Functional genomics. But in principle we already know the secret of life. The secret of life?
|
|
- Cecil Baker
- 6 years ago
- Views:
Transcription
1 Functional genomics Dr. Sydney Brenner: In late 1962, Francis Crick and I began a long series of conversations about the next steps to be taken in our research. Both of us felt very strongly that most of the classical problems of molecular biology had been solved and that the future lay in tackling more complex biological problems. I remember that we decided against working on animal viruses, on the structure of ribosomes, on membranes, and other similar trivial problems in molecular biology. I had come to believe that most of molecular biology had become inevitable and that, as I put it in a draft paper, "we must move on to other problems of biology which are new, mysterious and exciting. Broadly speaking, the fields which we should now enter are development and the nervous system." Jacques Monod (1970): The secret of life? But in principle we already know the secret of life. Horace Judson The Eighth Day of Creation The species with the smallest genome size in this class is Mycoplasma genitalium (580 kb), which was originally isolated from urethral specimens of patients with non-gonoccocal urethritis and has since been shown to exist in parasitic association with ciliated epithelial cells of primate genital and respiratory tracts. Mycoplasmas are of interest because they are believed to represent a minimal life form, having yielded to selective pressure to reduce genome size
2 The minimal gene complement of Mycoplasma genitalium. Fraser CM, Gocayne JD, White O, Adams MD, Clayton RA, Fleischmann RD, Bult CJ, Kerlavage AR, Sutton G, Kelley JM, et al. Institute for Genomic Research, Rockville, MD 20850, USA. The complete nucleotide sequence (580,070 base pairs) of the Mycoplasma genitalium genome, the smallest known genome of any freeliving organism, has been determined by whole-genome random sequencing and assembly. A total of only 470 predicted coding regions were identified that include genes required for DNA replication, transcription and translation, DNA repair, cellular transport, and energy metabolism. Science, Mysterious yeast How does life work? How does the genome work? Sequence of genome answer Problem: very many genes of unknown function: In human, at least 12,000 (30%). In mouse, < 5,000 have experimentally defined function. Brave new world Classical genetics gene-by-gene, circuitby-circuit. Functional genomics massively parallel (=many at once) analysis of gene function by a combination of reverse genetics and other things
3 Northern gene-by-gene measurement of mrna levels Massively parallel Northern: genome-wide expression profiling 1. Silicon chip (or glass slide) containing single-stranded probes complementary to each gene in the genome. 2. A method for extracting RNA from cells and making it fluorescent. 3. A hybridization chamber in which 2 will be hybridized to A laser that will scan the chip after the hybridization. Sudarsanam et al. (2000) PNAS 97:
4 13 14 Comprehensive identification of cell cycleregulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization How does transcription in yeast change as the cell cycle progresses? 1. Take asynchronous yeast 2. Synchronize them in G 1 by DIFFERENT METHODS 3. Release from arrest 4. Extract RNA at set timepoints post-arrest 5. Compare levels to that in asynchronous culture Spellman et al. (1998) Mol. Biol. Cell 9:
5 cell cycle control DNA replication DNA repair budding glycosylation nuclear division mitosis structure of the cytoskeleton mating we identified are: The major functions of the cell cycle regulated genes 800 genes phenomenon what caused it
6 The transcriptional program in the response of human fibroblasts to serum Take human fibroblasts arrested in G 0. Add serum (they start dividing) Extract RNA at defined timepoints and do Affy. Iyer et al. (2000) Science 285: ,356 individual measurements Primary cultured fibroblasts from human neonatal foreskin were induced to enter a quiescent state by serum deprivation for 48 hours and then stimulated by addition of medium containing 10% FBS. DNA microarray hybridization was used to measure the temporal changes in mrna levels of 8613 human genes at 12 times, ranging from 15 min to 24 hours after serum stimulation. Iyer et al. (2000) Science 285:
7 Wound healing Problem On the one hand, it is incredibly gratifying that the cell s response to the stimulus makes biological sense (a human skin fibroblast normally enounters serum i.e., blood in the context of a wound). On the other hand, knowing that all these genes respond to serum tells us very little about why they do that. If we were doing this in yeast, we d do a screen. Or, alternatively, we could test a strain with a deletion for the gene(s) that regulate this response. Which gene is that? Well, let s delete each gene, one by one, and see which defect the strains get!! Screen of each gene for each defect SATURATION The central challenge in experimental biology How to convert data into knowledge 26 28
8 An additional, extremely cool, trick What this means The deletion cassette contains a molecular bar code a tag region. The tag is a sandwich (2 actually) on either side of the tag are sequences that are the same in all deletion cassettes, but the filling is unique to each gene: Within each deleted gene lies a unique, identifiable sequence. This represents a tag that can be used as a unique identifier for that strain and that strain only. More on this very soon Functional Characterization of the S. cerevisiae Genome by Gene Deletion and Parallel Analysis The seven phenotypic categories of deletion mutant morphologies What about essential genes? use heterozygous diploids! 1. When spores from the 2026 heterozygous strains were germinated on YPD media at 30 C haploid deletants could not be recovered for 356 ORFs (17%) 2. In total, we deleted 5,916 genes (96.5% of total attempted). Some 18.7% (1,105) of the genes proved essential for growth on rich glucose medium. 1. Winzeler et al. (1999) 285:
9 Now what? Eighty two percent of yeast genes are nonessential in rich medium. What do all these yeast genes do? fitness profiling: measure how the deletion of gene X affects the cell s ability to react to, or live in, condition Y. Ah, the good old days This is what one could do Take 5,100 vials, into each inoculate a different strain. Label the vial with the name of the gene deleted in the strain. Do this in duplicate. To one vial, add something (I don t know, a toxin or Diet Coke or something). See, which strains have a defect in growing in the presence of aspartame Screen for gal cells H. Douglas, D. Hawthorne (1964): 1. Take wt haploid yeast. 2. Zap them with UV light. 3. Replica-plate to find those that are gal. 4. 1:1000 are mutant. Douglas HC, Hawthorne D (1964) Enzymatic expression and genetic linkage of genes controlling lactose utilization in Saccharomyces. Genetics 49: 837. The way this was actually done (are you ready for this?!) Whole-genome parallel analysis The unique sequence tags linked to each gene deletion allow the strains to be analysed in parallel. In each experiment, a mixed culture containing every deletion mutant is grown, samples are collected at several times during growth, and the molecular bar-code tags are amplified from genomic DNA. The abundance of each deletion strain is then determined by quantifying the associated molecular bar codes by hybridization to an oligonucleotide array of the complementary barcode sequences
10 Amazing but true 1. They did not want to have 5,000 vials of anything. Instead, they put all the deletions in the same vial two vials, actually, one control (+ glucose) and one experimental (+ aspartame), and started growing this strange family. 2. Those strains that have a growth deficiency on aspartame will grow more slowly than those that do not. 3. At defined timepoints, they took aliquots, isolated genomic DNA, and Yes, and what? This means they can directly measure, how many cells of which strain were present in the mix at any time by hybridizing this pool to a custom microarray please understand, not the yeast genome array this was an array they made especially for this experiment it contained 5,100 tag sequences, each one annotated: GTCAAGATGCTACCGTTCAG = GAL1 GGTAGTATGTTTGGGACAG = GAL Oooh, mama! did PCR with the primers flanking the tag. This will amplify every tag in the mix that is, from every strain in the vial. BUT! the tag itself is unique that is, their PCR product is a POOL the number of times a given tag is represented in that pool is directly proportional to how abundant that strain was at that moment in time! One question How cool is that, I ask you? Answer: cooler than Keanu Reeves, Lawrence Fishburne, and Carrie-Anne Moss COMBINED
11 First About 15% of all viable homozygous deletion strains exhibit a slow growth phenotype in rich medium at 30 C ~ 620 genes are not essential, but in their absence yeast wish they were dead Stress response Yeast (and us) has evolved to respond to stress (change in environment) temperature, salinity, nutrient composition, ph, UV damage, etc etc. Take those strains that are alive and do not have a death wish (~4,700 genes) and profile them with respect to their ability to respond to such stress. = identify genes required for stress response Gene Average Ratio Gene Description SRV kDa adenylyl cyclase-associated protein, cytoskeleton organization and biogenesis*, cytoskeletal protein binding protein*, actin cortical patch (sensu Saccharomyces) RNR ribonucleotide reductase, DNA replication, ribonucleoside-diphosphate reductase, cytosol VAC Integral vacuolar membrane protein,molecular_function unknown, FYV biological_process unknown, molecular_function unknown, cellular_component unknown BEM contains two SH3 domains ARV similar to Nup120p and C.elegans R05H5.5 protein and Nup120p, biological_process unknown, molecular_function unknown, YDJ yeast dnaj homolog (nuclear envelope protein); heat shock protein BUD bud site selection, biological_process unknown, molecular_function unknown, cellular_component unknown VPS phosphatidylinositol 3-kinase, protein phosphorylation*, protein kinase*, membrane fraction SWI transcription factor, chromatin modeling, non-specific RNA polymerase II transcription factor, nucleosome remodeling complex TPS Trehalose-6-phosphate phosphatase, stress response*, trehalose phosphatase, alpha,alpha-trehalose-phosphate synthase (UDP-forming) CUP vacuolar ATPase V0 domain subunit c (17 kda), endocytosis*, hydrogen-transporting two-sector ATPase, hydrogen-transporting ATPase V0 domain BUD biological_process unknown, molecular_function unknown, cellular_component unknown RPL27 Ribosomal protein L27A, protein biosynthesis, structural protein of MCB ribosome, 140 cytosolic 17.1 Giaever et al. A (2002) Nature 418, large 387. ribosomal (60S)-subunit 42 Which stress stimuli to pick first? They picked: 1. Change of carbon source (galactose or 1.5M sorbitol) 2. Change in osmolarity (1M NaCl) 3. ph 8 4. DNA damage 44
12 Surprise # PGM2 Phosphoglucomutase, glycogen metabolism*, phosphoglucomutase, cytoplasm* GAL7 galactose-1-phosphate uridyl transferase, galactose metabolism, UTP--hexose-1-phosphate uridylyltran GAL10 UDP-glucose 4-epimerase, galactose metabolism, UDP-glucose 4-epimerase, cytoplasm SNF4 associates with Snf1p IRA2 encodes a GTPase activating protein, highly homologous to Ira1p, homologue of neurofibromin GAL3 involved in galactose induction of GAL genes, galactose metabolism*, molecular_function unknown, nu GAL4 zinc-finger transcription factor of the Zn(2)-Cys(6) binuclear cluster domain type, galactose metabolism* NBP2 interacts with Nap1, which is involved in histone assembly, biological_process unknown, SRB8 RNA polymerase II mediator subunit, repression of transcription from Pol II promoter, RNA polymerase CYS3 cystathionine gamma-lyase,cystathionine-gamma-lyase, biological_process unknown, molecular_function unknown, GEF1 putative transport protein involved in intracellular iron metabolism, transport, SMI1 57 kda nuclear protein biological_process unknown, molecular_function unknown, GAL2 galactose permease, galactose metabolism*, galactose transporter, plasma membrane RML2 mitochondrial ribosomal protein L2 of the large subunit, protein biosynthesis*, structural protein of ribos SEC22 Synaptobrevin (v-snare) homolog, non-selective vesicle fusion*, v-snare, inter-golgi transport vesic MDM12 Mdm12p is a mitochondrial outer membrane protein. An Mdm12p homolog exists in S. Pombe which c BMH1 Homolog of mammalian proteins, pseudohyphal growth*, molecular_function unknown, FTR1 Iron permease, transport, RAV1 Regulator of (H+)-ATPase in vacuolar membrane,molecular_function unknown, DIA4 Seryl-tRNA synthetase, pseudohyphal growth*, serine--trna ligase, cellular_component unknown FET3 multicopper oxidase, high affinity iron transport, multicopper ferroxidase iron transport mediator, plasma GAL1 galactokinase, galactose metabolism, galactokinase, plasma membrane* biological_process unknown, molecular_function unknown, 47 Surprise #1 The use of galactose is one of the beststudied pathways in yeast, yet we identified ten genes not previously known to be required for optimal growth on this carbon source: MSN2, FTR1, FET3, YDR290W, ATX1, YNL077W, YDR269C, GEF1, YML090w, YKL037W. Thus, fitness profiling can discover genes involved even in previously well-studied pathways
13 Message This was the first real saturation screen ever done for anything. Saturation screens have been done in the past, but the claim of saturation ( we ve made a mutation in every gene ) has always been a statistical, not an empirical one. It s amazing how much more one can find when one does a true saturation screen! Let s think about this for a second If a stimulus activates (or represses) a gene, this must be for a reason! For example, when you add lactose to E. coli, one gene that is induced is, of course, b-galactosidase. Prediction: If a gene is induced by the stimulus, it must have something to do with responding to the stimulus! Expression profiling vs. genetics? The stimuli (galactose, 1M NaCl, DNA damage, etc.) picked were not chosen randomly. They chose the ones for which the expression profiling had already been done. Compare two lists: 1. Genes activated (repressed) by stimulus. 2. Genes that are required for growth following that stimulus. Buckle your seatbelts and return your tray tables to an upright and fully locked position 50 52
14 Holy cow Our hypothesis was this: if a gene exhibits a significant increase in expression in a given condition, then it should also be required for optimal growth in that condition. We found that in galactose, less than 7% of the genes that exhibited a significant increase in mrna expression also exhibited a significant decrease in fitness. In the case of ph 8, 1 M NaCl and 1.5 M sorbitol, 3.0%, 0.88% and 0.34%, respectively, of the genes that exhibited a significant increase in mrna expression also exhibited a significant decrease in fitness. Seventeen thousand three hundred and eighteen Expression profiling = 17,318 papers. Take cell, do something to it, observe change in gene expression and change in cell. What is the relationship between changes in gene expression and what happened to the cell? Assumption: a causal one. That is, gene expression changed because of what we did to the cell, and, furthermore, how the cell responded to what we did is due to the gene expression change Hmmmmmmmmmmmmm We observed little overlap of genes identified both as significant by fitness profiling and as significantly upregulated by gene expression profiling in conditions of 1 M NaCl, 1.5 M sorbitol, ph 8 and galactose. It is easy to imagine why some genes required for growth under a particular condition do not exhibit a change in expression in that condition, because the response to the change in condition may operate post-transcriptionally. The converse situation a gene that exhibits a significant increase in expression but is not required for growth is quite surprising, and more difficult to comprehend. It is possible that under stress conditions, multiple gene products are expressed, only a small fraction of which are essential for adaptation to the specific condition in question. Coincidental correlation Post hoc, ergo propter hoc. After something, therefore because of something
15 Transcriptional response of S. cerevisiae to DNA-damaging agents does not identify the genes that protect against these agents The recent completion of the deletion of all of the nonessential genes in budding yeast has provided a powerful new way of determining those genes that affect the sensitivity of this organism to cytotoxic agents. We have used this system to test the hypothesis that genes whose transcription is increased after DNA damage are important for the survival to that damage. We used a pool of 4,627 diploid strains each with homozygous deletion of a nonessential gene to identify those genes that are important for the survival of yeast to four DNA-damaging agents: ionizing radiation, UV radiation, and exposure to cisplatin or to hydrogen peroxide. In addition we measured the transcriptional response of the wild-type parental strain to the same DNAdamaging agents. We found no relationship between the genes necessary for survival to the DNA-damaging agents and those genes whose transcription is increased after exposure. These data show that few, if any, of the genes involved in repairing the DNA lesions produced in this study, including double-strand breaks, pyrimidine dimers, single-strand breaks, base damage, and DNA cross-links, are induced in response to toxic doses of the agents that produce these lesions. This finding suggests that the enzymes necessary for the repair of these lesions are at sufficient levels within the cell. The data also suggest that the nature of the lesions produced by DNA-damaging agents cannot easily be deduced from gene expression profiling. Birrell et al. (2002) PNAS 99: Next time Use of functional genomics to understand cancer cell biology Please understand This does not mean that genes that respond to stimuli are irrelevant to that response. This only means that you cannot take a list of genes that have responded and make a sweeping claim as to the relevance of all the genes that responded to the actual functional pathway of the response. For some pathways (DNA damage in yeast) the Venn diagram has near-zero overlap! 58
The geneticist s questions. Deleting yeast genes. Functional genomics. From Wikipedia, the free encyclopedia
From Wikipedia, the free encyclopedia Functional genomics..is a field of molecular biology that attempts to make use of the vast wealth of data produced by genomic projects (such as genome sequencing projects)
More informationGO ID GO term Number of members GO: translation 225 GO: nucleosome 50 GO: calcium ion binding 76 GO: structural
GO ID GO term Number of members GO:0006412 translation 225 GO:0000786 nucleosome 50 GO:0005509 calcium ion binding 76 GO:0003735 structural constituent of ribosome 170 GO:0019861 flagellum 23 GO:0005840
More informationIntroduction. Gene expression is the combined process of :
1 To know and explain: Regulation of Bacterial Gene Expression Constitutive ( house keeping) vs. Controllable genes OPERON structure and its role in gene regulation Regulation of Eukaryotic Gene Expression
More informationBiological Process Term Enrichment
Biological Process Term Enrichment cellular protein localization cellular macromolecule localization intracellular protein transport intracellular transport generation of precursor metabolites and energy
More information7.06 Problem Set #4, Spring 2005
7.06 Problem Set #4, Spring 2005 1. You re doing a mutant hunt in S. cerevisiae (budding yeast), looking for temperaturesensitive mutants that are defective in the cell cycle. You discover a mutant strain
More informationEukaryotic Gene Expression
Eukaryotic Gene Expression Lectures 22-23 Several Features Distinguish Eukaryotic Processes From Mechanisms in Bacteria 123 Eukaryotic Gene Expression Several Features Distinguish Eukaryotic Processes
More information32 Gene regulation, continued Lecture Outline 11/21/05
32 Gene regulation, continued Lecture Outline 11/21/05 Review the operon concept Repressible operons (e.g. trp) Inducible operons (e.g. lac) Positive regulation of lac () Practice applying the operon concept
More informationLecture 18 June 2 nd, Gene Expression Regulation Mutations
Lecture 18 June 2 nd, 2016 Gene Expression Regulation Mutations From Gene to Protein Central Dogma Replication DNA RNA PROTEIN Transcription Translation RNA Viruses: genome is RNA Reverse Transcriptase
More information16 The Cell Cycle. Chapter Outline The Eukaryotic Cell Cycle Regulators of Cell Cycle Progression The Events of M Phase Meiosis and Fertilization
The Cell Cycle 16 The Cell Cycle Chapter Outline The Eukaryotic Cell Cycle Regulators of Cell Cycle Progression The Events of M Phase Meiosis and Fertilization Introduction Self-reproduction is perhaps
More informationThree different fusions led to three basic ideas: 1) If one fuses a cell in mitosis with a cell in any other stage of the cell cycle, the chromosomes
Section Notes The cell division cycle presents an interesting system to study because growth and division must be carefully coordinated. For many cells it is important that it reaches the correct size
More informationMultiple Choice Review- Eukaryotic Gene Expression
Multiple Choice Review- Eukaryotic Gene Expression 1. Which of the following is the Central Dogma of cell biology? a. DNA Nucleic Acid Protein Amino Acid b. Prokaryote Bacteria - Eukaryote c. Atom Molecule
More informationCHAPTER 3. Cell Structure and Genetic Control. Chapter 3 Outline
CHAPTER 3 Cell Structure and Genetic Control Chapter 3 Outline Plasma Membrane Cytoplasm and Its Organelles Cell Nucleus and Gene Expression Protein Synthesis and Secretion DNA Synthesis and Cell Division
More informationDiscovering modules in expression profiles using a network
Discovering modules in expression profiles using a network Igor Ulitsky 1 2 Protein-protein interactions (PPIs) Low throughput measurements: accurate, scarce High throughput: more abundant, noisy Large,
More informationRNA Synthesis and Processing
RNA Synthesis and Processing Introduction Regulation of gene expression allows cells to adapt to environmental changes and is responsible for the distinct activities of the differentiated cell types that
More informationComputational Cell Biology Lecture 4
Computational Cell Biology Lecture 4 Case Study: Basic Modeling in Gene Expression Yang Cao Department of Computer Science DNA Structure and Base Pair Gene Expression Gene is just a small part of DNA.
More informationDevelopment Team. Regulation of gene expression in Prokaryotes: Lac Operon. Molecular Cell Biology. Department of Zoology, University of Delhi
Paper Module : 15 : 23 Development Team Principal Investigator : Prof. Neeta Sehgal Department of Zoology, University of Delhi Co-Principal Investigator : Prof. D.K. Singh Department of Zoology, University
More informationChapter 16 Lecture. Concepts Of Genetics. Tenth Edition. Regulation of Gene Expression in Prokaryotes
Chapter 16 Lecture Concepts Of Genetics Tenth Edition Regulation of Gene Expression in Prokaryotes Chapter Contents 16.1 Prokaryotes Regulate Gene Expression in Response to Environmental Conditions 16.2
More informationSignal Transduction. Dr. Chaidir, Apt
Signal Transduction Dr. Chaidir, Apt Background Complex unicellular organisms existed on Earth for approximately 2.5 billion years before the first multicellular organisms appeared.this long period for
More informationYeast Genome-wide Screens to Ascertain the Genetic Landscape for Barth Syndrome. Christopher R. McMaster, PhD Dalhousie University
Yeast Genome-wide Screens to Ascertain the Genetic Landscape for Barth Syndrome Christopher R. McMaster, PhD Dalhousie University Using Systematic Genetics to Identify Modifies Genes that Affect Fitness
More information4. Why not make all enzymes all the time (even if not needed)? Enzyme synthesis uses a lot of energy.
1 C2005/F2401 '10-- Lecture 15 -- Last Edited: 11/02/10 01:58 PM Copyright 2010 Deborah Mowshowitz and Lawrence Chasin Department of Biological Sciences Columbia University New York, NY. Handouts: 15A
More informationREVIEW SESSION. Wednesday, September 15 5:30 PM SHANTZ 242 E
REVIEW SESSION Wednesday, September 15 5:30 PM SHANTZ 242 E Gene Regulation Gene Regulation Gene expression can be turned on, turned off, turned up or turned down! For example, as test time approaches,
More informationBig Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Tuesday, December 27, 16
Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. Enduring understanding 3.B: Expression of genetic information involves cellular and molecular
More informationChapters 12&13 Notes: DNA, RNA & Protein Synthesis
Chapters 12&13 Notes: DNA, RNA & Protein Synthesis Name Period Words to Know: nucleotides, DNA, complementary base pairing, replication, genes, proteins, mrna, rrna, trna, transcription, translation, codon,
More informationRegulation and signaling. Overview. Control of gene expression. Cells need to regulate the amounts of different proteins they express, depending on
Regulation and signaling Overview Cells need to regulate the amounts of different proteins they express, depending on cell development (skin vs liver cell) cell stage environmental conditions (food, temperature,
More informationInterphase & Cell Division
1 Interphase & Cell Division 2 G1 = cell grows and carries out its normal job. S phase = DNA is copied (replicated/duplicated) G2 = Cell prepares for division 3 During mitosis, the nuclear membrane breaks
More informationInitiation of translation in eukaryotic cells:connecting the head and tail
Initiation of translation in eukaryotic cells:connecting the head and tail GCCRCCAUGG 1: Multiple initiation factors with distinct biochemical roles (linking, tethering, recruiting, and scanning) 2: 5
More informationName: SBI 4U. Gene Expression Quiz. Overall Expectation:
Gene Expression Quiz Overall Expectation: - Demonstrate an understanding of concepts related to molecular genetics, and how genetic modification is applied in industry and agriculture Specific Expectation(s):
More informationCellular Neuroanatomy I The Prototypical Neuron: Soma. Reading: BCP Chapter 2
Cellular Neuroanatomy I The Prototypical Neuron: Soma Reading: BCP Chapter 2 Functional Unit of the Nervous System The functional unit of the nervous system is the neuron. Neurons are cells specialized
More informationName: Date: Hour: Unit Four: Cell Cycle, Mitosis and Meiosis. Monomer Polymer Example Drawing Function in a cell DNA
Unit Four: Cell Cycle, Mitosis and Meiosis I. Concept Review A. Why is carbon often called the building block of life? B. List the four major macromolecules. C. Complete the chart below. Monomer Polymer
More informationCHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON
PROKARYOTE GENES: E. COLI LAC OPERON CHAPTER 13 CHAPTER 13 PROKARYOTE GENES: E. COLI LAC OPERON Figure 1. Electron micrograph of growing E. coli. Some show the constriction at the location where daughter
More informationRule learning for gene expression data
Rule learning for gene expression data Stefan Enroth Original slides by Torgeir R. Hvidsten The Linnaeus Centre for Bioinformatics Predicting biological process from gene expression time profiles Papers:
More informationLecture 10: Cyclins, cyclin kinases and cell division
Chem*3560 Lecture 10: Cyclins, cyclin kinases and cell division The eukaryotic cell cycle Actively growing mammalian cells divide roughly every 24 hours, and follow a precise sequence of events know as
More informationIntroduction to Molecular and Cell Biology
Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the molecular basis of disease? What
More information3 RFC1-like clamps (Ctf18, Elg1 and Rad24) have nonessential and overlapping functions as seen by the increased sensitivity to DNA damage or slowed
3 RFC1-like clamps (Ctf18, Elg1 and Rad24) have nonessential and overlapping functions as seen by the increased sensitivity to DNA damage or slowed replication Initiation of Replication http://www.orst.edu/instruction/bb492/figletters/figh3.gif
More informationBi 1x Spring 2014: LacI Titration
Bi 1x Spring 2014: LacI Titration 1 Overview In this experiment, you will measure the effect of various mutated LacI repressor ribosome binding sites in an E. coli cell by measuring the expression of a
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression Edited by Shawn Lester PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley
More information2012 Univ Aguilera Lecture. Introduction to Molecular and Cell Biology
2012 Univ. 1301 Aguilera Lecture Introduction to Molecular and Cell Biology Molecular biology seeks to understand the physical and chemical basis of life. and helps us answer the following? What is the
More informationUnit 3: Control and regulation Higher Biology
Unit 3: Control and regulation Higher Biology To study the roles that genes play in the control of growth and development of organisms To be able to Give some examples of features which are controlled
More informationTopic 4 - #14 The Lactose Operon
Topic 4 - #14 The Lactose Operon The Lactose Operon The lactose operon is an operon which is responsible for the transport and metabolism of the sugar lactose in E. coli. - Lactose is one of many organic
More informationBiology I Fall Semester Exam Review 2014
Biology I Fall Semester Exam Review 2014 Biomolecules and Enzymes (Chapter 2) 8 questions Macromolecules, Biomolecules, Organic Compunds Elements *From the Periodic Table of Elements Subunits Monomers,
More informationProkaryotic Regulation
Prokaryotic Regulation Control of transcription initiation can be: Positive control increases transcription when activators bind DNA Negative control reduces transcription when repressors bind to DNA regulatory
More informationTransport between cytosol and nucleus
of 60 3 Gated trans Lectures 9-15 MBLG 2071 The n GATED TRANSPORT transport between cytoplasm and nucleus (bidirectional) controlled by the nuclear pore complex active transport for macro molecules e.g.
More informationVariation of Traits. genetic variation: the measure of the differences among individuals within a population
Genetic variability is the measure of the differences among individuals within a population. Because some traits are more suited to certain environments, creating particular niches and fits, we know that
More informationNumber of questions TEK (Learning Target) Biomolecules & Enzymes
Unit Biomolecules & Enzymes Number of questions TEK (Learning Target) on Exam 8 questions 9A I can compare and contrast the structure and function of biomolecules. 9C I know the role of enzymes and how
More informationWhat Kind Of Molecules Carry Protein Assembly Instructions From The Nucleus To The Cytoplasm
What Kind Of Molecules Carry Protein Assembly Instructions From The Nucleus To The Cytoplasm What kind of reaction produces large molecules by linking small molecules? molecules carry protein assembly
More informationZool 3200: Cell Biology Exam 5 4/27/15
Name: Trask Zool 3200: Cell Biology Exam 5 4/27/15 Answer each of the following short answer questions in the space provided, giving explanations when asked to do so. Circle the correct answer or answers
More informationBioinformatics. Transcriptome
Bioinformatics Transcriptome Jacques.van.Helden@ulb.ac.be Université Libre de Bruxelles, Belgique Laboratoire de Bioinformatique des Génomes et des Réseaux (BiGRe) http://www.bigre.ulb.ac.be/ Bioinformatics
More informationOld FINAL EXAM BIO409/509 NAME. Please number your answers and write them on the attached, lined paper.
Old FINAL EXAM BIO409/509 NAME Please number your answers and write them on the attached, lined paper. Gene expression can be regulated at several steps. Describe one example for each of the following:
More information7.06 Cell Biology EXAM #3 April 21, 2005
7.06 Cell Biology EXAM #3 April 21, 2005 This is an open book exam, and you are allowed access to books, a calculator, and notes but not computers or any other types of electronic devices. Please write
More informationChapter 12. Genes: Expression and Regulation
Chapter 12 Genes: Expression and Regulation 1 DNA Transcription or RNA Synthesis produces three types of RNA trna carries amino acids during protein synthesis rrna component of ribosomes mrna directs protein
More informationRelated Courses He who asks is a fool for five minutes, but he who does not ask remains a fool forever.
CSE 527 Computational Biology http://www.cs.washington.edu/527 Lecture 1: Overview & Bio Review Autumn 2004 Larry Ruzzo Related Courses He who asks is a fool for five minutes, but he who does not ask remains
More informationStudy Guide 11 & 12 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Study Guide 11 & 12 MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) The receptors for a group of signaling molecules known as growth factors are
More informationRegulation of Gene Expression in Bacteria and Their Viruses
11 Regulation of Gene Expression in Bacteria and Their Viruses WORKING WITH THE FIGURES 1. Compare the structure of IPTG shown in Figure 11-7 with the structure of galactose shown in Figure 11-5. Why is
More informationBME 5742 Biosystems Modeling and Control
BME 5742 Biosystems Modeling and Control Lecture 24 Unregulated Gene Expression Model Dr. Zvi Roth (FAU) 1 The genetic material inside a cell, encoded in its DNA, governs the response of a cell to various
More information3.a.2- Cell Cycle and Meiosis
Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. 3.a.2- Cell Cycle and Meiosis EU 3.A: Heritable information provides for continuity of life.
More informationWelcome to Class 21!
Welcome to Class 21! Introductory Biochemistry! Lecture 21: Outline and Objectives l Regulation of Gene Expression in Prokaryotes! l transcriptional regulation! l principles! l lac operon! l trp attenuation!
More information16 CONTROL OF GENE EXPRESSION
16 CONTROL OF GENE EXPRESSION Chapter Outline 16.1 REGULATION OF GENE EXPRESSION IN PROKARYOTES The operon is the unit of transcription in prokaryotes The lac operon for lactose metabolism is transcribed
More informationNotes Chapter 4 Cell Reproduction. That cell divided and becomes two, two become four, four become eight, and so on.
4.1 Cell Division and Mitosis Many organisms start as one cell. Notes Chapter 4 Cell Reproduction That cell divided and becomes two, two become four, four become eight, and so on. Many-celled organisms,
More informationCo-ordination occurs in multiple layers Intracellular regulation: self-regulation Intercellular regulation: coordinated cell signalling e.g.
Gene Expression- Overview Differentiating cells Achieved through changes in gene expression All cells contain the same whole genome A typical differentiated cell only expresses ~50% of its total gene Overview
More informationName Period The Control of Gene Expression in Prokaryotes Notes
Bacterial DNA contains genes that encode for many different proteins (enzymes) so that many processes have the ability to occur -not all processes are carried out at any one time -what allows expression
More informationOrganization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p
Organization of Genes Differs in Prokaryotic and Eukaryotic DNA Chapter 10 p.110-114 Arrangement of information in DNA----- requirements for RNA Common arrangement of protein-coding genes in prokaryotes=
More informationChapter 15 Active Reading Guide Regulation of Gene Expression
Name: AP Biology Mr. Croft Chapter 15 Active Reading Guide Regulation of Gene Expression The overview for Chapter 15 introduces the idea that while all cells of an organism have all genes in the genome,
More information2. Yeast two-hybrid system
2. Yeast two-hybrid system I. Process workflow a. Mating of haploid two-hybrid strains on YPD plates b. Replica-plating of diploids on selective plates c. Two-hydrid experiment plating on selective plates
More informationNotes Chapter 4 Cell Reproduction. That cell divided and becomes two, two become, four become eight, and so on.
Notes Chapter 4 Cell Reproduction 4.1 Cell Division and Mitosis Many organisms start as. That cell divided and becomes two, two become, four become eight, and so on. Many-celled organisms, including you,
More informationGENE REGULATION AND PROBLEMS OF DEVELOPMENT
GENE REGULATION AND PROBLEMS OF DEVELOPMENT By Surinder Kaur DIET Ropar Surinder_1998@ yahoo.in Mob No 9988530775 GENE REGULATION Gene is a segment of DNA that codes for a unit of function (polypeptide,
More informationLesson Overview. Gene Regulation and Expression. Lesson Overview Gene Regulation and Expression
13.4 Gene Regulation and Expression THINK ABOUT IT Think of a library filled with how-to books. Would you ever need to use all of those books at the same time? Of course not. Now picture a tiny bacterium
More informationControlling Gene Expression
Controlling Gene Expression Control Mechanisms Gene regulation involves turning on or off specific genes as required by the cell Determine when to make more proteins and when to stop making more Housekeeping
More informationCell Division: the process of copying and dividing entire cells The cell grows, prepares for division, and then divides to form new daughter cells.
Mitosis & Meiosis SC.912.L.16.17 Compare and contrast mitosis and meiosis and relate to the processes of sexual and asexual reproduction and their consequences for genetic variation. 1. Students will describe
More informationBIOH111. o Cell Biology Module o Tissue Module o Integumentary system o Skeletal system o Muscle system o Nervous system o Endocrine system
BIOH111 o Cell Biology Module o Tissue Module o Integumentary system o Skeletal system o Muscle system o Nervous system o Endocrine system Endeavour College of Natural Health endeavour.edu.au 1 Textbook
More informationName Chapter 10: Chromosomes, Mitosis, and Meiosis Mrs. Laux Take home test #7 DUE: MONDAY, NOVEMBER 16, 2009 MULTIPLE CHOICE QUESTIONS
MULTIPLE CHOICE QUESTIONS 1. A bacterial chromosome consists of: A. a linear DNA molecule many times larger than the cell. B. a circular DNA molecule many times larger than the cell. C. a circular DNA
More informationLife Sciences 1a: Section 3B. The cell division cycle Objectives Understand the challenges to producing genetically identical daughter cells
Life Sciences 1a: Section 3B. The cell division cycle Objectives Understand the challenges to producing genetically identical daughter cells Understand how a simple biochemical oscillator can drive the
More informationReading Assignments. A. Systems of Cell Division. Lecture Series 5 Cell Cycle & Cell Division
Lecture Series 5 Cell Cycle & Cell Division Reading Assignments Read Chapter 18 Cell Cycle & Cell Death Read Chapter 19 Cell Division Read Chapter 20 pages 659-672 672 only (Benefits of Sex & Meiosis sections)
More informationLecture Series 5 Cell Cycle & Cell Division
Lecture Series 5 Cell Cycle & Cell Division Reading Assignments Read Chapter 18 Cell Cycle & Cell Death Read Chapter 19 Cell Division Read Chapter 20 pages 659-672 672 only (Benefits of Sex & Meiosis sections)
More informationS1 Gene ontology (GO) analysis of the network alignment results
1 Supplementary Material for Effective comparative analysis of protein-protein interaction networks by measuring the steady-state network flow using a Markov model Hyundoo Jeong 1, Xiaoning Qian 1 and
More informationLecture Series 5 Cell Cycle & Cell Division
Lecture Series 5 Cell Cycle & Cell Division Reading Assignments Read Chapter 18 Cell Cycle & Cell Division Read Chapter 19 pages 651-663 663 only (Benefits of Sex & Meiosis sections these are in Chapter
More informationWritten Exam 15 December Course name: Introduction to Systems Biology Course no
Technical University of Denmark Written Exam 15 December 2008 Course name: Introduction to Systems Biology Course no. 27041 Aids allowed: Open book exam Provide your answers and calculations on separate
More informationTypes of biological networks. I. Intra-cellurar networks
Types of biological networks I. Intra-cellurar networks 1 Some intra-cellular networks: 1. Metabolic networks 2. Transcriptional regulation networks 3. Cell signalling networks 4. Protein-protein interaction
More informationFrom Gene to Protein
From Gene to Protein Gene Expression Process by which DNA directs the synthesis of a protein 2 stages transcription translation All organisms One gene one protein 1. Transcription of DNA Gene Composed
More information1. In most cases, genes code for and it is that
Name Chapter 10 Reading Guide From DNA to Protein: Gene Expression Concept 10.1 Genetics Shows That Genes Code for Proteins 1. In most cases, genes code for and it is that determine. 2. Describe what Garrod
More informationWhy do we have to cut our hair, nails, and lawn all the time?
Chapter 5 Cell Reproduction Mitosis Think about this Why do we have to cut our hair, nails, and lawn all the time? EQ: Why is cell division necessary for the growth & development of living organisms? Section
More informationStudy Guide: Fall Final Exam H O N O R S B I O L O G Y : U N I T S 1-5
Study Guide: Fall Final Exam H O N O R S B I O L O G Y : U N I T S 1-5 Directions: The list below identifies topics, terms, and concepts that will be addressed on your Fall Final Exam. This list should
More informationBiological Pathways Representation by Petri Nets and extension
Biological Pathways Representation by and extensions December 6, 2006 Biological Pathways Representation by and extension 1 The cell Pathways 2 Definitions 3 4 Biological Pathways Representation by and
More informationInitiation of DNA Replication Lecture 3! Linda Bloom! Office: ARB R3-165! phone: !
Initiation of DNA Replication Lecture 3! Linda Bloom! Office: ARB R3-165! email: lbloom@ufl.edu! phone: 392-8708! 1! Lecture 3 Outline! Students will learn! Basic techniques for visualizing replicating
More informationNewly made RNA is called primary transcript and is modified in three ways before leaving the nucleus:
m Eukaryotic mrna processing Newly made RNA is called primary transcript and is modified in three ways before leaving the nucleus: Cap structure a modified guanine base is added to the 5 end. Poly-A tail
More informationPlant Molecular and Cellular Biology Lecture 8: Mechanisms of Cell Cycle Control and DNA Synthesis Gary Peter
Plant Molecular and Cellular Biology Lecture 8: Mechanisms of Cell Cycle Control and DNA Synthesis Gary Peter 9/10/2008 1 Learning Objectives Explain why a cell cycle was selected for during evolution
More informationComplete all warm up questions Focus on operon functioning we will be creating operon models on Monday
Complete all warm up questions Focus on operon functioning we will be creating operon models on Monday 1. What is the Central Dogma? 2. How does prokaryotic DNA compare to eukaryotic DNA? 3. How is DNA
More information2011 The Simple Homeschool Simple Days Unit Studies Cells
1 We have a full line of high school biology units and courses at CurrClick and as online courses! Subscribe to our interactive unit study classroom and make science fun and exciting! 2 A cell is a small
More informationREGULATION OF GENE EXPRESSION. Bacterial Genetics Lac and Trp Operon
REGULATION OF GENE EXPRESSION Bacterial Genetics Lac and Trp Operon Levels of Metabolic Control The amount of cellular products can be controlled by regulating: Enzyme activity: alters protein function
More informationAnswer Key. Cell Growth and Division
Cell Growth and Division Answer Key SECTION 1. THE CELL CYCLE Cell Cycle: (1) Gap1 (G 1): cells grow, carry out normal functions, and copy their organelles. (2) Synthesis (S): cells replicate DNA. (3)
More informationBacterial Genetics & Operons
Bacterial Genetics & Operons The Bacterial Genome Because bacteria have simple genomes, they are used most often in molecular genetics studies Most of what we know about bacterial genetics comes from the
More information3.B.1 Gene Regulation. Gene regulation results in differential gene expression, leading to cell specialization.
3.B.1 Gene Regulation Gene regulation results in differential gene expression, leading to cell specialization. We will focus on gene regulation in prokaryotes first. Gene regulation accounts for some of
More informationGene regulation II Biochemistry 302. Bob Kelm February 28, 2005
Gene regulation II Biochemistry 302 Bob Kelm February 28, 2005 Catabolic operons: Regulation by multiple signals targeting different TFs Catabolite repression: Activity of lac operon is restricted when
More informationDNA Structure and Function
DNA Structure and Function Nucleotide Structure 1. 5-C sugar RNA ribose DNA deoxyribose 2. Nitrogenous Base N attaches to 1 C of sugar Double or single ring Four Bases Adenine, Guanine, Thymine, Cytosine
More informationGene regulation I Biochemistry 302. Bob Kelm February 25, 2005
Gene regulation I Biochemistry 302 Bob Kelm February 25, 2005 Principles of gene regulation (cellular versus molecular level) Extracellular signals Chemical (e.g. hormones, growth factors) Environmental
More informationLecture 2: Read about the yeast MAT locus in Molecular Biology of the Gene. Watson et al. Chapter 10. Plus section on yeast as a model system Read
Lecture 2: Read about the yeast MAT locus in Molecular Biology of the Gene. Watson et al. Chapter 10. Plus section on yeast as a model system Read chapter 22 and chapter 10 [section on MATing type gene
More informationProf. Fahd M. Nasr. Lebanese university Faculty of sciences I Department of Natural Sciences.
Prof. Fahd M. Nasr Lebanese university Faculty of sciences I Department of Natural Sciences fnasr@ul.edu.lb B3206 Microbial Genetics Eukaryotic M. G. The yeast Saccharomyces cerevisiae as a genetic model
More informationBIOLOGY STANDARDS BASED RUBRIC
BIOLOGY STANDARDS BASED RUBRIC STUDENTS WILL UNDERSTAND THAT THE FUNDAMENTAL PROCESSES OF ALL LIVING THINGS DEPEND ON A VARIETY OF SPECIALIZED CELL STRUCTURES AND CHEMICAL PROCESSES. First Semester Benchmarks:
More informationBiology 112 Practice Midterm Questions
Biology 112 Practice Midterm Questions 1. Identify which statement is true or false I. Bacterial cell walls prevent osmotic lysis II. All bacterial cell walls contain an LPS layer III. In a Gram stain,
More informationVCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design
VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and
More informationUNIT 5. Protein Synthesis 11/22/16
UNIT 5 Protein Synthesis IV. Transcription (8.4) A. RNA carries DNA s instruction 1. Francis Crick defined the central dogma of molecular biology a. Replication copies DNA b. Transcription converts DNA
More information