennifer M. Roberts, ushar A. Parlikar, homas

More information

Prediction of Paroxysmal Atrial Fibrillation (PAF) Onset through Analysis of Inter-beat Intervals (IBI)

Prediction of Paroxysmal Atrial Fibrillation (PAF) Onset through Analysis of Inter-beat Intervals (IBI) Prediction of Paroxysmal Atrial Fibrillation (PAF) Onset through Analysis of Inter-beat Intervals (IBI) By Charles Q. Du Submitted to the Department of Electrical Engineering and Computer Science In Partial

More information

NACC Uniform Data Set (UDS) FTLD Module

NACC Uniform Data Set (UDS) FTLD Module NACC Uniform Data Set (UDS) FTLD Module Data Template For Initial Visit Packet Version 2.0, January 2012 Copyright 2013 University of Washington Created and published by the FTLD work group of the ADC

More information

ESTIMATION AND IDENTIFICATION OF PARAMETERS IN A LUMPED CEREBROVASCULAR MODEL

ESTIMATION AND IDENTIFICATION OF PARAMETERS IN A LUMPED CEREBROVASCULAR MODEL MATHEMATICAL BIOSCIENCES doi:10.3934/mbe.2009.6.93 AND ENGINEERING Volume 6, Number 1, January 2009 pp. 93 115 ESTIMATION AND IDENTIFICATION OF PARAMETERS IN A LUMPED CEREBROVASCULAR MODEL Scott R. Pope

More information

Assessing Catheter Contact in Radiofrequency Cardiac Ablation Using Complex Impedance

Assessing Catheter Contact in Radiofrequency Cardiac Ablation Using Complex Impedance Assessing Catheter Contact in Radiofrequency Cardiac Ablation Using Complex Impedance Neal P. Gallagher a, Israel J. Byrd b, Elise C. Fear a, Edward J. Vigmond a a Dept. Electrical and Computer Engineering,

More information

NACC Uniform Data Set (UDS) FTLD Module

NACC Uniform Data Set (UDS) FTLD Module NACC Uniform Data Set (UDS) FTLD Module Data Template For FOLLOW-UP Visit Packet Version 2.0, January 2012 Copyright 2013 University of Washington Created and published by the FTLD work group of the ADC

More information

PUBLISHED VERSION PERMISSIONS.

PUBLISHED VERSION PERMISSIONS. PUBLISHED VERSION Zebrowski, J. J.; Grudzinski, K.; Buchner, T.; Kuklik, Pawel; Gac, J.; Gielerak, G.; Sanders, Prashanthan; Baranowski, R. Nonlinear oscillator model reproducing various phenomena in the

More information

TAC1 TAC4 TAC7 TAC14 TAC21

TAC1 TAC4 TAC7 TAC14 TAC21 Table S1 Gene qrt-pcr primer sequence Amplification efficiency α-sma (FW) 5 - GCCAGTCGCTGTCAGGAACCC -3 (RV) 5 - AGCCGGCCTAGAGCCCA -3 Procollagen-I (FW) 5 - AAGACGGGAGGGCGAGTGCT -3 (RV) 5 - AACGGGTCCCCTTGGGCCTT

More information

Decision Trees Lecture 12

Decision Trees Lecture 12 Decision Trees Lecture 12 David Sontag New York University Slides adapted from Luke Zettlemoyer, Carlos Guestrin, and Andrew Moore Machine Learning in the ER Physician documentation Triage Information

More information

Localizing Cardiac Structures in Fetal Heart Ultrasound Video

Localizing Cardiac Structures in Fetal Heart Ultrasound Video Localizing Cardiac Structures in Fetal Heart Ultrasound Video Christopher P. Bridge 1, Christos Ioannou 2, and J. Alison Noble 1 1 Institute of Biomedical Engineering, University of Oford, Oford, UK, 2

More information

Chapter 17. Current and Resistance

Chapter 17. Current and Resistance Chapter 17 Current and Resistance Electric Current The current is the rate at which the charge flows through a surface Look at the charges flowing perpendicularly through a surface of area A I av The SI

More information

Complex temporal patterns of spontaneous initiation and termination of reentry in a loop of cardiac tissue

Complex temporal patterns of spontaneous initiation and termination of reentry in a loop of cardiac tissue University of Richmond UR Scholarship Repository Math and Computer Science Faculty Publications Math and Computer Science 2008 Complex temporal patterns of spontaneous initiation and termination of reentry

More information

Structural Identifiability Analysis of a Cardiovascular System Model

Structural Identifiability Analysis of a Cardiovascular System Model Preprints of the 19th World Congress The International Federation of Automatic Control Structural Identifiability Analysis of a Cardio System Model Antoine Pironet Pierre C. Dauby J. Geoffrey Chase James

More information

Chapter 17 Current and Resistance

Chapter 17 Current and Resistance Chapter 17 Current and Resistance Current Practical applications were based on static electricity. A steady source of electric current allowed scientists to learn how to control the flow of electric charges

More information

Synthesising robust and optimal parameters for cardiac pacemakers using symbolic and evolutionary computation techniques

Synthesising robust and optimal parameters for cardiac pacemakers using symbolic and evolutionary computation techniques Synthesising robust and optimal parameters for cardiac pacemakers using symbolic and evolutionary computation techniques Marta Kwiatkowska 1, Alexandru Mereacre 1, Nicola Paoletti 1, and Andrea Patanè

More information

Modelling Heart Rate Variability

Modelling Heart Rate Variability Modelling Heart Rate Variability P. Laguna and L. Sörnmo Introduction The study of heart rate variability (HRV) has become increasingly popular because information on the state of the autonomic nervous

More information

TIETZ FUNDAMENTALS OF CLINICAL CHEMISTRY PDF

TIETZ FUNDAMENTALS OF CLINICAL CHEMISTRY PDF TIETZ FUNDAMENTALS OF CLINICAL CHEMISTRY PDF ==> Download: TIETZ FUNDAMENTALS OF CLINICAL CHEMISTRY PDF TIETZ FUNDAMENTALS OF CLINICAL CHEMISTRY PDF - Are you searching for Tietz Fundamentals Of Clinical

More information

Heat Transfer F12-ENG Lab #4 Forced convection School of Engineering, UC Merced.

Heat Transfer F12-ENG Lab #4 Forced convection School of Engineering, UC Merced. 1 Heat Transfer F12-ENG-135 - Lab #4 Forced convection School of Engineering, UC Merced. October 23, 2012 1 General purpose of the Laboratory To gain a physical understanding of the behavior of the average

More information

The Severe Weather Event of 7 August 2013 By Richard H. Grumm and Bruce Budd National Weather Service State College, PA 1. INTRODUCTION and Overview

The Severe Weather Event of 7 August 2013 By Richard H. Grumm and Bruce Budd National Weather Service State College, PA 1. INTRODUCTION and Overview The Severe Weather Event of 7 August 2013 By Richard H. Grumm and Bruce Budd National Weather Service State College, PA 1. INTRODUCTION and Overview A fast moving short-wave (Fig. 1) with -1σ 500 hpa height

More information

Mathematical physiology. 1.1 Derive a suitably scaled form of the Michaelis-Menten model for the reaction E + P,, λ = k 2

Mathematical physiology. 1.1 Derive a suitably scaled form of the Michaelis-Menten model for the reaction E + P,, λ = k 2 Problem sheet 1. 1.1 Derive a suitably scaled form of the Michaelis-Menten model for the reaction S + E and show that it depends on the parameters k 1 k 1 C k 2 E + P K = k 1 + k 2 k 1 S 0 λ = k 2 k 1

More information

ROLE OF BIDOMAIN MODEL OF CARDIAC TISSUE IN THE DYNAMICS OF PHASE SINGULARITIES

ROLE OF BIDOMAIN MODEL OF CARDIAC TISSUE IN THE DYNAMICS OF PHASE SINGULARITIES ROLE OF BIDOMAIN MODEL OF CARDIAC TISSUE IN THE DYNAMICS OF PHASE SINGULARITIES Jianfeng Lv Submitted to the faculty of the University Graduate School in partial fulfillment of the requirement for the

More information

Velocity Images. Phase Contrast Technique. G. Reiter 1,2, U. Reiter 1, R. Rienmüller 1

Velocity Images. Phase Contrast Technique. G. Reiter 1,2, U. Reiter 1, R. Rienmüller 1 Velocity Images - the MR Phase Contrast Technique G. Reiter 1,2, U. Reiter 1, R. Rienmüller 1 SSIP 2004 12 th Summer School in Image Processing, Graz, Austria 1 Interdisciplinary Cardiac Imaging Center,

More information

Version 3.0, March 2015

Version 3.0, March 2015 NACC UNIFORM data set FTLD MODULE Data Template for IVP Version 3.0, March 2015 Copyright 2013, 2015 University of Washington. Created and published by the FTLD work group of the ADC Program (David Knopman,

More information

A Preliminary Fractional Calculus Model of the Aortic Pressure Flow Relationship during Systole

A Preliminary Fractional Calculus Model of the Aortic Pressure Flow Relationship during Systole Proceedings of the International Conference on Biomedical Engineering and Systems Prague, Czech Republic, August 14-15, 2014 Paper No. 34 A Preliminary Fractional Calculus Model of the Aortic Pressure

More information

PROBLEM SET 3. SOLUTIONS February 26, 2004

PROBLEM SET 3. SOLUTIONS February 26, 2004 Harvard-MIT Division of Health Sciences and Technology HST.542J: Quantitative Physiology: Organ Transport Systems Instructors: Roger Mark and Jose Venegas MASSACHUSETTS INSTITUTE OF TECHNOLOGY Departments

More information

Exploration, Processing and Visualization of Physiological Signals from the ICU

Exploration, Processing and Visualization of Physiological Signals from the ICU Exploration, Processing and Visualization of Physiological Signals from the ICU By Carlos A. Renjifo Submitted to the Department of Electrical Engineering and Computer Science in Partial Fulfillment of

More information

CHAPTER 3 FEATURE EXTRACTION USING GENETIC ALGORITHM BASED PRINCIPAL COMPONENT ANALYSIS

CHAPTER 3 FEATURE EXTRACTION USING GENETIC ALGORITHM BASED PRINCIPAL COMPONENT ANALYSIS 46 CHAPTER 3 FEATURE EXTRACTION USING GENETIC ALGORITHM BASED PRINCIPAL COMPONENT ANALYSIS 3.1 INTRODUCTION Cardiac beat classification is a key process in the detection of myocardial ischemic episodes

More information

Biomechanics. Soft Tissue Biomechanics

Biomechanics. Soft Tissue Biomechanics Biomechanics cross-bridges 3-D myocardium ventricles circulation Image Research Machines plc R* off k n k b Ca 2+ 0 R off Ca 2+ * k on R* on g f Ca 2+ R0 on Ca 2+ g Ca 2+ A* 1 A0 1 Ca 2+ Myofilament kinetic

More information

How do nerve cells behave? At

How do nerve cells behave? At Excitable Media: The Belousov-Zhabotinsky Chemical Reaction and the Heart Harold M. Hastings Professor and Chairperson Department of Physics Figure 2. Simulated cardiac dynamics by Flavio Fenton and Elizabeth

More information

Heart rate control and variability

Heart rate control and variability Heart rate control and variability Na (Lina) Li (CDS13 ) EE @ SEAS Harvard University CDS @ 20 The persistent mystery Young, fit, healthy more extreme Resting Heart Rate (bpm) 60 0 50 100 150 200 250 300

More information

Multicompartment Pharmacokinetic Models. Objectives. Multicompartment Models. 26 July Chapter 30 1

Multicompartment Pharmacokinetic Models. Objectives. Multicompartment Models. 26 July Chapter 30 1 Multicompartment Pharmacokinetic Models Objectives To draw schemes and write differential equations for multicompartment models To recognize and use integrated equations to calculate dosage regimens To

More information

Calibration Verification Linearity in the Clinical Lab. Did I Pass or Fail? 2017 ASCLS New Jersey

Calibration Verification Linearity in the Clinical Lab. Did I Pass or Fail? 2017 ASCLS New Jersey Calibration Verification Linearity in the Clinical Lab. Did I Pass or Fail? 2017 ASCLS New Jersey Presentation Topics & Objectives Calibration Verification Key Definitions Why do I need to perform CV?

More information

Overture: Why is Physiologic Variability Important?

Overture: Why is Physiologic Variability Important? Welcome! HRV 2006: April, 2006 Overture: Why is Physiologic Variability Important? Ary L. Goldberger, MD Director, Margret and H.A. Rey Institute for Nonlinear Dynamics in Medicine Beth Israel Deaconess

More information

Swine Enteric Coronavirus Disease (SECD) Situation Report June 30, 2016

Swine Enteric Coronavirus Disease (SECD) Situation Report June 30, 2016 Animal and Plant Health Inspection Service Veterinary Services Swine Enteric Coronavirus Disease (SECD) Situation Report June 30, 2016 Information current as of 12:00 pm MDT, 06/29/2016 This report provides

More information

Swine Enteric Coronavirus Disease (SECD) Situation Report Sept 17, 2015

Swine Enteric Coronavirus Disease (SECD) Situation Report Sept 17, 2015 Animal and Plant Health Inspection Service Veterinary Services Swine Enteric Coronavirus Disease (SECD) Situation Report Sept 17, 2015 Information current as of 12:00 pm MDT, 09/16/2015 This report provides

More information

Section 9.5. Testing the Difference Between Two Variances. Bluman, Chapter 9 1

Section 9.5. Testing the Difference Between Two Variances. Bluman, Chapter 9 1 Section 9.5 Testing the Difference Between Two Variances Bluman, Chapter 9 1 This the last day the class meets before spring break starts. Please make sure to be present for the test or make appropriate

More information

7, 48 7, 6 7, 45. Name: Class: Date: Multiple Choice Questions

7, 48 7, 6 7, 45. Name: Class: Date: Multiple Choice Questions Class: Date: Practice Test (00 Trigonometry) Instructor: Koshal Dahal Multiple Choice Questions SHOWALLWORK,EVENFORMULTIPLECHOICEQUESTIONS,TORECEIVECREDIT.. Find the terminal point P (x, y) on the unit

More information

Recovery dynamics of the Fenton-Karma membrane model and their implications for modeling pharmacologically-induced atrial fibrillation

Recovery dynamics of the Fenton-Karma membrane model and their implications for modeling pharmacologically-induced atrial fibrillation Recovery dynamics of the Fenton-Karma membrane model and their implications for modeling pharmacologically-induced atrial fibrillation Matt Gonzales Department of Bioengineering University of California,

More information

Closed-loop Verification of Medical Devices With Model Abstraction and Refinement

Closed-loop Verification of Medical Devices With Model Abstraction and Refinement University of Pennsylvania ScholarlyCommons Real-Time and Embedded Systems Lab (mlab) School of Engineering and Applied Science 9-11-2013 Closed-loop Verification of Medical Devices With Model Abstraction

More information

The Probability of Pathogenicity in Clinical Genetic Testing: A Solution for the Variant of Uncertain Significance

The Probability of Pathogenicity in Clinical Genetic Testing: A Solution for the Variant of Uncertain Significance The Probability of Pathogenicity in Clinical Genetic Testing: A Solution for the Variant of Uncertain Significance 1 Introduction by (in alphabetical order) Michael Gollob, Jeffrey S. Rosenthal, and Kevin

More information

CONDITIONAL JOINT TRANSFER ENTROPY OF CARDIOVASCULAR AND CEREBROVASCULAR CONTROL SYSTEMS IN SUBJECTS PRONE TO POSTURAL SYNCOPE

CONDITIONAL JOINT TRANSFER ENTROPY OF CARDIOVASCULAR AND CEREBROVASCULAR CONTROL SYSTEMS IN SUBJECTS PRONE TO POSTURAL SYNCOPE CONDITIONAL JOINT TRANSFER ENTROPY OF CARDIOVASCULAR AND CEREBROVASCULAR CONTROL SYSTEMS IN SUBJECTS PRONE TO POSTURAL SYNCOPE Vlasta Bari 1, Andrea Marchi 2,3, Beatrice De Maria 2,4, Gianluca Rossato

More information

IMPACT Improving Massachusetts Post-Acute Care Transfers

IMPACT Improving Massachusetts Post-Acute Care Transfers IMPACT Improving Massachusetts Post-Acute Care Transfers New England Home Care Conference May 31 st, 2012 Larry Garber, MD Medical Director for Informatics Reliant Medical Group Agenda IMPACT project overview

More information

SZILÁGYI Sándor Miklós

SZILÁGYI Sándor Miklós SZILÁGYI Sándor Miklós Producția ştiințifică TOTAL PUNCTE 9, Categoria A,00 Categoria B,00 Categoria C, Lucrări categoria A + (/) + (/) + (/) = puncte curent A.0. A.0. A.0. A.0. A.0. A.0. A.07. Lucrare

More information

School of Science, Medicine & Health Michael J Macartney. Supervised By: Dr Gregory Peoples Prof Peter McLennan Mr Marc Brown

School of Science, Medicine & Health Michael J Macartney. Supervised By: Dr Gregory Peoples Prof Peter McLennan Mr Marc Brown School of Science, Medicine & Health 2013 Michael J Macartney Supervised By: Dr Gregory Peoples Prof Peter McLennan Mr Marc Brown The Cardiac Branch The Vascular Branch Blood Pressure = CVD & all-cause

More information

The Probability of Pathogenicity in Clinical Genetic Testing: A Solution for the Variant of Uncertain Significance

The Probability of Pathogenicity in Clinical Genetic Testing: A Solution for the Variant of Uncertain Significance International Journal of Statistics and Probability; Vol. 5, No. 4; July 2016 ISSN 1927-7032 E-ISSN 1927-7040 Published by Canadian Center of Science and Education The Probability of Pathogenicity in Clinical

More information

System Modelling using Event-B

System Modelling using Event-B System Modelling using Event-B Neeraj Kumar Singh McMaster Centre for Software Certification March 25, 2014 Neeraj Kumar Singh (McMaster University) Modelling in Event-B March 25, 2014 1 / 34 Outline 1

More information

ANGULAR ERROR IN ULTRASOUND DOPPLER TISSUE VELOCITIES AND ITS IFLUENCE ON THE DERIVED VARIABLE PEAK SYSTOLIC STRAIN

ANGULAR ERROR IN ULTRASOUND DOPPLER TISSUE VELOCITIES AND ITS IFLUENCE ON THE DERIVED VARIABLE PEAK SYSTOLIC STRAIN ANGULAR ERROR IN ULTRASOUND DOPPLER TISSUE VELOCITIES AND ITS IFLUENCE ON THE DERIVED VARIABLE PEAK SYSTOLIC STRAIN 1of Camilla Storaa 1, Lars-Åke Brodin, Britta Lind 1 Division of Medical Engineering,

More information

Technical Report: Abstraction-Tree For Closedloop Model Checking of Medical Devices

Technical Report: Abstraction-Tree For Closedloop Model Checking of Medical Devices University of Pennsylvania ScholarlyCommons Real-Time and Embedded Systems Lab (mlab) School of Engineering and Applied Science 5-6-2015 Technical Report: Abstraction-Tree For Closedloop Model Checking

More information

ECG Noise Filtering Using Online Model-Based Bayesian Filtering Techniques

ECG Noise Filtering Using Online Model-Based Bayesian Filtering Techniques ECG Noise Filtering Using Online Model-Based Bayesian Filtering Techniques by Aron Su A thesis presented to the University of Waterloo in fulfillment of the thesis requirement for the degree of Master

More information

Atmosphere CHANGE IS IN THE AIR

Atmosphere CHANGE IS IN THE AIR Activity 8 UVs and Frisbees Atmosphere CHANGE IS IN THE AIR Forces of Change» Atmosphere» Activity 8» Page 1 UVs and Frisbees Overview This experiment will help students understand that ultraviolet radiation

More information

ENGG Fundamentals of Electrical Circuits and Machines Final Examination

ENGG Fundamentals of Electrical Circuits and Machines Final Examination Name: Lecture Section: ID#: ENGG 225 - Fundamentals of Electrical Circuits and Machines Final Examination Monday, April 22, 2013 Time: 12:00-3:00 PM Red and Gold Gymnasium L01 - Anis Haque L02 - Norm Bartley

More information

USDA NRCS Soil Survey

USDA NRCS Soil Survey USDA NRCS Soil Survey Thomas Reinsch National Leader World Soil Resources Slide 1 Slide 2 National Cooperative Soil Survey Congress Has Directed The Secretary Of Agriculture To: 1899-2011 Inventory Soils

More information

Classifying Mechanisms of Spiral Wave Breakup Underlying Cardiac Fibrillation Using Quantitative Metrics

Classifying Mechanisms of Spiral Wave Breakup Underlying Cardiac Fibrillation Using Quantitative Metrics Rochester Institute of Technology RIT Scholar Works Theses Thesis/Dissertation Collections 8--04 Classifying Mechanisms of Spiral Wave Breakup Underlying Cardiac Fibrillation Using Quantitative Metrics

More information

Receding horizon controller for the baroreceptor loop in a model for the cardiovascular system

Receding horizon controller for the baroreceptor loop in a model for the cardiovascular system SpezialForschungsBereich F 32 Karl Franzens Universität Graz Technische Universität Graz Medizinische Universität Graz Receding horizon controller for the baroreceptor loop in a model for the cardiovascular

More information

Applied Physics Topics 1. Dr Andrey Varvinskiy Consultant Anaesthetist Torbay Hospital, UK EDAIC Paper B Lead and Examiner

Applied Physics Topics 1. Dr Andrey Varvinskiy Consultant Anaesthetist Torbay Hospital, UK EDAIC Paper B Lead and Examiner Applied Physics Topics 1 Dr Andrey Varvinskiy Consultant Anaesthetist Torbay Hospital, UK EDAIC Paper B Lead and Examiner Conflict of interest declaration WHAT DECLARATION Grants/research support/p.i.

More information

Daily Operations Briefing Wednesday, February 10, :30 a.m. EST

Daily Operations Briefing Wednesday, February 10, :30 a.m. EST Daily Operations Briefing Wednesday, February 10, 2016 8:30 a.m. EST Significant Activity: February 9-10 Significant Events: None Significant Weather: Snow Northern Plains to Upper/Middle Mississippi valleys,

More information

Isotope Analysis XRF XRD Source Rock Pyrolysis SEM Paraffin Reducers

Isotope Analysis XRF XRD Source Rock Pyrolysis SEM Paraffin Reducers Final XRF Report For SUMMARY -- PILOT WELL -- WBM/CURVE -- DATA-OBM/LATERAL DATA -- CALIBRATION LOGS TOC-est PLOTS -- RATIO PLOTS -- TH/K PLOTS 1 P a g e 2 P a g e Isotope Analysis XRF XRD Source Rock

More information

Dynamic Control of a Tandem Queueing System with Abandonments

Dynamic Control of a Tandem Queueing System with Abandonments Dynamic Control of a Tandem Queueing System with Abandonments Gabriel Zayas-Cabán 1 Jungui Xie 2 Linda V. Green 3 Mark E. Lewis 1 1 Cornell University Ithaca, NY 2 University of Science and Technology

More information

YOUR HW MUST BE STAPLED YOU MUST USE A PENCIL (no pens)

YOUR HW MUST BE STAPLED YOU MUST USE A PENCIL (no pens) Spring 2008 CIVE 462 HOMEWORK #1 1. Print out the syllabus. Read it. Write the grade percentages in the first page of your notes. 2. Go back to your 301 notes, internet, etc. and find the engineering definition

More information

Detection of Heart Rate Turbulence Using an Extended IPFM Model

Detection of Heart Rate Turbulence Using an Extended IPFM Model Detection of Heart Rate Turbulence Using an Extended IPFM Model Solem, Kristian; Laguna, Pablo; Sörnmo, Leif Published in: [Host publication title missing] Published: 26-1-1 Link to publication Citation

More information

The National Lung Health Education Program. Spirometric Reference Values for the 6-s FVC Maneuver*

The National Lung Health Education Program. Spirometric Reference Values for the 6-s FVC Maneuver* Spirometric Reference Values for the 6-s FVC Maneuver* John L. Hankinson, PhD; Robert O. Crapo, MD, FCCP; and Robert L. Jensen, PhD Study objectives: The guidelines of the National Lung Health Education

More information

Daily Operations Briefing Friday, January 22, :30 a.m. EST

Daily Operations Briefing Friday, January 22, :30 a.m. EST Daily Operations Briefing Friday, January 22, 2016 8:30 a.m. EST Significant Activity: Jan 21-22 Significant Events: Winter Storm Eastern U.S. Significant Weather: Heavy snow possible Cascades and Sierras;

More information

cobas 6000 analyzer series Flexibility you can build on

cobas 6000 analyzer series Flexibility you can build on cobas 6000 analyzer series Flexibility you can build on cobas 6000 analyzer series Flexibility you can build on Many of today s laboratories are challenged with delivering high standards of laboratory

More information

Parametric Functions and Vector Functions (BC Only)

Parametric Functions and Vector Functions (BC Only) Parametric Functions and Vector Functions (BC Only) Parametric Functions Parametric functions are another way of viewing functions. This time, the values of x and y are both dependent on another independent

More information

East West Acupuncture & Wellness Center, Inc. Patient Intake Form

East West Acupuncture & Wellness Center, Inc. Patient Intake Form East West Acupuncture & Wellness Center, Inc. Patient Intake Form Date: / / How did you hear about us? ( )Ad ( ) Healthcare Referral ( ) Friend/Family Whom may we thank for the referral? Name DOB / / Age

More information

polycardiographic measurements1

polycardiographic measurements1 British Heart J7ournal, 1978, 40, 1344-1348 Effects of recording speed on precision of time-based polycardiographic measurements1 Optimal paper speeds for measuring points and intervals DAVID H. SPODICK,

More information

ERYTHROBLASTOSIS FETALIS WITHOUT AN OBVIOUS CAUSE Case Study by Jim Perkins, MD ( 2010)

ERYTHROBLASTOSIS FETALIS WITHOUT AN OBVIOUS CAUSE Case Study by Jim Perkins, MD ( 2010) ERYTHROBLASTOSIS FETALIS WITHOUT AN OBVIOUS CAUSE Case Study by Jim Perkins, MD ( 2010) A 31 year old pregnant woman at 41 weeks, 2 days gestation was admitted to the hospital for induction of labor because

More information

Simple Harmonic Motion Concept Questions

Simple Harmonic Motion Concept Questions Simple Harmonic Motion Concept Questions Question 1 Which of the following functions x(t) has a second derivative which is proportional to the negative of the function d x! " x? dt 1 1. x( t ) = at. x(

More information

Wednesday, November 7, :30 a.m. EST

Wednesday, November 7, :30 a.m. EST Wednesday, November 7, 2018 8:30 a.m. EST Significant Activity Nov 6-7 Significant Events: Tropical Cyclone Yutu Recovery Tropical Activity: Atlantic No new tropical cyclones are expected during the next

More information

NONLINEAR DYNAMICS AND CHAOS. Facilitating medical diagnosis. Medical classifications

NONLINEAR DYNAMICS AND CHAOS. Facilitating medical diagnosis. Medical classifications LECTURE : BIOMEDICAL MODELS NONLINEAR DYNAMICS AND CHAOS Patrick E McSharry Systems Analysis, Modelling & Prediction Group www.eng.ox.ac.uk/samp patrick@mcsharry.net Tel: +44 2 823 74 Medical diagnostics

More information

FLUVIA NAUTIC DATASET (16 March 2007) Description of the sensor logs

FLUVIA NAUTIC DATASET (16 March 2007) Description of the sensor logs FLUVIA NAUTIC DATASET (16 March 2007) Description of the sensor logs David Ribas, PhD Student. Underwater Robotics Lab, Computer Vision and Robotics Group, University of Girona Doppler Velocity Log (Argonaut

More information

Analysis Of The Second Cardiac Sound Using The Fast Fourier And The Continuous Wavelet Transforms

Analysis Of The Second Cardiac Sound Using The Fast Fourier And The Continuous Wavelet Transforms ISPUB.COM The Internet Journal of Medical Technology Volume 3 Number 1 Analysis Of The Second Cardiac Sound Using The Fast Fourier And The Continuous Wavelet Transforms S Debbal, F Bereksi-Reguig Citation

More information

Supervised Learning! Algorithm Implementations! Inferring Rudimentary Rules and Decision Trees!

Supervised Learning! Algorithm Implementations! Inferring Rudimentary Rules and Decision Trees! Supervised Learning! Algorithm Implementations! Inferring Rudimentary Rules and Decision Trees! Summary! Input Knowledge representation! Preparing data for learning! Input: Concept, Instances, Attributes"

More information

Daily Operations Briefing Thursday, December 25, :30 a.m. EST

Daily Operations Briefing Thursday, December 25, :30 a.m. EST Daily Operations Briefing Thursday, December 25, 2014 8:30 a.m. EST Significant Activity: Dec 24 25 Significant Events: Severe Weather Southeast (Dec 23 24) Significant Weather: Heavy snow: Intermountain

More information

Fatigue Problems Solution

Fatigue Problems Solution Fatigue Problems Solution Problem 1. (a) Given the values of σ m (7 MPa) and σ a (1 MPa) we are asked t o compute σ max and σ min. From Equation 1 Or, σ m σ max + σ min 7 MPa σ max + σ min 14 MPa Furthermore,

More information

Today s Discussion: Fluids Pressure and Pascal s principle Bouyancy, Archimedes principle Bernoulli s equation

Today s Discussion: Fluids Pressure and Pascal s principle Bouyancy, Archimedes principle Bernoulli s equation 1 Physics 213 Waves, Fluids and Thermal Physics Summer 2007 Lecturer: Mike Kagan (mak411@psu.edu, 322 Whitmore) Today s Discussion: Fluids Pressure and Pascal s principle Bouyancy, Archimedes principle

More information