Kamran Ghalili, M.D. Rosamund Irwin, M.D.
|
|
- Coleen Peters
- 5 years ago
- Views:
Transcription
1 Giffen, Todd Michael (29 yrs [3/13/1985]) Sex.M Procedure Notes Procedures filed by Ghalili, Kamran, MD at 10/08/ Author: Ghalili, Kamran, MD Service: (none) Author Physician Type: Filed: 10/08/ Note 09/22/ Trans ID: D Time: Trans Available Status: Procedure Orders: 1. HOLTER MONITOR [ ] ordered by liavin, Rosamund, MD at 09/18/ DATE OF STUDY: PATIENT NAME: Giffen, Todd Michael PATIENT AGE: 23 PATIENT LOCATION: CARL REFERRING PHYSICIAN: REFERRING PHYSICIAN: Rosamund Irwin, M.D. TYPE OF STUDY: HOLTER MONITOR INDICATIONS: Palpitations. FINDINGS: 1. Underlying rhythm is normal sinus rhythm. Average rate was 106 beats per minute. Sinus tachycardia. Minimum rate was 76 beats per minute at 1044 hours. Maximal rate was 160 beats per minute at 1656 hours. 2. No ventricular premature beats noted. 3. No significant ectopic beat noted. No obvious supraventricular tachycardia noted. IMPRESSION: Essentially during this Holter monitor recording patient is mostly in sinus tachycardia. No evidence of supraventricular or ventricular tachycardia noted. S I G N E D B Y K a m r a n Ghalili, M. D. 1 0 / 0 8 / : 2 9 P K a i s e r # ( I f A p p l i c a b l e ) : cc: Kamran Ghalili, M.D. Rosamund Irwin, M.D. Consult Notes Page 1 of 8
2 Consult Notes (continued) Initial Assessment Notes H&P Summary Notes Discharge Summary Notes ER RECORDS ED Arrival Information Patient not seen in ED Diagnosis None ED Disposition None ED Notes Clinical Lab Results Lab Results No matching s found No matching s found HOLTER MONITOR [ ] Ordering Provider: Transcription Cardiac Lab-Stress Tests Document Text Resulted: 09/26/ , Result Status: Final Irwin, Rosamund, MD 09/18/ Order Status: Completed ID C^te and Time Author D /22/ :46 PM Ghalili, Kamran, MD Page 2 of
3 HOLTER MONITOR [ ] (continued) Resulted: 09/26/ , Result Status: Final DATE OF STUDY: PATIENT NAME: PATIENT AGE: PATIENT LOCATION: REFERRING PHYSICIAN: Giffen, Todd Michael 23 CARL REFERRING PHYSICIAN: Rosamund Irwin, M.D. TYPE OF STUDY: HOLTER MONITOR INDICATIONS: Palpitations. FINDINGS: 1. Underlying rhythm is normal sinus rhythm. Average rate was 106 beats per minute. Sinus tachycardia. Minimum rate was 76 beats per minute at 1044 hours. Maximal rate was 160 beats per minute at 1656 hours. 2. No ventricular premature beats noted. 3. No significant ectopic beat noted. No obvious supraventricular tachycardia noted. IMPRESSION: Essentially during this Holter monitor recording patient is mostly in sinus tachycardia. No evidence of supraventricular or ventricular tachycardia noted. S I G N E D B Y K a m r a n Ghalili, M. D. 1 0 / 0 8 / : 2 9 P K a i s e r # ( I f A p p l i c a b l e ) : cc: Kamran Ghalili, M.D. Rosamund Irwin, M.D. ECHOCARDIOGRAPH [ ] Resulted: 09/18/ , Result Status: Final Ordering Unlisted, Provider, PA 09/18/ Order Status: Completed Provider: Specimen Resulting Lab: SALEM ECHO LAB [XECHO- 09/18/ ] Narrative: Ordered by Rosamund Irwin MD Page 3 of 8
4 ECHOCARDIOGRAPH [ ] (continued) Resulted: 09/18/ , Result Status: Final Component Value Flag INTERPRETATION SUMMARY PATIENT HEIGHT PATIENT WEIGHT BSA LEFT VENTRICLE RIGHT VENTRICLE ATRIA MITRAL VALVE TRICUSPID VALVE AORTIC VALVE I n t e r p r e t a t i o n Summary A t w o - d i m e n s i o n a l t r a n s t h o r a c i c e c h o c a r d i o g r a m w i t h M- mode a n d D o p p l e r was p e r f o r m e d. T h i s was e s s e n t i a l l y a n o r m a l s t u d y. T h e r e i s r n i l d t r i c u s p i d r e g u r g i t a t i o n. 74 in 179 lbs 2.1 m L e f t V e n t r i c l e The l e f t v e n t r i c l e i s n o r m a l i n s i z e. T h e r e i s n o r m a l l e f t v e n t r i c u l a r w a l l t h i c k n e s s. E j e c t i o n F r a c t i o n = %. P v i g h t V e n t r i c l e The r i g h t v e n t r i c l e i s n o r m a l s i z e. A t r i a The l e f t a t r i a l s i z e i s n o r m a l. R i g h t a t r i a l s i z e i s n o r m a l. The JVC i s n o r m a l i n s i z e a n d c o l l a p s e s w i t h i n s p i r a t i o n. M i t r a l V a l v e The m i t r a l v a l v e l e a f l e t s a p p e a r n o r m a l. T h e r e i s no e v i d e n c e o f s t e n o s i s, f l u t t e r i n g, o r p r o l a p s e. T h e r e i s no m i t r a l r e g u r g i t a t i o n n o t e d. T r i c u s p i d V a l v e The t r i c u s p i d v a l v e i s n o t w e l l v i s u a l i z e d, b u t i s g r o s s l y n o r m a l. T h e r e i s m r l d t r i c u s p i d r e g u r g i t a t i o n. PULMONIC VALVE PERICARDIUM/PLEURAL A o r t i c V a l v e The a o r t i c v a l v e i s t r i l e a f l e t. The a o r t i c v a l v e o p e n s w e l l. Mo a o r t i c r e g u r g i t a t i o n i s p r e s e n t. P u l m o n i c V a l v e The p u l m o n i c, v a l v e i s n o t w e l l s e e n, b u t i s g r o s s l y n o r m a l. T h e r e i s no p u l m o n i c v a l v u l a r r e g u r g i t a t i o n. P e r i c a r d i u m. / P1 e u r a 1 T h e r e i s no p e r i c a r d i a l e f f u s i o n. Page 4 of 8
5 ECHOCARDIOGRAPH [ ] (continued) MMODE 2D MEASUREMENTS & CALCULATIONS RVDD IVSD IVSS LVIDD LVIDS LVPWD LVPWS EF (EST.) MV EXCURSION MV E-F SLOPE AO ROOT DIAM ACS LA DIMENSION LVLS AP4 DOPPLER MEASUREMENTS & CALCULATIONS MVV2 MAX MV MAXPG MV V2 MEAN MV MEAN PG MV V2 VTI AO V2 MAX AO MAX PG AO V2 MEAN AO MEAN PG AO V2 VTI TV V2 MAX TV MAX PG TV V2 MEAN TV MEAN PG PA V2 MAX PA MAX PG PA V2 MEAN PA MEAN PG PA V2 VTI TR MAX VEL TR MAX PG RVSP RAP SYSTOLE INTERPRETING PHYSICIAN Resulted: 09/18/ , Result Status: Final MMode 2D Measurements & Calculations 3.0 cm 0.89 cm 1.2 cm 4.9 cm 3.5 cm 0.93 cm 1.6 cm 56 % 2.5 cm 20 cm/sec 2.8 cm 1.8 cm 2.9 cm 6.2 cm Doppler Measurements & Calculations 67 cm/sec 1.8 mmhg 45 cm/sec 0.90 mmhg 12 cm 93 cm/sec 3.5 mmhg 63 cm/sec 1.8 mmhg 15 cm 89 cm/sec 3.2 mmhg 45 cm/sec 0.95 mmhg 69 cm/sec 1.9 mmhg 51 cm/sec 1.2 mmhg 18 cm 221 cm/sec 20 mmhg 25 mmhg 5.0 mmhg I n t e r p r e t i n g P h y s i c i a n : James W a s e n m i l l e r, e l e c t r o n i c a l l y s i g n e d on :44:37 Procedure Notes Page 5 of 8
6 Consult Notes MRN: CSN: Initial Assessment Notes H&P Summary Notes Discharge Summary Notes ER RECORDS ED Arrival Information Patient not seen in ED Diagnoses.DysjDhagia, ^sogha^eam^/sn^^ Obstruction esophagus ED Disposition None ED Notes Clinical Lab Results Lab Results No matching s found Resulted: 05/19/ , Result Status: Final Resultedby: Farthing. David G., MD Performed: 05/19/ /19/ Resulting Lab: EPIC RADIANT Specimen: 05/19/11 Narrative: ESOPHAGRAM (Fluoroscopy time: 0 min. 36 sec. Room: 1) HISTORY: Dysphagia. FINDINGS: With the oral ingestion of contrast, the esophagus was examined. There is normal antegrade peristalsis. There is suggestion of a minimal sliding-type hiatal hernia. No reflux was elicited. 13 mm Page 6 of 8
7 MRN: CSN: (continued) Resulted: 05/19/ , Result Status: Final pressed barium tablet passes normally down the esophagus. The fluoroscopic procedure was performed by Kevin Hutchins, RPA under direct supervision. Impression: IMPRESSION: Suggestion of a potential minimal sliding-type hiatal hernia but no reflux was seen. No other abnormalities are identified. Reading Dr.: Farthing, M.D., David G This report has been electronically signed by: Farthing, M.D., David G Resulted: 05/19/ , Result Status: Resultedby: Farthing, David G., MD Performed: Resulting Lab: EPIC RADIANT Specimen: Narrative: ESOPHAGRAM (Fluoroscopy time: 0 min. 36 sec. Room: 1) HISTORY: Dysphagia. FINDINGS: With the oral ingestion of contrast, the esophagus was examined. There is normal antegrade peristalsis. There is suggestion of a minimal sliding-type hiatal hernia. No reflux was elicited. 13 mm pressed barium tablet passes normally down the esophagus. 05/19/ /19/ /19/11 Preliminary Impression: IMPRESSION: Suggestion of a potential minimal slidmg-type hiatal hernia but no reflux was seen. No other abnormalities are identified. Reading Dr.: Farthing, M.D., David G Resulted: 05/19/ , Result Status: In Resulted by: Farthing, David G., ID Resulting Lab: EPIC RADIANT Resulted by: Farthing, David G., MD Specimen: 05/19/11 Performed: Specimen: 05/19/ /19/ /19/11 process Result Status: In process Performed: 05/19/ /19/ Testing Performed By Lab - Abbreviation Name Director Address Valid Date Range 54 - Unknown EPIC RADIANT Unknown Unknown 03/11/ Present Order Status: Completed Performed: 05/19/ /19/ Specimen: 05/19/11 [ ] Narrative: ESOPHAGRAM (Fluoroscopy time: 0 min. 36 sec. Room: 1 HISTORY: Dysphagia. Resulted: 05/19/ , Result Status: Final Resulted by: Resulting Lab: Farthing, David G., MD EPIC RADIANT Page 7 of 8
8 MRN: CSN: (continued) Resulted: 05/19/ , Result Status: Final FINDINGS: With the oral ingestion of contrast, the esophagus was examined. There is normal antegrade peristalsis. There is suggestion of a minimal sliding-type hiatal hernia. No reflux was elicited. 13 mm pressed barium tablet passes normally down the esophagus. The fluoroscopic procedure was performed by Kevin Hutchins, RPA under direct supervision. Impression: IMPRESSION: Suggestion of a potential minimal sliding-type hiatal hernia but no reflux was seen. No other abnormalities are identified. Reading Dr.: Farthing, M.D., David G This report has been electronically signed by: Farthing, M.D., David G Page 8 of 8
Test Date Job Number Referring Site
hr Holter Analysis ECG On-Demand Black Barn, Cornwells Farm Sheephurst Lane, Marden Kent T S Details Patient ame Patient umber Patient D.O.B. Jane Smith // ( Years) Test Date Job umber Referring Site //
More informationTechnical Publications. Vivid i / Vivid q. Reference Manual. GE Medical Systems. GEMS #: Rev. 02
GE Medical Systems Technical Publications Vivid i / Vivid q Reference Manual GEMS #: 2-1 Rev. 2 Copyright 211 By General Electric Co. Reference Documentation Regulatory Requirements This product complies
More informationSystems Models of the Circula4on BENG 230C Lecture 2
Systems Models of the Circula4on BENG 230C Lecture 2 Why modeling Enhance insight in physiology Hypothesis genera5on Clinical applica5ons diagnosis training pla7orms for surgeons predict outcomes of surgical
More informationBIOE 110: Biomedical Physiology for Engineers Spring 2013 Midterm I Solutions Key
BIOE 110: Biomedical Physiology for Engineers Spring 2013 Midterm I Solutions Key QUESTION 1 Consider a chamber (at 25 C) consisting of two 1L solutions of mannose (MW 180 g/mol) separated by a semipermeable
More informationParameter Identification Methods in a Model of the Cardiovascular System
Parameter Identification Methods in a Model of the Cardiovascular System Antoine Pironet Thomas Desaive Pierre C. Dauby J. Geoffrey Chase Paul D. Docherty GIGA-Cardiovascular Sciences, University of Liège,
More informationBasic mechanisms of arrhythmogenesis and antiarrhythmia
EHRA EDUCATIONAL REVIEW AND PREPARATORY COURSE ON INVASIVE CARDIAC ELECTROPHYSIOLOGY EUROPEAN HEART HOUSE, February 2011 Basic mechanisms of arrhythmogenesis and antiarrhythmia Antonio Zaza Università
More informationDetermination of pressure data in aortic valves
Determination of pressure data in aortic valves Helena Švihlová a, Jaroslav Hron a, Josef Málek a, K.R.Rajagopal b and Keshava Rajagopal c a, Mathematical Institute, Charles University, Czech Republic
More informationCairns Hospital: Suspected Acute Coronary Syndrome Pathways. DO NOT USE if a non cardiac cause for the chest pain can be diagnosed
Cairns Hospital: Suspected Acute Coronary Syndrome Pathways DO NOT USE if a non cardiac cause for the chest pain can be diagnosed Clinical pathways never replace clinical judgement. Care outlined on this
More informationMathematical Modelling of the Cardiovascular System Haemodynamics
Mathematical Modelling of the Cardiovascular System Haemodynamics Anabel Hernández-Ramírez 1 Andrés Fraguela-Collar 1 Rafael Lemuz-López 2 1 Benemérita Universidad Autónoma de Puebla Physical and Mathematical
More informationNOVEL TECHNIQUES FOR CARDIAC ARRHYTHMIA DETECTION
NOVEL TECHNIQUES FOR CARDIAC ARRHYTHMIA DETECTION By Eng. Mohamed Ibrahim Ismail Owis Systems and Biomedical Engineering Department Faculty of Engineering, Cairo University A Thesis Submitted to the Faculty
More informationCARDIAC METASTASIS MASQUERADE AS STEMI D R S R E E K A N T H K O D U R
CARDIAC METASTASIS MASQUERADE AS STEMI D R S R E E K A N T H K O D U R MR OR, 68 YRS Smoker No prior cardiac hx Lives near Muswellbrook area Called ambulance 3 am Atypical chest pain Life net ecg transmitted
More informationNumerical methods for cardiovascular problems: computational electrocardiology and fluid dynamics in moving domains
POLITECNICO DI MILANO Dipartimento di Matematica F. Brioschi Ph. D. course in Mathematical Engineering XXII cycle Numerical methods for cardiovascular problems: computational electrocardiology and fluid
More informationNoninvasive Estimation of Pulmonary Artery Pressure Using Heart Sound Analysis
Brigham Young University BYU ScholarsArchive All Theses and Dissertations 009-1-07 Noninvasive Estimation of Pulmonary Artery Pressure Using Heart Sound Analysis Aaron W. Dennis Brigham Young University
More informationHarmonic Regression in the Biological Setting. Michael Gaffney, Ph.D., Pfizer Inc
Harmonic Regression in the Biological Setting Michael Gaffney, Ph.D., Pfizer Inc Two primary aims of harmonic regression 1. To describe the timing (phase) or degree of the diurnal variation (amplitude)
More information10 0 = 1 1 second. Chapter 1
Chapter 1 10 0 = 1 1 second The word second is derived from the Latin word secundus or gradus secundus, which means second step or next step. The Romans divided the daylight time into 12 hours. As a further
More informationGLR-Entropy Model for ECG Arrhythmia Detection
, pp.363-370 http://dx.doi.org/0.4257/ijca.204.7.2.32 GLR-Entropy Model for ECG Arrhythmia Detection M. Ali Majidi and H. SadoghiYazdi,2 Department of Computer Engineering, Ferdowsi University of Mashhad,
More informationSimulating ventricular elastance with a heart-arterial interaction model
Simulating ventricular elastance with a heart-arterial interaction model Anita Gerstenmayer 1, Bernhard Hametner 2, Stephanie Parragh 1,2, Thomas Weber 3, Siegfried Wassertheurer 2 1 Department for Analysis
More informationPulsatile Aortic Pressure-Flow Analysis using Fractional Calculus for Minimally-invasive Applications
Avestia Publishing Journal of Biomedical Engineering and Biosciences Volume, Year 204 ISSN: TBD DOI: TBD Pulsatile Aortic Pressure-Flow Analysis using Fractional Calculus for Minimally-invasive Applications
More information= (, ) V λ (1) λ λ ( + + ) P = [ ( ), (1)] ( ) ( ) = ( ) ( ) ( 0 ) ( 0 ) = ( 0 ) ( 0 ) 0 ( 0 ) ( ( 0 )) ( ( 0 )) = ( ( 0 )) ( ( 0 )) ( + ( 0 )) ( + ( 0 )) = ( + ( 0 )) ( ( 0 )) P V V V V V P V P V V V
More informationBENG 186B Winter 2014 Quiz 3. March 5, NAME (Last, First): This quiz is closed book and closed notes. You may use a calculator for algebra.
BENG 186B Winter 2014 Quiz 3 March 5, 2014 NAME (Last, First): This quiz is closed book and closed notes. You may use a calculator for algebra. Circle your final answers in the space provided; show your
More informationEGD (Upper Endoscopy)
Gastroenterology EGD (Upper Endoscopy) REMINDER FOR: ON THE DAY OF YOUR PROCEDURE Bring a list of all your medications (over-the-counter and prescription) You must have a driver to take you home following
More informationÊ 7, 45 Ê 7 Ë 7 Ë. Time: 100 minutes. Name: Class: Date:
Class: Date: Time: 100 minutes Test1 (100 Trigonometry) Instructor: Koshal Dahal SHOW ALL WORK, EVEN FOR MULTIPLE CHOICE QUESTIONS, TO RECEIVE FULL CREDIT. 1. Find the terminal point P (x, y) on the unit
More informationMASSACHUSETTS INSTITUTE OF TECHNOLOGY
Harvard-MIT Division of Health Sciences and Technology HST.54J: Quantitative Physiology: Organ Transport Systems Instructors: Roger Mark and Jose Venegas MASSACHUSETTS INSTITUTE OF TECHNOLOGY Departments
More information8/2/2012. Outline. Dr M. Mahesh MS, PhD, FAAPM, FACR, FACMP, FSCCT. Fluoroscopy Training and Compliance Experience of a Large Academic Institution
Fluoroscopy Training and Compliance Experience of a Large Academic Institution Mahadevappa Mahesh, MS, PhD, FAAPM, FACR, FACMP, FSCCT. Associate Professor of Radiology and Cardiology School of Medicine
More informationBayesian Networks for Cardiovascular Monitoring
Proceedings of the 8th IEEE EMBS Annual International Conference New York City, USA, Aug 3-Sept 3, 6 WeC5.3 Bayesian Networks for Cardiovascular Monitoring Jennifer M. Roberts, ushar A. Parlikar, homas
More informationPrediction of Paroxysmal Atrial Fibrillation (PAF) Onset through Analysis of Inter-beat Intervals (IBI)
Prediction of Paroxysmal Atrial Fibrillation (PAF) Onset through Analysis of Inter-beat Intervals (IBI) By Charles Q. Du Submitted to the Department of Electrical Engineering and Computer Science In Partial
More informationNACC Uniform Data Set (UDS) FTLD Module
NACC Uniform Data Set (UDS) FTLD Module Data Template For Initial Visit Packet Version 2.0, January 2012 Copyright 2013 University of Washington Created and published by the FTLD work group of the ADC
More informationESTIMATION AND IDENTIFICATION OF PARAMETERS IN A LUMPED CEREBROVASCULAR MODEL
MATHEMATICAL BIOSCIENCES doi:10.3934/mbe.2009.6.93 AND ENGINEERING Volume 6, Number 1, January 2009 pp. 93 115 ESTIMATION AND IDENTIFICATION OF PARAMETERS IN A LUMPED CEREBROVASCULAR MODEL Scott R. Pope
More informationAssessing Catheter Contact in Radiofrequency Cardiac Ablation Using Complex Impedance
Assessing Catheter Contact in Radiofrequency Cardiac Ablation Using Complex Impedance Neal P. Gallagher a, Israel J. Byrd b, Elise C. Fear a, Edward J. Vigmond a a Dept. Electrical and Computer Engineering,
More informationNACC Uniform Data Set (UDS) FTLD Module
NACC Uniform Data Set (UDS) FTLD Module Data Template For FOLLOW-UP Visit Packet Version 2.0, January 2012 Copyright 2013 University of Washington Created and published by the FTLD work group of the ADC
More informationPUBLISHED VERSION PERMISSIONS.
PUBLISHED VERSION Zebrowski, J. J.; Grudzinski, K.; Buchner, T.; Kuklik, Pawel; Gac, J.; Gielerak, G.; Sanders, Prashanthan; Baranowski, R. Nonlinear oscillator model reproducing various phenomena in the
More informationTAC1 TAC4 TAC7 TAC14 TAC21
Table S1 Gene qrt-pcr primer sequence Amplification efficiency α-sma (FW) 5 - GCCAGTCGCTGTCAGGAACCC -3 (RV) 5 - AGCCGGCCTAGAGCCCA -3 Procollagen-I (FW) 5 - AAGACGGGAGGGCGAGTGCT -3 (RV) 5 - AACGGGTCCCCTTGGGCCTT
More informationDecision Trees Lecture 12
Decision Trees Lecture 12 David Sontag New York University Slides adapted from Luke Zettlemoyer, Carlos Guestrin, and Andrew Moore Machine Learning in the ER Physician documentation Triage Information
More informationLocalizing Cardiac Structures in Fetal Heart Ultrasound Video
Localizing Cardiac Structures in Fetal Heart Ultrasound Video Christopher P. Bridge 1, Christos Ioannou 2, and J. Alison Noble 1 1 Institute of Biomedical Engineering, University of Oford, Oford, UK, 2
More informationChapter 17. Current and Resistance
Chapter 17 Current and Resistance Electric Current The current is the rate at which the charge flows through a surface Look at the charges flowing perpendicularly through a surface of area A I av The SI
More informationComplex temporal patterns of spontaneous initiation and termination of reentry in a loop of cardiac tissue
University of Richmond UR Scholarship Repository Math and Computer Science Faculty Publications Math and Computer Science 2008 Complex temporal patterns of spontaneous initiation and termination of reentry
More informationStructural Identifiability Analysis of a Cardiovascular System Model
Preprints of the 19th World Congress The International Federation of Automatic Control Structural Identifiability Analysis of a Cardio System Model Antoine Pironet Pierre C. Dauby J. Geoffrey Chase James
More informationChapter 17 Current and Resistance
Chapter 17 Current and Resistance Current Practical applications were based on static electricity. A steady source of electric current allowed scientists to learn how to control the flow of electric charges
More informationSynthesising robust and optimal parameters for cardiac pacemakers using symbolic and evolutionary computation techniques
Synthesising robust and optimal parameters for cardiac pacemakers using symbolic and evolutionary computation techniques Marta Kwiatkowska 1, Alexandru Mereacre 1, Nicola Paoletti 1, and Andrea Patanè
More informationModelling Heart Rate Variability
Modelling Heart Rate Variability P. Laguna and L. Sörnmo Introduction The study of heart rate variability (HRV) has become increasingly popular because information on the state of the autonomic nervous
More informationTIETZ FUNDAMENTALS OF CLINICAL CHEMISTRY PDF
TIETZ FUNDAMENTALS OF CLINICAL CHEMISTRY PDF ==> Download: TIETZ FUNDAMENTALS OF CLINICAL CHEMISTRY PDF TIETZ FUNDAMENTALS OF CLINICAL CHEMISTRY PDF - Are you searching for Tietz Fundamentals Of Clinical
More informationHeat Transfer F12-ENG Lab #4 Forced convection School of Engineering, UC Merced.
1 Heat Transfer F12-ENG-135 - Lab #4 Forced convection School of Engineering, UC Merced. October 23, 2012 1 General purpose of the Laboratory To gain a physical understanding of the behavior of the average
More informationThe Severe Weather Event of 7 August 2013 By Richard H. Grumm and Bruce Budd National Weather Service State College, PA 1. INTRODUCTION and Overview
The Severe Weather Event of 7 August 2013 By Richard H. Grumm and Bruce Budd National Weather Service State College, PA 1. INTRODUCTION and Overview A fast moving short-wave (Fig. 1) with -1σ 500 hpa height
More informationMathematical physiology. 1.1 Derive a suitably scaled form of the Michaelis-Menten model for the reaction E + P,, λ = k 2
Problem sheet 1. 1.1 Derive a suitably scaled form of the Michaelis-Menten model for the reaction S + E and show that it depends on the parameters k 1 k 1 C k 2 E + P K = k 1 + k 2 k 1 S 0 λ = k 2 k 1
More informationROLE OF BIDOMAIN MODEL OF CARDIAC TISSUE IN THE DYNAMICS OF PHASE SINGULARITIES
ROLE OF BIDOMAIN MODEL OF CARDIAC TISSUE IN THE DYNAMICS OF PHASE SINGULARITIES Jianfeng Lv Submitted to the faculty of the University Graduate School in partial fulfillment of the requirement for the
More informationVelocity Images. Phase Contrast Technique. G. Reiter 1,2, U. Reiter 1, R. Rienmüller 1
Velocity Images - the MR Phase Contrast Technique G. Reiter 1,2, U. Reiter 1, R. Rienmüller 1 SSIP 2004 12 th Summer School in Image Processing, Graz, Austria 1 Interdisciplinary Cardiac Imaging Center,
More informationVersion 3.0, March 2015
NACC UNIFORM data set FTLD MODULE Data Template for IVP Version 3.0, March 2015 Copyright 2013, 2015 University of Washington. Created and published by the FTLD work group of the ADC Program (David Knopman,
More informationA Preliminary Fractional Calculus Model of the Aortic Pressure Flow Relationship during Systole
Proceedings of the International Conference on Biomedical Engineering and Systems Prague, Czech Republic, August 14-15, 2014 Paper No. 34 A Preliminary Fractional Calculus Model of the Aortic Pressure
More informationPROBLEM SET 3. SOLUTIONS February 26, 2004
Harvard-MIT Division of Health Sciences and Technology HST.542J: Quantitative Physiology: Organ Transport Systems Instructors: Roger Mark and Jose Venegas MASSACHUSETTS INSTITUTE OF TECHNOLOGY Departments
More informationExploration, Processing and Visualization of Physiological Signals from the ICU
Exploration, Processing and Visualization of Physiological Signals from the ICU By Carlos A. Renjifo Submitted to the Department of Electrical Engineering and Computer Science in Partial Fulfillment of
More informationCHAPTER 3 FEATURE EXTRACTION USING GENETIC ALGORITHM BASED PRINCIPAL COMPONENT ANALYSIS
46 CHAPTER 3 FEATURE EXTRACTION USING GENETIC ALGORITHM BASED PRINCIPAL COMPONENT ANALYSIS 3.1 INTRODUCTION Cardiac beat classification is a key process in the detection of myocardial ischemic episodes
More informationBiomechanics. Soft Tissue Biomechanics
Biomechanics cross-bridges 3-D myocardium ventricles circulation Image Research Machines plc R* off k n k b Ca 2+ 0 R off Ca 2+ * k on R* on g f Ca 2+ R0 on Ca 2+ g Ca 2+ A* 1 A0 1 Ca 2+ Myofilament kinetic
More informationHow do nerve cells behave? At
Excitable Media: The Belousov-Zhabotinsky Chemical Reaction and the Heart Harold M. Hastings Professor and Chairperson Department of Physics Figure 2. Simulated cardiac dynamics by Flavio Fenton and Elizabeth
More informationHeart rate control and variability
Heart rate control and variability Na (Lina) Li (CDS13 ) EE @ SEAS Harvard University CDS @ 20 The persistent mystery Young, fit, healthy more extreme Resting Heart Rate (bpm) 60 0 50 100 150 200 250 300
More informationMulticompartment Pharmacokinetic Models. Objectives. Multicompartment Models. 26 July Chapter 30 1
Multicompartment Pharmacokinetic Models Objectives To draw schemes and write differential equations for multicompartment models To recognize and use integrated equations to calculate dosage regimens To
More informationCalibration Verification Linearity in the Clinical Lab. Did I Pass or Fail? 2017 ASCLS New Jersey
Calibration Verification Linearity in the Clinical Lab. Did I Pass or Fail? 2017 ASCLS New Jersey Presentation Topics & Objectives Calibration Verification Key Definitions Why do I need to perform CV?
More informationOverture: Why is Physiologic Variability Important?
Welcome! HRV 2006: April, 2006 Overture: Why is Physiologic Variability Important? Ary L. Goldberger, MD Director, Margret and H.A. Rey Institute for Nonlinear Dynamics in Medicine Beth Israel Deaconess
More informationSwine Enteric Coronavirus Disease (SECD) Situation Report June 30, 2016
Animal and Plant Health Inspection Service Veterinary Services Swine Enteric Coronavirus Disease (SECD) Situation Report June 30, 2016 Information current as of 12:00 pm MDT, 06/29/2016 This report provides
More informationSwine Enteric Coronavirus Disease (SECD) Situation Report Sept 17, 2015
Animal and Plant Health Inspection Service Veterinary Services Swine Enteric Coronavirus Disease (SECD) Situation Report Sept 17, 2015 Information current as of 12:00 pm MDT, 09/16/2015 This report provides
More informationSection 9.5. Testing the Difference Between Two Variances. Bluman, Chapter 9 1
Section 9.5 Testing the Difference Between Two Variances Bluman, Chapter 9 1 This the last day the class meets before spring break starts. Please make sure to be present for the test or make appropriate
More information7, 48 7, 6 7, 45. Name: Class: Date: Multiple Choice Questions
Class: Date: Practice Test (00 Trigonometry) Instructor: Koshal Dahal Multiple Choice Questions SHOWALLWORK,EVENFORMULTIPLECHOICEQUESTIONS,TORECEIVECREDIT.. Find the terminal point P (x, y) on the unit
More informationRecovery dynamics of the Fenton-Karma membrane model and their implications for modeling pharmacologically-induced atrial fibrillation
Recovery dynamics of the Fenton-Karma membrane model and their implications for modeling pharmacologically-induced atrial fibrillation Matt Gonzales Department of Bioengineering University of California,
More informationClosed-loop Verification of Medical Devices With Model Abstraction and Refinement
University of Pennsylvania ScholarlyCommons Real-Time and Embedded Systems Lab (mlab) School of Engineering and Applied Science 9-11-2013 Closed-loop Verification of Medical Devices With Model Abstraction
More informationThe Probability of Pathogenicity in Clinical Genetic Testing: A Solution for the Variant of Uncertain Significance
The Probability of Pathogenicity in Clinical Genetic Testing: A Solution for the Variant of Uncertain Significance 1 Introduction by (in alphabetical order) Michael Gollob, Jeffrey S. Rosenthal, and Kevin
More informationCONDITIONAL JOINT TRANSFER ENTROPY OF CARDIOVASCULAR AND CEREBROVASCULAR CONTROL SYSTEMS IN SUBJECTS PRONE TO POSTURAL SYNCOPE
CONDITIONAL JOINT TRANSFER ENTROPY OF CARDIOVASCULAR AND CEREBROVASCULAR CONTROL SYSTEMS IN SUBJECTS PRONE TO POSTURAL SYNCOPE Vlasta Bari 1, Andrea Marchi 2,3, Beatrice De Maria 2,4, Gianluca Rossato
More informationIMPACT Improving Massachusetts Post-Acute Care Transfers
IMPACT Improving Massachusetts Post-Acute Care Transfers New England Home Care Conference May 31 st, 2012 Larry Garber, MD Medical Director for Informatics Reliant Medical Group Agenda IMPACT project overview
More informationSZILÁGYI Sándor Miklós
SZILÁGYI Sándor Miklós Producția ştiințifică TOTAL PUNCTE 9, Categoria A,00 Categoria B,00 Categoria C, Lucrări categoria A + (/) + (/) + (/) = puncte curent A.0. A.0. A.0. A.0. A.0. A.0. A.07. Lucrare
More informationSchool of Science, Medicine & Health Michael J Macartney. Supervised By: Dr Gregory Peoples Prof Peter McLennan Mr Marc Brown
School of Science, Medicine & Health 2013 Michael J Macartney Supervised By: Dr Gregory Peoples Prof Peter McLennan Mr Marc Brown The Cardiac Branch The Vascular Branch Blood Pressure = CVD & all-cause
More informationThe Probability of Pathogenicity in Clinical Genetic Testing: A Solution for the Variant of Uncertain Significance
International Journal of Statistics and Probability; Vol. 5, No. 4; July 2016 ISSN 1927-7032 E-ISSN 1927-7040 Published by Canadian Center of Science and Education The Probability of Pathogenicity in Clinical
More informationSystem Modelling using Event-B
System Modelling using Event-B Neeraj Kumar Singh McMaster Centre for Software Certification March 25, 2014 Neeraj Kumar Singh (McMaster University) Modelling in Event-B March 25, 2014 1 / 34 Outline 1
More informationANGULAR ERROR IN ULTRASOUND DOPPLER TISSUE VELOCITIES AND ITS IFLUENCE ON THE DERIVED VARIABLE PEAK SYSTOLIC STRAIN
ANGULAR ERROR IN ULTRASOUND DOPPLER TISSUE VELOCITIES AND ITS IFLUENCE ON THE DERIVED VARIABLE PEAK SYSTOLIC STRAIN 1of Camilla Storaa 1, Lars-Åke Brodin, Britta Lind 1 Division of Medical Engineering,
More informationTechnical Report: Abstraction-Tree For Closedloop Model Checking of Medical Devices
University of Pennsylvania ScholarlyCommons Real-Time and Embedded Systems Lab (mlab) School of Engineering and Applied Science 5-6-2015 Technical Report: Abstraction-Tree For Closedloop Model Checking
More informationECG Noise Filtering Using Online Model-Based Bayesian Filtering Techniques
ECG Noise Filtering Using Online Model-Based Bayesian Filtering Techniques by Aron Su A thesis presented to the University of Waterloo in fulfillment of the thesis requirement for the degree of Master
More informationAtmosphere CHANGE IS IN THE AIR
Activity 8 UVs and Frisbees Atmosphere CHANGE IS IN THE AIR Forces of Change» Atmosphere» Activity 8» Page 1 UVs and Frisbees Overview This experiment will help students understand that ultraviolet radiation
More informationENGG Fundamentals of Electrical Circuits and Machines Final Examination
Name: Lecture Section: ID#: ENGG 225 - Fundamentals of Electrical Circuits and Machines Final Examination Monday, April 22, 2013 Time: 12:00-3:00 PM Red and Gold Gymnasium L01 - Anis Haque L02 - Norm Bartley
More informationUSDA NRCS Soil Survey
USDA NRCS Soil Survey Thomas Reinsch National Leader World Soil Resources Slide 1 Slide 2 National Cooperative Soil Survey Congress Has Directed The Secretary Of Agriculture To: 1899-2011 Inventory Soils
More informationClassifying Mechanisms of Spiral Wave Breakup Underlying Cardiac Fibrillation Using Quantitative Metrics
Rochester Institute of Technology RIT Scholar Works Theses Thesis/Dissertation Collections 8--04 Classifying Mechanisms of Spiral Wave Breakup Underlying Cardiac Fibrillation Using Quantitative Metrics
More informationReceding horizon controller for the baroreceptor loop in a model for the cardiovascular system
SpezialForschungsBereich F 32 Karl Franzens Universität Graz Technische Universität Graz Medizinische Universität Graz Receding horizon controller for the baroreceptor loop in a model for the cardiovascular
More informationApplied Physics Topics 1. Dr Andrey Varvinskiy Consultant Anaesthetist Torbay Hospital, UK EDAIC Paper B Lead and Examiner
Applied Physics Topics 1 Dr Andrey Varvinskiy Consultant Anaesthetist Torbay Hospital, UK EDAIC Paper B Lead and Examiner Conflict of interest declaration WHAT DECLARATION Grants/research support/p.i.
More informationDaily Operations Briefing Wednesday, February 10, :30 a.m. EST
Daily Operations Briefing Wednesday, February 10, 2016 8:30 a.m. EST Significant Activity: February 9-10 Significant Events: None Significant Weather: Snow Northern Plains to Upper/Middle Mississippi valleys,
More informationIsotope Analysis XRF XRD Source Rock Pyrolysis SEM Paraffin Reducers
Final XRF Report For SUMMARY -- PILOT WELL -- WBM/CURVE -- DATA-OBM/LATERAL DATA -- CALIBRATION LOGS TOC-est PLOTS -- RATIO PLOTS -- TH/K PLOTS 1 P a g e 2 P a g e Isotope Analysis XRF XRD Source Rock
More informationDynamic Control of a Tandem Queueing System with Abandonments
Dynamic Control of a Tandem Queueing System with Abandonments Gabriel Zayas-Cabán 1 Jungui Xie 2 Linda V. Green 3 Mark E. Lewis 1 1 Cornell University Ithaca, NY 2 University of Science and Technology
More informationYOUR HW MUST BE STAPLED YOU MUST USE A PENCIL (no pens)
Spring 2008 CIVE 462 HOMEWORK #1 1. Print out the syllabus. Read it. Write the grade percentages in the first page of your notes. 2. Go back to your 301 notes, internet, etc. and find the engineering definition
More informationDetection of Heart Rate Turbulence Using an Extended IPFM Model
Detection of Heart Rate Turbulence Using an Extended IPFM Model Solem, Kristian; Laguna, Pablo; Sörnmo, Leif Published in: [Host publication title missing] Published: 26-1-1 Link to publication Citation
More informationThe National Lung Health Education Program. Spirometric Reference Values for the 6-s FVC Maneuver*
Spirometric Reference Values for the 6-s FVC Maneuver* John L. Hankinson, PhD; Robert O. Crapo, MD, FCCP; and Robert L. Jensen, PhD Study objectives: The guidelines of the National Lung Health Education
More informationDaily Operations Briefing Friday, January 22, :30 a.m. EST
Daily Operations Briefing Friday, January 22, 2016 8:30 a.m. EST Significant Activity: Jan 21-22 Significant Events: Winter Storm Eastern U.S. Significant Weather: Heavy snow possible Cascades and Sierras;
More informationcobas 6000 analyzer series Flexibility you can build on
cobas 6000 analyzer series Flexibility you can build on cobas 6000 analyzer series Flexibility you can build on Many of today s laboratories are challenged with delivering high standards of laboratory
More informationParametric Functions and Vector Functions (BC Only)
Parametric Functions and Vector Functions (BC Only) Parametric Functions Parametric functions are another way of viewing functions. This time, the values of x and y are both dependent on another independent
More informationEast West Acupuncture & Wellness Center, Inc. Patient Intake Form
East West Acupuncture & Wellness Center, Inc. Patient Intake Form Date: / / How did you hear about us? ( )Ad ( ) Healthcare Referral ( ) Friend/Family Whom may we thank for the referral? Name DOB / / Age
More informationpolycardiographic measurements1
British Heart J7ournal, 1978, 40, 1344-1348 Effects of recording speed on precision of time-based polycardiographic measurements1 Optimal paper speeds for measuring points and intervals DAVID H. SPODICK,
More informationERYTHROBLASTOSIS FETALIS WITHOUT AN OBVIOUS CAUSE Case Study by Jim Perkins, MD ( 2010)
ERYTHROBLASTOSIS FETALIS WITHOUT AN OBVIOUS CAUSE Case Study by Jim Perkins, MD ( 2010) A 31 year old pregnant woman at 41 weeks, 2 days gestation was admitted to the hospital for induction of labor because
More informationSimple Harmonic Motion Concept Questions
Simple Harmonic Motion Concept Questions Question 1 Which of the following functions x(t) has a second derivative which is proportional to the negative of the function d x! " x? dt 1 1. x( t ) = at. x(
More informationWednesday, November 7, :30 a.m. EST
Wednesday, November 7, 2018 8:30 a.m. EST Significant Activity Nov 6-7 Significant Events: Tropical Cyclone Yutu Recovery Tropical Activity: Atlantic No new tropical cyclones are expected during the next
More informationNONLINEAR DYNAMICS AND CHAOS. Facilitating medical diagnosis. Medical classifications
LECTURE : BIOMEDICAL MODELS NONLINEAR DYNAMICS AND CHAOS Patrick E McSharry Systems Analysis, Modelling & Prediction Group www.eng.ox.ac.uk/samp patrick@mcsharry.net Tel: +44 2 823 74 Medical diagnostics
More informationFLUVIA NAUTIC DATASET (16 March 2007) Description of the sensor logs
FLUVIA NAUTIC DATASET (16 March 2007) Description of the sensor logs David Ribas, PhD Student. Underwater Robotics Lab, Computer Vision and Robotics Group, University of Girona Doppler Velocity Log (Argonaut
More informationAnalysis Of The Second Cardiac Sound Using The Fast Fourier And The Continuous Wavelet Transforms
ISPUB.COM The Internet Journal of Medical Technology Volume 3 Number 1 Analysis Of The Second Cardiac Sound Using The Fast Fourier And The Continuous Wavelet Transforms S Debbal, F Bereksi-Reguig Citation
More informationSupervised Learning! Algorithm Implementations! Inferring Rudimentary Rules and Decision Trees!
Supervised Learning! Algorithm Implementations! Inferring Rudimentary Rules and Decision Trees! Summary! Input Knowledge representation! Preparing data for learning! Input: Concept, Instances, Attributes"
More informationDaily Operations Briefing Thursday, December 25, :30 a.m. EST
Daily Operations Briefing Thursday, December 25, 2014 8:30 a.m. EST Significant Activity: Dec 24 25 Significant Events: Severe Weather Southeast (Dec 23 24) Significant Weather: Heavy snow: Intermountain
More informationFatigue Problems Solution
Fatigue Problems Solution Problem 1. (a) Given the values of σ m (7 MPa) and σ a (1 MPa) we are asked t o compute σ max and σ min. From Equation 1 Or, σ m σ max + σ min 7 MPa σ max + σ min 14 MPa Furthermore,
More informationToday s Discussion: Fluids Pressure and Pascal s principle Bouyancy, Archimedes principle Bernoulli s equation
1 Physics 213 Waves, Fluids and Thermal Physics Summer 2007 Lecturer: Mike Kagan (mak411@psu.edu, 322 Whitmore) Today s Discussion: Fluids Pressure and Pascal s principle Bouyancy, Archimedes principle
More information