Knowledge IUP. Indiana University of Pennsylvania. Kathryn Coates. Theses and Dissertations (All) Summer

Transcription

1 Indiana University of Pennsylvania Knowledge IUP Theses and Dissertations (All) Summer Assessing Genetic Diversity, Hybridization, and Microhabitat Associations in Populations of Plethodon hoffmani From the Allegheny Plateau in Western Pennsylvania Kathryn Coates Follow this and additional works at: Recommended Citation Coates, Kathryn, "Assessing Genetic Diversity, Hybridization, and Microhabitat Associations in Populations of Plethodon hoffmani From the Allegheny Plateau in Western Pennsylvania" (2018). Theses and Dissertations (All) This Thesis is brought to you for free and open access by Knowledge IUP. It has been accepted for inclusion in Theses and Dissertations (All) by an authorized administrator of Knowledge IUP. For more information, please contact cclouser@iup.edu, sara.parme@iup.edu.

2 ASSESSING GENETIC DIVERSITY, HYBRIDIZATION, AND MICROHABITAT ASSOCIATIONS IN POPULATIONS OF PLETHODON HOFFMANI FROM THE ALLEGHENY PLATEAU IN WESTERN PENNSYLVANIA A Thesis Submitted to the School of Graduate Studies and Research in Partial Fulfillment of the Requirements for the Degree Master of Science Kathryn Coates Indiana University of Pennsylvania August 2018

3 Indiana University of Pennsylvania School of Graduate Studies and Research Department of Biology We hereby approve the thesis of Kathryn Coates Candidate for the degree of Master of Science Josiah H. Townsend, Ph.D. Associate Professor of Biology, Advisor Joseph E. Duchamp, Ph.D. Associate Professor of Biology Jeffery L. Larkin, Ph.D. Professor of Biology Edwin R. Patterson Director Indiana County Parks and Trails ACCEPTED Randy L. Martin, Ph.D. Dean School of Graduate Studies and Research ii

4 Title: Assessing Genetic Diversity, Hybridization, and Microhabitat Associations in Populations of Plethodon hoffmani From the Allegheny Plateau in Western Pennsylvania Author: Kathryn Coates Thesis Chair: Dr. Josiah H. Townsend Thesis Committee Members: Dr. Joseph E. Duchamp Dr. Jeffery L. Larkin Mr. Edwin R. Patterson The genus Plethodon are a diverse group of forest dwelling, direct-developing salamanders that play an important role in the complex food webs of temperature forests of eastern North America. Unfortunately, large population declines have been documented and many Plethodon species remain poorly understood, undermining planning for conservation and management. One understudied species is the Valley and Ridge salamander, Plethodon hoffmani. In the northern part of the Valley and Ridge salamander s range, co-occurrence with the widespread red-backed salamander (Plethodon cinereus) is common. During the spring of 2017, I characterized microhabitat conditions for the Valley and Ridge salamander's occurrence in areas with and without the red-backed salamander co-occurring in Indiana County, Pennsylvania (n=7). Sympatric populations occupied areas with more cover objects available and higher humidity compared to allopatric P. hoffmani populations. Tissue samples were collected and mtdna sequences were analyzed for phylogeographic structure among and within populations. Low genetic diversity and limited phylogeographic structure were recovered, suggesting a recent population bottleneck, possibly resulting from a founder effect following post-glacial range expansion. Some individuals from Blue Spruce County Park possessed morphological traits intermediate to P. hoffmani and P. cinereus, iii

5 and were hypothesized to be hybrids. In the fall of 2017, Blue Spruce County Park was sampled using repeated count surveys to characterize the microhabitat for the P. hoffmani, P. cinereus, and those with intermediate morphotypes. Low detection rates of P. hoffmani and intermediates prevented robust analyses but results suggest that P. cinereus are associated with lower elevations. I collected 27 tissue samples representing each of the three morphotypes, which were sequenced for the mtdna locus COI and the ndna loci GAPD and POMC to detect evidence for hybridization. No first generation hybrids were detected, however incongruences among genealogies provide preliminary evidence for historical hybridization between these species. This is the first study to document ecology and hybridization for P. hoffmani populations in the Allegheny Plateau and provides critical information on Plethodon species co-occurrence in a changing climate. iv

6 ACKNOWLEDGEMENTS I would like to start by acknowledging the exceptional support from my advisor, Dr. Josiah Townsend. He was always encouraging and available to assist during the entire process of preparing my thesis. I was encouraged to seek the answer to all of my questions through my research, resulting in a project that exposed me to a variety of new research skills. The lab space provided enhanced productivity, with laboratory equipment easily accessible. The lab computer had an organized folder of protocols to assist in lab work and a plethora of evolution programs to aid in analyses. Taking courses with him enhanced my thesis work, by providing opportunities to create projects that tied into my work. His incredible mentorship has set a standard for how I will mentor future students in my career. Special thanks to Ed Patterson, for going out into the field with me and showing me where to find my study species and especially for driving around Indiana County with me on weekends to look for site locations. Your support and guidance is greatly appreciated. I would like to acknowledge the biology department, especially the faculty that were always eager to help me when I needed it. Dr. Duchamp, for spending several afternoons helping to plan my project and discussing what I could do with my data. Dr. Larkin, for giving me constructive feedback and directing my efforts where I would benefit the most. At many times, I received help from faculty that did not serve on my committee, which meant so much to me. Dr. Tyree, who helped me with GIS and locating points in the field using a GPS unit at Flight 93. Dr. Diep, who discussed genetic consequences of insertions in a protein-coding region. Dr. Travis, who was always available to talk and provided several education experiences. v

7 I would like to thank my lab mates, Sam Soto, Esbeiry Cordova, Ayla Ross, Dan Dudek, Dakotah Schaffer, Justin O Neill, Mike Almasy, Erich Hofmann, and Chris Garbark for being wonderful supporters, for helping me in the field, and for listening to me process ideas. You guys were wonderful! I would also like to acknowledge my incredible family for being patient, supportive, interested, and encouraging throughout this process. I recognize that I sacrificed a lot of family time for graduate school, and I am extremely grateful that I was never pressured to do otherwise. I love you guys! Special thanks to the Indiana County Parks and Trails and the Fish and Boat Commission that allowed me to use parks and game lands for data collection. Also to the landowners, Tom Metzger, William McIntire, Steve Townsend, and Terri Boyd Townsend for permission to use their land for data collection. Last and certainly not least, I would like to acknowledge the community of friends I grew to know in Indiana, Pennsylvania. JereAnn Wagner and her beautiful family, Jessica Angelo for her endless support and weekly coffee meetings, Stephanie Deiner and Jane Cope for being incredible motivators and role models, and Dan Lawson for encouraging me in my academic goals. vi

8 TABLE OF CONTENTS Chapter Page 1 INTRODUCTION LITERATURE REVIEW... 4 Plethodon Ecology... 4 Plethodon Salamanders... 4 Microhabitat Requirements... 5 Plethodon Evolution... 6 Systematics... 7 Rapid Speciation... 8 Hybridization... 9 Study Species- Plethodon hoffmani Ecology Species Co-Occurrence Evolution EVALUATING THE EFFECTIVENESS OF DNA BARCODING AS A TOOL FOR IDENTIFYING CRYPTIC STREAM SALAMANDER LARVAE IN PENNSYLVANIA Introduction DNA Barcoding Salamanders as Indicators of Stream Health Study Area Species of Interest Methods Results Discussion CHARACTERIZING MICROHABITAT PREFERENCE AND GENETIC DIVERSITY OF THE VALLEY AND RIDGE SALAMANDER (PLETHODON HOFFMANI) IN THE ALLEGHENY PLATEAU, PENNSYLVANIA Introduction Ecology Phylogeography Objectives Methods Data Collection Statistical Analyses for Ecological Observations vii

9 Chapter Page DNA Sequencing and Genetic Diversity Analyses Phylogenetic Reconstruction Results Habitat Characteristics and Surface Active Conditions Sequences and Genetic Diversity Phylogenetic Reconstruction Discussion Ecology Phylogeography CO-OCCURRENCE, MICROHABITAT ASSOCIATIONS, AND HYBRIDIZATION OF PLETHODON HOFFMANI AND PLETHODON CINEREUS IN WESTERN PENNSYLVANIA Introduction Plethodon Species Interactions Hybridization in Plethodon Salamanders Research Objectives and Species of Interest Study Area Methods Data Collection Statistical Analyses DNA Sequencing and Alignment Genetic Diversity F1 Hybrid Identification Phylogenetic Reconstruction Results Plethodon Detection Ecological Summary Statistics and RDA Morphological Assessment Species Microclimate Tolerance Genetic Diversity F1 Hybrid Identification Phylogenetic Reconstruction Discussion Species Interactions Morphology and F1 Hybridization Genetic Diversity and Phylogenetic Reconstruction CONCLUSION AND SUGGESTED RESEARCH Conclusion Future Research viii

10 Chapter Page REFERENCES APPENDICES Appendix A Euclidean Distance Between Spring Populations Appendix B Genbank Sequences for Spring Phylogenies Appendix C Cyt-b Pairwise Distances Appendix D Concatonated Cyt-b and COI Pairwise Distances Appendix E Genbank Sequences for Fall Phylogenies Appendix F Blue Spruce COI Pairwise Distances Appendix G Blue Spruce GAPD Pairwise Distances Appendix H Blue Spruce POMC Pairwise Distances Appendix I Habitat Characteristics for Spring Sites Appendix J COI Sequences From Spring Populations Appendix K Cyt-b Sequences From Spring Populations Appendix L Concatonated Cyt-b and COI Sequences From Spring ix

11 LIST OF TABLES Table Page 1 Primers Used for COI and Cyt-b PCR Models of Nucleotide Substitution Used in Bayesian Inference Analyses Habitat Characteristics for All Occupied Plots for Populations in the Allegheny Plateau Surface Active Conditions for Populations in the Allegheny Plateau Mann-Whitney U Test Summary Statistics of Surface Active Conditions for Allopatric and Sympatric P. hoffmani populations with P. cinereus Genetic Diversity Within Each Population Average Nucleotide Difference Between Populations DNA Divergence Primers Used Models of Nucleotide Substitution Used in Bayesian Inference Analyses as Inferred Using jmodeltest Average Value and Range of Habitat Characteristics of Occupied Plethodon Plots in Blue Spruce County Park, PA Surface Active Conditions of P. hoffmani, P. cinereus, and Intermediates Genetic Diversity Per Gene for P. hoffmani, P. cinereus, Intermediates, mtdna P. hoffmani, and mtdna P. cinereus in Blue Spruce County Park, Pennsylvania Gene Flow (Fst, Nm) Estimates and DNA Divergence (Dxy, Da) Between Species Groups Incongruent Samples in Phylogenetic Analyses x

12 LIST OF FIGURES Figure Page 1 Eurycea bislineata larvae morphology in Tyron Woods, Crawford County, PA COI Phylogeny of salamander larvae from Tyron Weber Woods, Crawford County, Pennsylvania Median-Joining Network of E. bislineata COI Haplotypes Localities of P. hoffmani populations that had habitat and weather variables recorded during sampling events Expanded Map of P. hoffmani Populations Including Cameron County samples (n=2) used for BI and ML Analysis Box plots comparing number of cover objects in plots for capture occasions for allopatric (Allo) and sympatric (Sym) P. hoffmani populations in the Allegheny Plateau Box plot comparing air temperature ( C) at capture occasions for allopatric (Allo) and sympatric (Sym) P. hoffmani populations Box Plots Comparing Average Soil Temperature ( C) at Capture Occasions for Allopatric (Allo) and Sympatric (Sym) P. hoffmani populations Box plots comparing relative humidity (%) at capture occasions for allopatric (Allo) and sympatric (Sym) P. hoffmani populations Box Plots Comparing Average Leaf Litter Depth (cm) at Capture Occasions for Allopatric (Allo) and Sympatric (Sym) P. hoffmani populations Snout to vent length (SVL) for P. hoffmani in the absence of (Allopatric) and the presence of (Sympatric) P. cinereus COI BI and ML consensus phylogeny of Plethodon salamanders Cyt-b BI and ML consensus phylogeny of Plethodon salamanders Cyt-B median-joining network of Allegheny Plateau Populations + Cameron County xi

13 Figure Page 15 Concatenated COI and cyt-b BI phylogeny of Plethodon salamanders Randomly placed points in Blue Spruce County Park Capture localities for P. cinereus (RB), P. hoffmani (VR), and intermediates in Blue Spruce County Park, PA Redundancy analysis showing the effect of habitat variables on Plethodon community structure Comparison of SVL for Intermediates (n= 13), P. cinereus (RB; n= 20), and P. hoffmani (VR; n= 9) in Blue Spruce County Park, PA during the Fall (2017) Average soil temperature at capture for Plethodon in the Allegheny Plateau Average leaf litter depth at capture for Plethodon in the Allegheny Plateau Relative humidity during capture events for Plethodon salamanders Air temperature during capture events for Plethodon salamanders Median-joining networks for COI, GAPD, and POMC Blue Spruce County Park samples COI BI phylogeny of Plethodon Salamanders in Blue Spruce County Park GAPD BI phylogeny of Plethodon salamanders in Blue Spruce County Park POMC BI phylogeny of Plethodon salamanders in Blue Spruce County Park xii

14 CHAPTER 1 INTRODUCTION Population declines and global extinction are threatening extant amphibian species worldwide, with about one third of the recognized species listed as vulnerable, endangered, or critically endangered (McCartney Melstad & Shaffer, 2015). These declines are occurring in both protected areas and unprotected areas, suggesting habitat loss is not the only cause of these declines (McCartney Melstad & Shaffer, 2015). Proposed causes of decline include land use change, overharvesting, pesticides, invasive species, disease, climate change, and hybridization (McCartney Melstad & Shaffer, 2015). Extensive monitoring programs that record species occurrence and measure shifts in population size are essential for managing amphibian populations (Bailey et al., 2004). Fortunately, initiatives for amphibian monitoring exist (e.g., Partners in Amphibian and Reptile Conservation, Amphibian Research and Monitoring Initiative, Declining Amphibian Population Task Force, and North American Amphibian Monitoring Program) (Bailey et al., 2004). This study is a baseline monitoring initiative for an understudied Plethodontid salamander, the Valley and Ridge salamander (Plethodon hoffmani), in which no known threats have been identified in the sparse literature. The genus Plethodon are a diverse group of forest dwelling, direct-developing salamanders that play an important role in the complex food webs of temperature forests of eastern North America (Carlson et al., 2016; Davic & Welsh, 2004; Wake & Hanken, 2004). Unfortunately, large population declines have been documented and many Plethodon species remain poorly understood, undermining planning for conservation and management (Highton, 2005). Plethodon salamander survival is dependent on suitable 1

15 temperature and moisture ranges to facilitate cutaneous respiration (O Donnell et al., 2015), but studies have shown that species vary in their tolerance (Farallo & Miles, 2016; Baecher, 2017). Understanding species climate tolerance is an important consideration for managing populations (Carlson et al., 2016) in the light of ongoing climate change. Climate change is having a profound effect on ecological communities (Chunco, 2014) with novel climatic extremes forecasted to be the primary driver of changes in species ecology during the forthcoming century (Walls et al., 2013). The number of extreme drought events per 100 years is expected to increase by factors of two, which will greatly affect species that are sensitive to their immediate environment, and has already been doing so in some instance (Walls et al., 2013). As one of the fastest radiations of extant taxa (Weins et al., 2006), many Plethodon species are morphologically cryptic due to the limited time for trait divergence (Sites et al., 2004; Highton, 1995), making ecological studies more challenging. Further, species often co-occur (Wiens et al., 2006; Highton, 1995). To prevent misidentification, including a genetic component to verify species when undertaking ecological studies on Plethodon is recommended (Sites et al., 2004). DNA barcoding, a molecular technique for verifying species (Che et al., 2011), is utilized for cryptic Plethodontid salamanders in this study. For my thesis, I explored the ecology and evolution of Plethodon hoffmani (Valley and Ridge Salamander), inhabiting the least well-known part of its distribution, the Allegheny Plateau. As its name suggests, P. hoffmani populations primarily occupy the Valley and Ridge physiographic region, but are also found in the adjacent Allegheny Plataeu region of western Pennsylvania (Highton, 1986). A few studies (Carlson et al., 2

16 2016; Highton, 2005; Highton, 1972; Angle, 1969; Netting, 1939) have looked at populations in the Valley and Ridge region, but this is the first study to focus on populations in the Allegheny Plateau. Preeminant salamander biologist, Richard Highton (2005), wrote that his extensive Plethodon salamander research (1951 present) exposed widespread trends of population crashes across eastern North America. With that in mind, I set up this study to provide an initial baseline for a long-term monitoring initiative focused on evolution and conservation in general and P. hoffmani in particular. Additionally, DNA barcoding, a genetic technique used to verify species, was applied to cryptic Plethodontid salamanders to validate its practical use. This technique was used in every chapter to verify species. The objectives of my thesis are: 1) validating use of DNA barcoding to verify cryptic Plethodontid salamanders; 2) characterizing habitat use and surface-active conditions for P. hoffmani populations in the Allegheny Plateau; 2) inferring genetic diversity and phylogenetic reconstruction of P. hoffmani populations in the Allegheny Plateau; 4) comparing habitat use of P. hoffmani, P. cinereus, and intermediate individuals in Blue Spruce County Park, Pennsylvania; and 5) using molecular data to assess for hybridization between P. hoffmani and P. cinereus in Blue Spruce County Park, Pennsylvania. 3

17 CHAPTER 2 LITERATURE REVIEW Plethodon Ecology Plethodon Salamanders Plethodon salamanders are a species-rich genus of North American amphibians (Carlson et al., 2016; Kozak et al. 2006) that play an ecologically important role in forest ecosystems (Davic & Welsh, 2004; Highton, 1995). As direct developers that lack a larval phase (Kuchta et al., 2016; Wake & Hanken, 2004; Highton, 1995), most Plethodon species are associated with mature forests in the eastern United States (Peterman and Semlitsch, 2013). The ranges of these species vary, with some found broadly distributed and others restricted to a few square kilometers (Highton, 1995). Phylogeographic structure among populations is typically high due to territoriality, small home ranges, and low dispersal ability (Kuchta et al., 2016). There have been large population declines documented for many species (Highton, 2005), with habitat alteration being a primary concern (Petranka et al., 1993; Knapp et al., 2003), along with climate change (Milanovich et al., 2010), invasive species (Maerz et al. 2009), and disease (Vazquez et al., 2009). The effects of these can be amplified due to their limited dispersal ability (Smith and Green, 2005) and philopatric nature (Peterman &Semlitsch, 2013). Due to their sensitivity to habitat alterations, Plethodon salamanders are considered good indicators of forest health (Farallo & Miles, 2016; Dietloff et al., 2013; Bailey et al., 2004). These salamanders are long-lived, exhibit low fecundity, and mature slowly, unlike most anuran species further enhancing their role as indicators (Bailey et al., 2004). Understanding the natural history of these species is critical for planning for and 4

18 managing threats to their populations (Carlson et al., 2016). When monitoring Plethodon populations, identifying individuals to species can be challenging due to minimal morphological differentiation between closely related species (Highton, 1995), with the true number of species often underrepresented when genetic evaluation has not been carried out (Sites et al., 2004). Across the genus, species are considered osteologically uniform except for the number of costal grooves (i.e. trunk vertebrae), which ranges from grooves (Litvinchuk & Borkin, 2003; Highton, 1995). The number of costal grooves directly reflects trunk length and could be related to fossoriality, as species that burrow more frequently have more than those that do not burrow or do so very rarely (Litvinchuk & Borkin, 2003). Misava (1989) defined a species costal grooves count as the number of grooves along the side of the salamander that do not contact the limbs bases. He also noted that the left and right sides of an individual might have varied groove counts, making this feature sometimes unreliable to rely on for species identification (Misava, 1989). Microhabitat Requirements Plethodontid salamanders are lungless and have evolved to respire exclusively across their skin (Peterman & Semlitsch, 2013; O Donnell et al., 2015; Farallo & Miles, 2016). At cooler temperatures, there is an increase in the ability to diffuse gases across the skin and absorb nutrients (Peterman and Semlitsch, 2013). To maintain permeable skin conditions and facilitate the process of cutaneous respiration, moisture levels in the immediate environment are especially critical (Peterman & Semlitsch, 2013; Farallo & Miles, 2016). As a result, prolonged periods are spent underground to avoid desiccation and surface level activity increases when environmental conditions are favorable 5

19 (O Donnell et al., 2015). Highton (2005) noted that season, temperature, and surface moisture conditions were useful in predicting surface activity for Plethodon salamanders. When temperatures are too cold or too hot during times when they are expected to be surface active, individuals are difficult to find due to temporary retreat into underground burrows (Highton, 2005). Understanding the relationship between Plethodon salamanders and the environment is essential to predicting their ability to adapt to a changing environment (O Donnell et al., 2014). Plethodon Evolution Evolutionary changes occur when altered genetic material is passed from generation to generation (Futuyma, 2013). Mutation is the driver of genetic variation in populations, with the effects amplified during recombination associated with sexual reproduction (Arntzen et al., 1998). As generations pass, genetic changes will accumulate in response to genetic drift (random shifts in allele frequency) or natural selection (nonrandom selection towards traits that increase the organisms reproductive success and survival) (Avise, 2012). Speciation typically occurs in response to prolonged accumulation of slight genetic differences between populations that are geographically segregated or divergent selection (Futuyma, 2013; Nosil, 2012). The three most species-rich families of salamanders, Plethodontidae, Salamandridae, and Hynobiidae, contain nearly 90% of the living salamander species and are respectively found in America, Europe, and Asia. According to Zhang & Wake (2009), cladogenesis occurred in these three groups around the same period ( million years ago), with major clades within each family beginning to undergo diversification in the Late Cretaceous. During the Late Cretaceous, the earth experienced 6

20 a global warming event with higher temperatures in the northern latitude, which may have pressured species to disperse (Vieites et al., 2007). Most salamanders are adapted to low temperatures, suggesting this global warming may have driven many salamander taxa to extinction and leaving the three modern families to diversify rapidly (Zhang & Wake, 2009). It is hypothesized that Plethodontid salamanders lungless physiology is a result of selection from Late Cretaceous ancestors that lived in fast-moving, cool mountain brooks. Lacking lungs prevented the salamanders from being carried down the quick streams they inhabited. Other hypotheses suggest these ancestors were only semi-aquatic or even terrestrial (Ruben & Boucot, 1989). Another exceptional evolutionary trait is direct development in Plethodontidae salamanders. Direct development is the evolutionary loss of an aquatic larval stage. All reproductive processes (e.g. mating, oviposition) are done terrestrially and the eggs hatch fully formed, appearing like miniature adults. This direct development process is only seen in a single lineage in the family Plethodontidae, the genus Plethodon. This evolutionary advantage is often the attributed trait for the families incredible evolutionary success (Wake & Hanken, 2004). Systematics The Plethodon genus has been systematically revised three times (Dunn, 1926; Grobman, 1944; Highton, 1962) prior to molecular analyses. Proposed causes for morphological failure to identify species include convergence, parallelism, and speciation without morphological divergence (Highton, 1995). In some cases, it can be virtually impossible to tell species apart without confirmation from molecular data, making it essential that populations being studied are correctly identified to species (Sites et al., 7

21 2004). Following molecular species diagnosis, subtle morphological differences are often discovered between cryptic species (Highton, 1995). There are currently 55 species of Plethodon recognized, nine in a western group and 46 in an eastern group, with many being cryptic species (Bayer et al., 2012; Highton et al., 2012; Wiens et al., 2006). Molecular analysis suggests that eastern and western clades seperated over 40 million years ago (Highton, 1995). All species of Plethodon in the eastern United States form a monophyletic group on phylogenies constructed using sequence data, allozyme data, morphological characters, and immunological studies (Fisher-Reid & Wiens; 2011). In eastern Plethodon, there are four species groups: two groups of larger species (P. glutinosus group and P. wehrlei group) and two groups of smaller species (P. cinereus group and P. welleri group) (Highton et al., 2012). According to estimates by Weins et al. (2006), eastern Plethodon share a recent ancestor about 25 million years ago. In all molecular studies, the P. cinereus group is recovered as the sister group to a clade containing the three remaining species groups. The P. cinereus group are considered to be the most morphologically primitive of the eastern Plethodon groups, having a distinct shape of the mental gland (Highton et al., 2012). The P. cinereus group is made up of ten species, which have had poorly resolved relationships with different arrangements seen using allozyme data, mitochondrial, and nuclear DNA (Fisher-Reid & Wiens; 2011). Rapid Speciation Over the last several million years, the United States has gone through dynamic changes in the environment, resulting in fluctuating species distributions, speciation events, and varied population connectivity. For example, the cyclical climate trends 8

22 during the Pleistocene resulted in many species experiencing alternating episodes of range contraction and expansion. If newly allopatric populations were fragmented long enough and gene flow was reduced or halted, genetic divergence and speciation may have occurred (Thesing et al., 2016). Phylogenetic studies are useful in estimating when speciation events occurred and can estimate past movement patterns. Amphibians are model organisms for phylogeographic studies due to their typically low dispersal ability and high degree of philopatricy, resulting in high population structure (D Aoust-Messier & Lesbarreres, 2015). Plethodon species were most likely isolated to mesic forest refugia in mountains during the arid climate of the Pliocene (Shepard & Burbrink, 2011) and underwent bursts of allopatric speciation, with pleistocene glaciation events over the last 2 million years further contributing to interruptions in gene flow among diverging lineages (Highton, 1995). As the climate became more mesic, populations overall dispersed and came into secondary contact, creating parapatric contact (Highton et al., 2012). Five lineages known to have existed since the early Pliocene diversified into all exant species (Highton, 1995). Closely related species are shown to hybridize in areas of co-occurrence in response to frequent episodes of range expansion and restriction associated with climatic shifts during the late Cenozoic (Highton, 2012). Hybridization An active area of research focuses on how competitive interactions are affected by climate change-induced co-occurrences, but more research attention is needed on reproductive interactions and hybridization (Chunco, 2014). Many hybrid zones formed through secondary contact and range expansions during the environmental shifts in the 9

23 Quaternary (Hewitt, 2011). Hybridization is a major conservation concern but can also be an important source of genetic variation, potentially driving a species to extinction or enhancing a species ability to adapt to a changing environment (McCartney-Melstad & Shaffer, 2015). In order for hybridization to occur, premating barriers and post mating barriers must be overcome (Wiens et al., 2006). Premating barriers include spatial isolation, temporal isolation, and behavioral isolation. In the absence of isolation by premating barriers, the potential for hybridization increases and the fitness of the offspring becomes the primary determinant of whether the reproduction event will have an effect on the population (Chunco, 2014). If hybridization advances fitness for the native species, then introgression could advance and persist (Chunco, 2014) with natural selection considered ineffective at removing genes that have introgressed into a population (Canestrelli et al., 2016). Gene flow between recently co-occurring populations of closely related species is dependent on the degree of sexual isolation, hybrid fitness, and the ecological and adaptive properties of both populations (Weisrock et al., 2005). When divergent lineages hybridize, evolutionary consequences may occur, including reproductive isolation, hybrid speciation, introgression, and adaptive radiation (Chunco, 2014). Spatially restricted species could be susceptible to hybridizing with widespread species, which is common in contact zones and does not typically threaten coexistence between the species but, if introgression progresses too far, the restricted species' genes could be subsumed among the gene pool of the wide spread species (Bayer et al., 2012), a phenomenon known as genetic swamping (Chunco, 2012). Assessing the magnitude of gene flow between two related species can aid in understanding if species-specific genetic complexes could be 10

24 maintained long-term (Bayer et al., 2012). Some studies assess populations for hybridization using morphological characters alone, with the idea that intermediate phenotypes are hybrid individuals (Ryan et al., 2017). Phenotypic plasticity among hybrids makes morphological idenfication difficult (Arntzen et al., 1998). Fortunately, recent advancement of genetic techniques has offered a more robust method for inquiring the occurrence of introgression and hybridization directionality in populations (Sullivan et al., 2015). Recognizing species with high rates of hybridization is important especially in regards to phylogenetic studies that only look at mitochondrial DNA, such as DNA barcoding projects (Pereyra et al., 2015). Pereyra et al. (2015) suggest including nuclear and morphological characters to validate species to avoid overlooking genetic introgression. Plethodon species experienced a high rate of lineage accumulation in the recent geological past, with an estimated 0.8 species per million years beginning 11-8 million years ago (Kozak et al. 2006). Radiation in the Plethodon genus is known as one of the quickest radiations to have occurred in extant taxa (Wiens et al., 2006). The consequence of lineages arising in a short time period is the potential for underdeveloped instrinsic barriers between species that typically prevent gene flow, resulting in extensive hybridization in areas of sympatry (Wiens et al., 2006). In addition to Plethodon (Highton 1995), other examples of rapid radiations that are known to hybridize include Darwin s finches, Rift Lake cichlids, and Hawaiian crickets (Wiens et al., 2006). There is extensive evidence of hybridization in the glutinosus species group of Plethodon, but relatively limited evidence of hybridization among other species (Weins et al., 2006). Wiens et al. (2006) estimated that hybridization occurs in Plethodon species 11

25 pairs that have recent ancestor million years ago. Hybridization is rare between species pairs with a recent ancestor 8.4 to 14.4 million years ago, and does not occur between species pairs with a recent ancestor million years ago. Wiens et al. (2006) estimates that this is when reproductive isolation is fully developed in Plethodon. In the cinereus group there is extensive sympatry but limited records of hybridization (Weins et al., 2006). The two species being assessed for hybridization in this study (Chapter 4) are P. hoffmani and P. cinereus, with a shared ancestor estimated to be million years ago according to Wiens et al. s (2006) fossil calibrated topology, which puts them in the rare classification. Study Species- Plethodon hoffmani Plethodon hoffmani was first described by Richard Highton in 1971 and was published in Prior to its taxonomic description, Highton described P. hoffmani morphologically in 1962 using chin and ventral coloration. Following the published description, Highton and Larson biochemically defined it to species. The halotype is an adult male collected by Richard L. Hoffman in April of 1954, which is stored at the National Museum of Natural History (USNM ) and the type locality is from Clifton Forge, Alleghany County, Virginia (Highton, 1986). The number of trunk vertebrae ranges from 21-22, adults are mm in body length and mm in total length (including tail). Brassy flecking and small white spots cover a brown dorsum with larger white spots on the sides. The chin is spotted with heavy mottling (Highton, 1986). Populations are primarily found in the Valley and Ridge Physiographic Province from the New River in West Virginia and Virginia, and northeast into central Pennsylvania. Some populations are also found in the Allegheny Plateau and the Blue 12

26 Ridge Physiographic Province in Virginia (Highton 1986; Amphibiaweb, 2018). Ecology In 2005, Richard Highton published his results of a comparison study looking at the mean abundance of 127 Plethodon salamander populations before 1990 and during the 1990s to assess for population declines. He noted that of the 38 species included, there were widespread declines with the exception of P. hoffmani and its sister species, P. shenandoah. P. hoffmani was the only species to have more increases in abundance than decreases. One Pennsylvania population was included from Snyder County, and had a mean of 1.2 salamanders per collector before 1990 and 0 in the 1990s. Populations of P. hoffmani from the Allegheny Plateau were not assessed. Highton (2005) mentions that due to the range of variables that affect Plethodon salamander detection, including length of survey and time of day along with weather conditions, it is not advised that the status of a population be concluded based on his observations. In 2016, Carlson et al. conducted a 2-year natural history study for a P. hoffmani population in Central Pennsylvania and assessed for demography, abundance, movement, and microhabitat use and partitioning between P. hoffmani and P. cinereus. They found that P. hoffmani had a bimodal surface activity and exhibited high site fidelity (average= 0.4 meters). Air temperature prior to capture was C. Microhabitat use of P. hoffmani and P. cinereus was observed at a single site, on a single day (Carlson et al., 2016). Their results suggested that P. hoffmani and P. cinereus did not select for cover objects differently by temperature and humidity. 13

27 Species Co-Occurrence When a species has been described relatively recently, synthesizing research on that species requires sorting through the literature and determining if studies on that animal have been published under a different name. Prior to the description of P. hoffmani, a paper titled: The Reproductive Cycle of the Northern Ravine Salamander, Plethodon richmondi richmondi, in the Valley and Ridge Province of Pennsylvania and Maryland was published (Angle, 1969). According to known distributions for that species, Highton (1986) claims that the populations being studied were P. hoffmani. This is the first paper to look at reproductive cycle in males and co-occurrence with closely related species (P. glutinosus and P. cinereus) (Angle, 1969). Additional studies have been found that assess habitat use, seasonal activity (Netting, 1939) and distributional interactions (Highton, 1972) under the name P. richmondi in areas that are determined to be P. hoffmani now. P. hoffmani is thought to exclude P. cinereus throughout its range, except for in narrow bands, suggesting that competition is at play (Adams & Rohlf, 2000). In 2000, Adams and Rohlf published a morphometric study looking at populations of P. hoffmani and P. cinereus in allopatry and sympatry. They found that in sympatry, the two species had character displacement in head morphology and partitioned food resources (Adams & Rohlf, 2000). P. hoffmani had a faster closing jaw and P. cinereus had a slower, stronger jaw, which corresponded to the prey items they were selecting for (Adams & Rohlf, 2000). Having only sampled from populations in the Valley and Ridge physiographic region (Adams & Rohlf, 2000), it is not known if trophic morphology divergence is occurring in the Allegheny physiographic region as well. 14

28 Evolution P. hoffmani has been included in several Plethodon phylogenetic studies attempting to resolve relationships among Plethodon species. In 1999, Highton assess geographic protein variation among 5 unstudied Plethodon species, including P. hoffmani. P. hoffmani was broken into two species, with the new species described as P. virginia occupying the Valley and Ridge physiographic province of West Virginia and Virginia. Highton (1999) found evidence for hybridization between P. hoffmani and P. virginia in parapatric zones. In 2004, Sites et al. (2004) published a study looking at the phylogenetic relationship of P. shenandoah and other members of the P. cinereus group, including three genetic samples of P. hoffmani. In the analyses, the single Pennsylvania sample (Beaver County) shared the same mtdna haplotype as the northern West Virginia sample, and a different haplotype than the southern West Virginia sample (Sites et al., 2004). In 2012, Highton et al. sequenced 12s, the complete nuclear albumin gene, and included four genes that were previously published for phylogenetic analysis of Plethodon species. They included three samples of P. hoffmani in their analyses and verified that P. hoffmani and P. virginia were sister species. Studies have not yet looked at population level diversity for P. hoffmani. 15

29 CHAPTER 3 EVALUATING THE EFFECTIVENESS OF DNA BARCODING AS A TOOL FOR IDENTIFYING CRYPTIC STREAM SALAMANDER LARVAE IN PENNSYLVANIA Introduction Properly identifying species of study is important, especially when cryptic species co-occur at the study site. This chapter aims to evaluate the effectiveness of a molecular technique commonly used in species identification, DNA barcoding. The method is applied to cryptic Plethodontid salamanders that have a cryptic larval stage in Tyron Weber Woods in Crawford County, Pennsylvania. The effectiveness of DNA barcoding in this chapter motivated its application in the following chapters. DNA Barcoding DNA barcoding is the process of using a single fragment of mitochondrial DNA to assign any tissue sample to the proper species accurately and rapidly (Che et al., 2011) The fragment of choice for most species of animals is cytochrome c oxidase subunit 1 (COI) (Ratnasingham & Herbert, 2007; Herbert et al., 2003). Once the COI gene is sequenced from the organism s tissue, it can be quickly compared to a library of known species for verification (Meyer & Paulay, 2005). An initiative exists to use this marker to barcode every species of vertebrate to help elucidate global patterns of diversity and conservation hotspots and in rapid genetic identification of species (Che et al., 2011). Benefits of DNA barcoding include cryptic species identification, linkage of adult and larval phases, and linkage of male to female morphotypes (Smith et al., 2008). Amphibians have numerous examples of cryptic species (Davic & Welsh, 2004), with annual increases of the discovery and description of new species in the current 16

30 literature in recent years largely driven by the incorporation of genetic techniques (Grosjean et al., 2015). Many studies have explored the implication of using COI as an amphibian DNA barcode (Crawford et al., 2013; Xia et al., 2012; Andrew et al., 2011; Crawford et al., 2010) For example, Grosjean et al. (2015) used DNA barcoding to properly assign tadpoles that were previously poorly identified in streams of Southeast Asia, highlighting its practical use in species inventories and subsequent application to ecology and conservation. Herpetofauna barcoding had lagged behind other taxa, but efforts, such as the Cold Code initiative (Murphy et al., 2013), are aiming to enhance DNA barcode availability for reptiles and amphibians. Che et al. (2011) published a paper with universal COI primers to be used on amphibian DNA barcoding and successfully tested the primers on 36 genera of Chinese amphibians, which will be utilized in this study. Salamanders as Indicators of Stream Health Amphibians are often used as biometrics of stream health or ecological integrity due to their sensitivity to environmental conditions and anthropogenic disturbances (Southerland et al., 2004; Hodgson, 2008). Maintaining and managing streams is a critical conservation effort for ecosystem health and landscape sustainability. These channels link terrestrial and aquatic habitats for species depending on either or both environmental conditions (Hodgson, 2008). It has been widely documented that salamander species exceed all other vertebrates in watershed headwater habitats and have many ecological roles in the ecosystem, including predators, energy connectors between terrestrial and aquatic landscapes, soil dynamic contributors, and prey items (David & Welsh, 2004). The family Plethodontidae contains both biphasic and direct developing 17

31 species, with stream inhibiting larvae reliant on their gills for respiration (Bank et al., 2006). As a result, their presence and diversity reflects water quality due to their sensitivity to aquatic contaminants (Bank et al., 2006). An important aspect of stream ecology is establishing an inventory of the species present in the area of interest, so that deeper questions can be formulated. In this study, I evaluate the utility of DNA barcoding as a method of species identification associated with an especially challenging group of Plethodontid salamander aquatic larvae. The success of this study promoted the use of DNA barcoding to identify cryptic species of Plethodon in Allegheny County, Pennsylvania in the next two chapters. Study Area Samples were collected from a second ordern stream in Tyron Weber Woods in Crawford County, Pennsylvania. This preserve is managed by the University of Pittsburgh s Pymatuning Lab of Ecology, which promotes ongoing ecological research and a series of associate undergraduate wildlife courses offered each summer. This study provides a baseline methodology and dataset for use and refinement in future classes. Species of Interest Species of Plethodontid salamander that are historically known to inhabit the streams of the study area include Pseudotriton ruber, Desmognathus ochrophaeus, Desmognathus fuscus, and Eurycea bislineata. Pseudotriton ruber larvae are usually distinctive enough to be identified to species upon capture, with a larger body size compared to the other species (Semlitsch, 1983). Desmognathus ochrophaeus larvae resemble larval D. fuscus, especially in the northern part of their range (Tilley, 1973). It has been noted that in some instances, D. fuscus will have more gill fimbriae per ramus 18

32 than D. ochrophaeus larvae (Tilley, 1973). It has also been suggested that D. fuscus larvae can attain larger body sizes compared to D. ochrophaeus larvae (Tilley, 1973). Geographic variation in morphology and reproductive period presents a further challenge. Eurycea bislineata co-occurs with both Desmognathus species, and the small sizes and morphological similarities of all 3 larvae makes identification difficult for the layperson (Marsh, 2009). I hypothesized that we would find two or more salamander species in the larval stage during sampling, which could be identified using a DNA barcode and morphological variation could be identified. An adult D. ochrophaeus was captured alongside the stream that was surveyed, so a second hypothesis was that this species would be present in larval form. Methods In August of 2017, Dr. Josiah Townsend and I led a group of students from the course Field Techniques in Ecology and Conservation through the process of collecting salamander larvae and DNA barcoding of these individuals. A second order stream in Tyron Weber Woods was walked through by students and rocks were flipped to look for salamander larvae during a single afternoon (07/29/2017). We selected this stream because adults of all three species had been captured at this location prior to sampling. Salamander larvae were collected using macroinvrtebrate and minnow nets. We captured three P. ruber larvae, an adult D. ochrophaeus, and 36 cryptic larvae at the site. Each individual was photographed and tail clipped for genetic analysis, and released after processing. Genomic DNA was extracted from the tissue samples collected using a Purelink Genomic DNA Mini Kit. I used polymerase chain reaction (PCR) to amplify a 19

33 fragment of mtdna, using the primers designed by Che et al. (2012) to target cytochrome oxidase subunit I (COI) in amphibians. For each sample, a 25-µL volume PCR reaction contained 1-µL of genomic DNA, 0.6-µL of each primer (forward and reverse), 17.5-µL ddh 2 O, and 5.3-µL of Dreamtaq Mastermix. The PCR conditions followed the procedure recommended by Che et al. (2012) using a Bio-Rad T100 thermo cycler. To validate the presence of PCR product, 1.5% agarose gel electrophoresis was used to validate the presence of PCR product. 2-µL of ExoSAP-IT was added to each PCR reaction tube to remove unincorporated nucleotides. All samples were sent to Eurofins Scientific (Louisville, Kentucky, USA) to be sequenced. Sequences were manually trimmed using Geneious v (Kearse et al., 2012) and aligned using the ClustalW algorithm in MEGA 7 (Tamura et al. 2015). I identified reference DNA sequences available on GenBank using the BLAST feature in MEGA 7, in order to validate species and reconstruct phylogenetic relationships. A maximum likelihood analysis was run in the program RaxML v7.2.8 (Stamatakis, 2014) using a GTR+GAMMA distribution and each codon was partioned for 1,000 bootstraps. A Bayesian inference analysis was run in the program MrBayes (Huelsenbeck & Ronquist, 2005). The best model of substitution for each codon position was selected using Akaike information criterion (AIC) values calculated in the program jmodeltest (Darriba et al., 2012). The SYM+G model of nucleotide substitution was used for the 1 st codon position and the HKY+G model of nucleotide substitution was used for the 2 nd and 3 rd codon positions. Bayesian inference analysis was performed with 4 Markov chains for 40,000,000 generations sampled every 10,000 generations. The consensus topology was uploaded into the program FigTree v1.4.2 (download here: 20

34 for both analyses. A Median-Joining network was constructed in the program POPART (Leigh & Bryant, 2015) to visualize haplotype relationships among larvae samples with traits assigned to body size categories. MEGA 7 was used to compute pairwise differences among larvae using a maximum composite likelihood method with complete deletion of gaps and missing data. The program DnaSP v6 (Librado & Rozas, 2009) was used to calculate nucleotide and haplotype diversity among the data set of salamander larvae samples. Results Twenty-five cryptic salamander larvae (Figure 1), three putative P. ruber larvae, an adult putative D. ochrophaeus and an adult putative E. bislineata were sequenced 626 bp of COI from 30 salamander tissue samples. I combined these 30 samples with a sample of E. bislineata, D. fuscus, D. ochrophaeus, P. ruber, and P. ouachita from Genbank for a final alignment of 36 sequences. One adult (FTB009) and 25 larval samples were genetically identified as E. bislineata, three larval samples as P. ruber (FTB13, FBT18, FTB16), and one adult sample to D. ochrophaeus (FTB14) (Figure 2). Among the E. bislineata larvae sequence data (415 bs excluding sites with missing data/gaps): three haplotypes were present (Hd=0.557, sd=0.043, Figure 3), three variable sites were identified, there was relatively low nucleotide diversity (π= ), an insignificant proportion of rare haplotypes (Fu s F=0.572, P>0.05), and an insignificant negative Tajima s D value ( , p= ). Average sequence pairwise distance was among E. bislineata larvae. 21

35 Figure 1. Eurycea bislineata larvae morphology in Tyron Woods, Crawford County, Pennsylvania. Photo Credit: Dr. Josiah Townsend (2017). 22

36 Figure 2. COI phylogeny of salamander larvae from Tyron Weber Woods, Crawford County, Pennsylvania. Maximum Likelihood bootstrap support values are displayed and Bayesian Inference posterior probabilities are displayed above branches. Figure 3. Median-joining network of E. bislineata COI haplotypes. The body size classification of each sample is indicated by color. 23

37 Discussion Stream salamanders are considered difficult study animals due to their cryptic morphology, which could be susceptible to observer bias (Crocker et al., 2007). This study confirmed the utility of DNA barcoding with larval salamanders when conducting biological inventories in streams. Before generating the results, our students hypothesized that more than one species of salamander was sampled because of the two obvious size classes. Larval stream salamanders grow slower compared to vernal pool amphibians (Bank et al., 2006), and it is likely the different sizes of larvae found represented cohort, associated with two different reproductive events. The length of the larval stage of E. bislineata is two to three years (Bruce, 1982) and breeding takes place during March and April following hibernation (AmphibiaWeb, 2018). Variation in the timing of metamorphosis among larvae of the same cohort has been observed, with most of the larvae passing into a pre-metamorphic stage during their second winter and a few larvae lagging behind a year (AmphibiaWeb, 2018). The body size variation of the Tyron Weber Woods population could, alternatively, represent differenial growth rates among the same cohort. The presence of an adult D. ochrophaeus alongside the stream where we sampled for salamander larvae suggests species interactions is taking place between E. bislineata and D. ochrophaeus. There have been no detailed studies looking at interactions between these two species in sympatry (AmphibiaWeb, 2018). Desmognathus ochrophaeus has a relatively short larval stage, ranging from several days to several months, that is hypothesized to be dependent on temperature and moisture (AmphibiaWeb, 2018). Eggs are deposited under moist logs less than 0.5 meters from water and studies have shown that in some cases, larvae may never enter water but rather 24

38 transform in the egg (Amphibiaweb, 2018), which would explain why only E. bislineata larvae was captured. I suggest that future research in this area continues to DNA barcode larvae in Tyron Weber Woods as well as characterize habitat conditions for each species. Salamander species tend to have unique niches and ranges of microhabitat conditions that they can inhabit, therefore properly identifying species presence can be useful in elaborating on stream conditions such as water temperature ranges and sediment surface area (Welsh & Hodgson, 2008). Additionally, larval polymorphisms for E. bislineata is unknown, so further exploration of larvae morphology is suggested. Our low genetic diversity is likely a result of related individuals being captured. 25

39 CHAPTER 4 CHARACTERIZING MICROHABITAT PREFERENCE AND GENETIC DIVERSITY OF THE VALLEY AND RIDGE SALAMANDER (PLETHODON HOFFMANI) IN THE ALLEGHENY PLATEAU, PENNSYLVANIA Introduction Ecology Microhabitat strongly influences the spatial distribution of animals and plants (Farallo & Miles, 2016; Pelletier & Carstens, 2016), with the selection of optimal thermal environments driven by seeking to minimize metabolic expenditure and maximize energy consumption (Peterman & Semlitsch, 2013). The relationship an organism has with its environments can shed light on dispersal, population dynamics, and evolutionary potential, especially how the species will react to climate change and anthropogenic land use changes (O Donnell et al., 2014; Costa et al., 2015). Terrestrial salamanders tend to be limited in their dispersal and are therefor dependent on the conditions of their immediate environmental conditions (Kuchta et al., 2016). The topography of a landscape can impact surface temperatures especially in the case of sloping landscapes altering solar exposure and ultimately soil moisture (Peterman & Semlitsch, 2013), which is a necessary factor in Plethodon activity and ultimately foraging and reproduction. Many studies have looked at the relationship between terrestrial salamander abundance and environmental variables (Costa et al., 2015; O Donnell et al., 2015; Peterman & Semlitsch, 2013), with the results depending on which species is being studied. Therefor, it is important to do focal studies rather than assuming all terrestrial salamanders are responding the same. Plethodon albagula prefers 26

40 habitat with low solar exposure, denser canopy cover, and higher moisture, factors that also play a role in prey abundance (Peterman & Semlitsch, 2013). Speleomantes strinatii, a Plethodontid salamander in Italy, abundance was dependent on the presence of rock and hillside aspect Costa et al. (2015). The best predictor of Plethodon serratus abundance in Dent County, Missouri, was the amount of course woody debris and aspect (O Donnell et al., 2015). In sympatry, the widespread P. cinereus utilized different microhabitats than two microendemics, P. sherando and P. hubrichti, with the P. cinereus utilizing cooler temperatures and higher humidity (Farallo & Miles). These examples highlight that Plethodontid species have a unique relationship with their environment, emphasizing habitat variables that maximize microhabitat conditions necessary for survival. Determining what environmental factors are associated with abundance and distribution of Plethodon salamander species can shed light on the optimal thermal environment necessary for physiological performance (Farallo & Miles, 2016). Fortunately in the light of ongoing climate change, range expansion into suitable habitat is not entirely restricted. For example, nine Plethodontid salamander species have undergone elevational range changes in the southern Appalacian Mountains, with foothill species expanding into higher elevation and montane species expanding into lower elevations. Proposed causes of these range expansion are changing climate, forest maturation, and species interactions (Moskwik, 2014). In instances where populations are surrounded by fragmentation, dispersal events to accommodate the necessity of environmental conditions that facilitate metabolic needs will be more challenging (Cushman, 2006). 27

41 Phylogeography Phylogeography is the study of how historica processes have shaped current species distributions using molecular techniques (Zamudio et al., 2016). Mitochondrial genes are a popular choice for analyzing phylogenetic and population genetic questions due to their relatively rapid rates of evolution (Suzuki et al., 2015). Populations of amphibians on the periphery of their range are inferred to inhabit conditions near to their physiological limits, therefore understanding population genetic structure and variation in these populations is important to predict species potential ability to adapt or disperse in changing climatic environments (D Aoust-Messier & Lesbarreres, 2015). Many species of amphibians exhibit genetic signals of distributional fluctuations in response to shifts in climate during the Pleistocene glaciation events cycle (Canestrelli et al., 2008). Intraspecific genetic diversity was greatly affected and can be used to assess for past refugia during the last glacial cycle (Lee-Yaw et al., 2007). Recently deglaciated areas will have lowest level of genetic diversity because of late episodes of founder effects further from the source population while populations closer to the glacial refugium are expected to show higher levels of genetic variation due to more time for genetic drift (D Aoust-Messier & Lesbarreres, 2015). Inferring historical post-glacial colonization movement in species allows for investigation of population resilience to environmental changes and can assist in identifying environmentally stable refugia necessary under accelerated anthrpogenic climate change (Gavin et al., 2014; Gunnar et al., 2011). 28

42 Objectives In this study, I used genetic markers to infer genetic structure among nine P. hoffmani populations in the Allegheny Plateau and recorded habitat characteristics and surface-active weather conditions of seven well-defined populations (multiple observations during a single visit). The remaining two populations (Pine Ridge and Bear Cave; Figure 3) were difficult to observe due to a single observation prior to the start of the spring field season. The localities of all historically-known P. hoffmani populations in Indiana County were supplied by Ed Patterson, the director of Indiana County Parks and Trails and a member of the Pennsylvania Amphibian Reptile Survey (PARS). Following data collection, each population could be categorized as co-occurring (sympatric) with P. cinereus or as exclusive (allopatric) of P. cinereus during the spring season. These populations may deviate from these categories during other seasons. Limited studies have evaluated sympatric interactions in P. hoffmani and P. cinereus populations (Carlson et al., 2016; Adams & Rohlf, 2000; Angle, 1969), a demonstration only found in the northern part of P. hoffmani s range (Adams & Rohlf, 2000). Both of these species are within the P. cinereus clade of the Plethodon genus (Highton et al., 2012) and are consequently relatively cryptic, especially in cases where P. cinereus lacks a well-defined red dorsal stripe. To validate individuals to species and infer phylogenetic structure among and within P. hoffmani populations, I used two mtdna loci, Cytochrome oxidase I (COI) and Cytochrome-b (cyt-b). COI is considered the fragment of choice for DNA barcoding (Ratnasingham & Herbert, 2007), and proved to be an effective marker for cryptic Plethodontid species in northwestern Pennsylvania (Chapter 3). Cytochrome-b (cyt-b) is considered the most effective genetic marker for estimating phylogenetic 29

43 relationships among species that are closely related (Patwardhan et al., 2014). Most of the sequence data available on Genbank for Plethodon species is cyt-b sequences, rather than COI (Bayer et al., 2012), so cyt-b was also useful for visualizing P. hoffmani s relation to other Plethodon species. I hypothesized that genetic structure among and within populations could be used to infer a relative age for each population relative to range expansion. The ecological data recorded was used to estimate physiological tolerances for this species at the northern edge of its range, with northward expansion expected in response to climate change. Methods Data Collection During the spring of 2017 (March 24-May 6), seven forested sites with populations of P. hoffmani in Indiana County, Pennsylvania, were visited to sample for salamanders under cover objects (logs and rocks). Three of the sites had P. hoffmani but not P. cinereus and were characterized as allopatric and four of the sites had both species and were characterized as sympatric with P. cinereus (Figure 4). 30

44 Figure 4. Localities of P. hoffmani populations that had habitat and weather variables recorded during sampling rvents. Red triangles indicate sympatric populations with P. cinereus and blue circles indicate allopatric P. hoffmani populations. TRU= Trusal, BS=Blue Spruce, GL=Game Lands. Indiana County, Pennsylvania (blacked out county in corner map of Pennsylvania) + adjacent Armstrong County, Pennsylvania. Each site was visited 1-3 times, with at least seven days between visits. The number of researchers present ranged from 1-4 persons. For each visit, 6-5 x 5 meter plots were placed randomly along the hillside using a random number generator and searched exhaustively by a single researcher. Prior to searching the plot, the following environmental variables were noted: relative humidity, air temperature, soil temperature, and leaf litter depth. Habitat characteristics were recorded for each plot including elevation, slope, aspect, and density of cover objects. Searches were timed and the number of cover objects turned was recorded. When captured, Plethodon individuals were placed in plastic zip lock bags with moist leaves and set on top of the cover object 31

45 to be processed following the search. I did not process salamanders that were not P. hoffmani or P. cinereus. Each salamander had the following morphological measurements recorded: 1) snout-vent length (SVL), 2) total length, 3) number of costal grooves, and 4) mass. Presence or absence of a mid-dorsal stripe and the age class (adult or juvenile) were also noted. Tissue samples were taken from the tip of each captured salamander s tail for DNA sequencing. Tissue was stored in a buffer solution of 0.25 M EDTA ph 7.5, 20% DMSO, and saturated NaCl. A visible implant elastomer (VIE) tag was injected into the side of each individual to prevent recapture data being incorporated into the genetic analyses. All salamanders were returned to their point of capture following the processing procedure. As noted previously, a single tissue sample was obtained from Pine Ridge County Park, Pennsylvania and Bear Cave Hallow in Westmorland County, PA, resulting in nine Allegheny Plateau populations represented in phylogeographic assessment (Figure 5). Furthermore, two P. hoffmani samples from a sympatric population in Cameron County, Pennsylvania were included to assess divergence between physiographic regions. As seen in Figure 5, Cameron County is outside of the Allegheny Plateau. Euclidean distances between each population are provided in Appendix A. 32

46 Figure 5. Expanded map of P. hoffmani populations including Cameron County samples (n=2) used for BI and ML analysis. Statistical Analyses of Ecological Observations All analyses were run in the program R (R Development Core Team, 2008). The pastecs package (Grosjean & Ibanez, 2014) and the stat.desc command were used to get summary statistics for habitat characteristics and weather conditions during P. hoffmani capture events. A t-test or Mann-Whitney s test was used to assess if these variables differed between population type (allopatric and sympatric). Additionally, a t-test or Mann-Whitney s test was used to assess if P. hoffmani SVL differed between population types (allopatric and sympatric). To determine which test to use, a Shapiro-Wilks test was used to check for normality. For normally distributed data, a Welches t-test was used and for abnormally distributed data, a Mann-Whitney s test was used. 33

47 DNA Sequencing and Genetic Diversity Analyses Genomic DNA was extracted from tissue samples using a PureLink Genomic DNA Mini Kit (Invitrogen by life technologies). Polymerase chain reaction (PCR) was used to amplify a portion of the cytochrome oxidase subunit I (COI) gene and a portion of cytochrome b (cyt-b). For COI, I used primers LepF1-T3 and LepR1 from Bayer et al. (2012) and for cyt-b, I used primers PcCytB-F-T3 and PcCytB-R from Bayer et al (2012) (Table 1). For both COI and cyt-b, PCR reactions were 25 µl per sample and made up of µl of nuclease-free autoclaved H 2 O, µl of mm MgCl2, µm of both primers (forward and reverse), µl mm dntps, µl of U/uL Taq polymerase, and 1.5 µl of genomic template DNA. COI PCR cycling conditions followed Bayer et al. s (2012) protocol: 94⁰C for 5 minutes, 34 cycles of 94⁰C for 30 seconds, 53.5⁰C for 1 minute, 72⁰C for 1.5 minutes, and finally 72⁰C for 5 minutes. Cyt-b PCR cycling conditions followed Bayer et al. s (2012) protocol: 94⁰C for 5 minutes, 34 cycles of 94⁰C for 30 seconds, 47⁰C for 1 minute, 72⁰C for 45 seconds, and finally 72⁰C for 5 minutes. Table 1 Primers Used for COI and Cyt-B PCR Gene Primer Sequence Reference COI (LepF1- Forward AATTAACCCTCACTAAAGATTCAA CCAATCATAAAGATATTGG Bayer et al. (2012) T3) COI Reverse TAAACTTCTGGATGTCCAAAAAAT Bayer et al. (LepR1) Cyt-b (PcCytB- F-T3) Cyt-b (PcCytB- R) Forward CA AATTAACCCTCACTAAAGGGCTC AACCAAAACCTTTGACC 34 (2012) Bayer et al. (2012) Reverse TAGCCCCCAATTTTGGTTTACA Bayer et al. (2012)

48 Agarose (1.5%) gel electrophoresis was used to validate the presence of PCR product and then 2-µL of ExoSAP-IT was added to each PCR reaction tube to remove unincorporated nucleotides. All PCR products were sequenced at Eurofins Scientific (Louisville, Kentucky, USA). Forward and reverse sequence data were combined into contiguous fragment using the De Nova Assemble function and then trimmed in the program Geneious (Kearse et al., 2012). Assembled contigs were aligned using the ClustalW feature in MEGA 7 (Tamura et al. 2015). Sequences were then translated into amino acids and assessed for premature stop codons using MEGA 7 and then exported for further analyses. MEGA 7 was also used to compute pairwise differences among salamanders using a p-distance method with a 95% partial deletion of gaps and missing data. Sequences were blasted for additional Genbank sequences (Appendix B) and aligned using the ClustalW feature in MEGA 7 (Tamura et al. 2015) for COI, cyt-b and a concatenated data set of COI and cyt-b. Sequence diversity, DNA divergence, and gene flow among and within populations was inferred using the program DnaSP v6 (Librado & Rozas, 2009). Genetic diversity was analyzed for each population separately and was measured by number of variable sites, nucleotide diversity (π), haplotype diversity (Hd), Fu s F, and Tajima s D. Fu s F statistic is a measurement of rare haplotypes (Bayer et al., 2016) and Tajima s D statistic is the difference between nucleotide diversity and segregating sites (Delmore et al., 2015), which can indicated a demographic change event such as a bottleneck or a founder event if it is significant (Natoli et al., 2017). Comparing genetic diversity among populations can be used to infer age of populations, with higher degrees of genetic diversity expected in populations that have been there longer (D Aoust-Messier & 35

49 Lesbarreres, 2015). DNA divergence was assessed between each population by measures of pairwise nucleotide differences, the average nucleotide substitutions per site (Dxy) and the net nucleotide substitutions per site (Da) (Wakeley, 1996) between populations. Gene flow was inferred by the pairwise Fst value generated among populations. An Fst value closer to 0 indicates no differentiation among populations and a high probability of gene flow, while an Fst value closer to 1 indicates high degree of differentiation among populations and reduced probability of gene flow (Alcala & Rosenberg, 2017). Phylogenetic Reconstruction A maximum likelihood (ML) analysis was performed in RAxML v7.2.8 (Stamatakis, 2014) with the raxmlgui v1.5 under the GTR+GAMMA substitution model with 1,000 bootstrap replicates partitioned by codon and gene. MrBayes (Huelsenbeck & Ronquist, 2005) was used to perform Bayesian inference (BI) analysis. The best model of substitution for each codon position was selected by Akaike information criterion (AIC) values using the program jmodeltest (Darriba et al., 2012). The models of nucleotide substitution used for each codon can be seen in Table 2. Bayesian inference analysis was performed with two parallel runs of four Markov chains for 40,000,000 generations and sampled every 10,000 generations. Partitions were set for each codon and gene. Consensus topologies were visualized and edited using FigTree v1.4.2 (download here: Haplotype diversity was visualized using the Median-Joining algorithm in the program POPART (Leigh & Bryant, 2015). 36

50 Table 2 Models of Nucleotide Substitution Used in Bayesian Inference Analyses Gene Codon 1 Codon 2 Codon 3 COI HKY GTR GTR Cyt-b HKY+I GTR+I GTR+I Concatonated (COI + Cyt-b) HKY HKY+I HKY+I Results Habitat Characteristics and Surface Active Conditions Thirty P. hoffmani individuals were included in the ecological assessment, 16 allopatric captures and 14 sympatric captures. P. cinereus captures were not included in the assessment, with a focus on P. hoffmani surface-active conditions in the presence and absence of P. cinereus. Table 3 shows summary statistics for P. hoffmani s occupied habitat characteristics and Table 4 shows surface active conditions at prior to capture. Table 3 Habitat Characteristics for all Occupied Plots for Populations in the Allegheny Plateau Variable Mean Min Median Max sd Elevation (m) Aspect (⁰) Slope (⁰) # of Cover Objects

51 Table 4 Surface Active Conditions for Populations in the Allegheny Plateau Variable Mean Min Median Max sd Air Temperature (⁰C) Soil Temperature (⁰C) Leaf Litter Depth (inches) A table showing the range of habitat characteristics for each site can be found in Appendix I. The number of cover objects available in occupied plots was higher (t=2.4927, df=21.921, p-value= ; Figure 6) for surface-active sympatric P. hoffmani populations (Δ= 36 Cos) than allopatric P. hoffmani populations (Δ= 21.31). Figure 6. Box plots comparing number of cover objects in plots for capture occasions for allopatric (Allo) and sympatric (Sym) P. hoffmani populations in the Allegheny Plateau. P. cinereus captures are not included. Air temperature at capture did not differ between population types (W= 76, p- value=0.6979; Table 5; Figure 7) and neither did the soil temperature (W= 123, p-value= 38

52 0.6612; Table 5; Figure 8). Relative humidity at capture did differ between populations (W= 122, p-value= ; Table 5; Figure 9), with higher humidity values at sympatric sites. Leaf litter depth at capture did not differ between population types (W=147.5, p- value= ; Table 5; Figure 10). Table 5 Mann-Whitney U Test Summary Statistics of Surface Active Conditions for Allopatric and Sympatric P. hoffmani populations with P. cinereus. W p-value Surface Active Conditions +/- P. cinereus +/-P.cinereus Air Temperature ( C) Soil Temperature ( C) Relative Humidity (%) Leaf litter depth (cm) P. cinereus are allopatric sites, + P. cinereus are sympatric sites, 16 allopatric and 14 sympatric P. hoffmani captures were included in analysis. Figure 7. Box plot comparing air temperature ( C) at capture occasions for allopatric (Allo) and sympatric (Sym) P. hoffmani populations. P. cinereus captures are not included. 39

53 Figure 8. Box plots comparing average soil temperature ( C) at capture occasions for allopatric (Allo) and sympatric (Sym) P. hoffmani populations. P. cinereus captures are not included. Figure 9. Box plots comparing relative humidity (%) at capture occasions for allopatric (Allo) and sympatric (Sym) P. hoffmani populations. P. cinereus captures are not included. 40

54 Figure 10. Box plots comparing average leaf litter depth (cm) at capture occasions for allopatric (Allo) and sympatric (Sym) P. hoffmani populations. P. cinereus captures are not included. The average adult SVL among all P. hoffmani populations in the Allegheny Plateau (n=9) was mm (n=43, range: mm, sd= ). This analysis included 43 salamanders; individuals from Pine Ridge County Park and Bear Cave Hallow were included in this analysis as well as additional individuals that were captured outside of the randomly placed plots at each site while looking to enhance tissue samples for each location. The average SVL for P. hoffmani captures did not differ between allopatric and sympatric populations (W=213.5, p=0.6788, Figure 11). 41

55 POP.TYPE ALLOPATRIC SYMPATRIC 50 Snout Vent Length (mm) ALLOPATRIC Population SYMPATRIC Figure 11. Snout to vent length (SVL) for P. hoffmani in the absence of (allopatric) and the presence of (sympatric) P. cinereus. 22 allopatric measurements and 21 sympatric measurements were included. Sequences and Genetic Diversity Twenty-nine COI sequences (637 bps) representing 10 P. hoffmani populations (Figure 3) were analyzed for genetic diversity within and among populations. Two individuals from Blue Spruce County Park were difficult to identify based on costal groove count; cyt-b sequence for those sample were blasted in MEGA 7, they were matched with P. hoffmani sequences, so those samples showed these two represented P. hoffmani. Among the COI dataset, there was a single haplotype (Hd: ), and therefore variable sites, average pairwise distances, nucleotide diversity, nucleotide divergence, and average nucleotide differences between populations were all All analyses were run with missing data and gaps excluded. 42

56 Twenty-eight Cyt-b sequences (584 bp) representing 8 populations (excluding Blue Spruce 2 and Bear Cave Hallow due to amplification difficulties) were analyzed for genetic diversity within and among populations. Pairwise distances between sequences is in the appendices (Appendix C). The overall mean pairwise distance was Genetic diversity was first assessed excluding samples from Cameron County from the dataset. There were seven haplotypes (Hd=0.471), nine variable sites, 1.33 average nucleotide differences (k), and low nucleotide diversity (π= ) among the seven populations. The Allegheny Plateau populations have an Fu s Fs statistic of and an insignificant Tajima s D value of Including the Cameron County population, the Fu's Fs statistic was , the Tajima's D value was (insignificant), and an additional haplotype was added (Hd: 0.495). Genetic differentiation was low among the Allegheny Plateau populations (Fst= , Nm=13.33). When the Cameron County population was added to the analysis, the Fst value increased slightly (Fst= , Nm= 12.02) but it was still very low. Within each population, genetic diversity was calculated (Table 6). The Trusal Road population had the highest nucleotide diversity (π = ), followed by the Game Lands population (π = ). The Kittaning population had the lowest nucleotide diversity (π = ), followed by the Cameron County population (π = ) and the Young Township population (π = ). The Trusal Road also had the highest degree of rare haplotypes (Fu s F=2.220) followed by the Young Township populations (Fu s F= 2.197). None of the populations had a significant Tajima s D value. 43

57 Table 6 Genetic Diversity Within Each Population Site Kittaning (n=5) Young Township (n=4) Tanoma (n=3) Trusal (n=4) Blue Spruce 1 (n=5) Game Lands 332 (n=4) Cameron County (n=2) Variable Sites Nucleotide Diversity (π) Number of Haplotypes Haplotype Diversity (Hd) Fs Tajima s D NA NA Pine Ridge (n=1) NA NA NA NA NA NA Fs=Fu s F statistic The Trusal Road population had the highest number of nucleotide differences between all populations, with the most being between the Game Lands 332 population (Table 7). The Game Lands 332 populations had the second highest number of nucleotide differences between populations. The degree of genetic divergence (Dxy, Da) was estimated between all populations (Table 8). Similarly to the results of nucleotide 44

58 differences, the Trusal Road population had the highest degree of divergence from all populations, with the highest divergence from the Game Lands 332 population (Dxy= ). Table 7 Average Nucleotide Difference Between Populations Site Kittanin g (n=5) Young Townshi p (n=4) Tanoma (n=3) Trusal (n=4) Blue Spruce 1 (n=5) Game Lands 332 (n=4) Camero n County (n=2) Pine Ridge (n=1) Kittanin g (n=5) Young Townshi p (n=4) Tanom a (n=3) Trusa l (n=4) Blue Spruc e 1 (n=5) Gam e Land s 332 (n=4) Camero n County (n=2) Pine Ridg e (n=1) NA NA NA NA NA NA NA NA 45

59 Table 8 DNA Divergence. Note Dxy and Da are reported between each population Site Kittanin g (n=5) Kittani ng (n=5) Young Towns hip (n=4) Tanom a (n=3) Trusal (n=4) Blue Spruce 1 (n=5) Game Lands 332 (n=4) Camer on Count y (n=2) Pine Ridg e (n=1 ) NA Young Townshi p (n=4) ; NA Tanoma (n=3) ; ; NA Trusal (n=4) ; ; ; NA Blue Spruce 1 (n=5) ; ; ; ; NA Game Lands 332 (n=4) ; ; ; ; ; NA - - Camero n County (n=2) ; ; ; ; ; ; NA - Pine Ridge (n=1) ; ; ; ; ; ; ; NA Twenty-five sequences from our study were combined in the concatenated COI and cyt-b dataset with a total length of 1225 bp. Twenty-three P. hoffmani and 2 P. cinereus sequences (KC1021 and KC2004) representing 8 populations (Excluding Blue 46

60 Spruce 2 and Bear Cave Hallow due to amplification difficulties for cyt-b). Four additional sequences were added from Genbank (AY728222, AY728223, AY728232, NC_006335). Sequence diversity was not calculated due to the different rate of evolution between COI and cyt-b. In MEGA, the alignment had 412 variable sites and 833 conserved sites. Pairwise distances between samples (P. cinereus and P. hoffmani) are in the appendices (Appendix D). The average pairwise distance was for all samples from this study. For only P. hoffmani samples, the average pairwise distance was Phylogenetic Reconstruction Fifty-one sequences were included in the COI phylogenetic analysis, with 29 sequences representing P. hoffmani and 4 sequences representing P. cinereus from my study area. The additional Genbank samples are provided in Appendix B. All P. hoffmani sequences were homogenous and are displayed on a single branch with strong BI posterior probability (PP: 1.00) and ML bootstrap values (ML=100) (Figure 12). The two samples that were difficult to identy to species were included in the P. hoffmani clade (KC1031 and KC1023). Both maximum likelihood and Bayesian inference topologies were congruent with eachother. 47

61 Figure 12. COI BI and ML consensus phylogeny of Plethodon salamanders. Maximum likelihood bootstrap scores and posterior probabilities are displayed above the branch. Samples from this study begin with KC and JHT. Green samples are P. hoffmani, red samples are P. cinereus, pink samples are intermediates, and blue samples are from Genbank. Fifty-six sequences were included in the cyt-b phylogenetic analysis, with 30 sequences representing P. hoffmani and four sequences representing P. cinereus from our study area. The additional Genbank samples are provided in Appendix B. Both maximum likelihood and Bayesian inference topologies were congruent with eachother. This marker exhibited more structure within the P. hoffmani clade and I was able to visualize relationships among more Plethodon species due to greater availability of reference cyt-b sequences on Genbank for Plethodon (Figure 13). The P. cinereus group was well supported (BI: 1, ML: 93). The Plethodon hoffmani group was also well supported (BI: 0.98, ML: 94), with a reference P. hoffmani sample (AY378048) from Pedleton, West Virginia. The other reference P. hoffmani sample (AY378048) from Summers, West Virginia, is highly supported to be divergent from the rest of P. hoffmani (BI: 1, ML: 95). 48

62 Figure 13. Cyt-b BI and ML consensus phylogeny of Plethodon salamanders. Maximum likelihood bootstrap scores and posterior probabilities are displayed above the branch. Samples from this study begin with KC and JHT. Green samples are P. hoffmani, red samples are P. cinereus, pink samples are intermediates, and blue samples are from Genbank. A Median-Joining Network was constructed for cyt-b with colors assigned to each population (Figure 14). Black nodes represent estimated haplotypes that were either not sampled or have disappeared. Each hash mark indicated a single variable site between the haplotypes. 49

63 Figure 14. Cyt-B Median-joining network of Allegheny Plateau populations + Cameron County Twenty-nine sequences (1225 bp) were included in the concatenated COI and cytb data set. 23 P. hoffmani and two P. cinereus sequences (KC1021 and KC204) representing eight populations (Excluding Blue Spruce 2 and Bear Cave Hallow due to amplification difficulties for cyt-b). Four additional sequences were added from Genbank (AY728222, AY728223, AY728232, NC_006335). Expectedly, the concatenated topology was congruent with those from individual genes as well and received significant Bayesian inference scores (top clade: BI: 0.98, ML: 58; bottom clade: BI: 0.85, ML: 59; Figure 15), but reluctantly received low posterior probability scores. 50

64 Figure 15. Concatenated COI and cyt-b BI phylogeny of Plethodon salamanders. Maximum likelihood bootstrap scores and posterior probabilities are displayed above the branch. Samples from this study begin with KC and JHT. Green samples are P. hoffmani, red samples are P. cinereus, pink samples are intermediates, and blue samples are from Genbank. Ecology Discussion Results from this study suggest that the sampled P. hoffmani populations may be selecting for habitat in forested landscapes with an elevation between meters, a southwestern facing aspect, and on a pronounced sloping hill. These biotic factors interact to form unique microhabitats, which often limit the distribution of animals that are sensitive to their environment (Peterman & Semlitsch, 2013). Amphibian distribution patterns that are linked to elevation are likely driven by the moisture and temperature requirements of that species (Caruso et al., 2017) but can also be a result of niche conservatism or interspecific competition (Lyons et al., 2014). Aspect and slope are known for their role in creating optimal conditions for plant community structure, due to their interaction affecting solar exposure and ultimately creating unique microclimates 51

65 (Peterman & Semlitsch, 2013). Occupied 25 m 2 plots had numerous cover object availability (average= 28.33). Cover objects are an important source of shelter for terrestrial salamanders, especially during the day while hiding from predators. Carlson et al. (2016) found higher rates of occupancy under cover objects that exhibited temperature stability compared to cover objects that had varied temperatures. Having narrow ranges of temperature requirements, it would make sense that P. hoffmani is selecting for areas that have dense cover object availability to increase the chance of available temperature stable cover objects for offspring. The significant (p= ) increase in available cover objects in sympatric populations compared to allopatric populations may be highlighting a necessary habitat requirement for P. hoffmani and P. cinereus to co-occur. Carlson et al. (2016) found that less than 5% of cover objects occupied by P. hoffmani had more than one individual present over a two-year study and suggested that cover objects was not a limiting resource for that population. In this study, it seems that increasing the number of cover objects decreases its limiting resource potential, and allows for more than one cinereus group species to occur. The average temperature at capture events was relatively high for this species (19.56 C). Carlson et al. (2016) reported that P. hoffmani was observed between C and rarely occurred below 5 C or above 20 C. According to our results, populations in the Allegheny Plateau may have a higher temperature tolerance than populations in the Ridge and Valley, but sampling of more populations in both regions is suggestedsoil temperature and air temperature conditions did not differ between sympatric and allopatric populations, suggesting that this factor is not limiting co-occurrence in 52

66 allopatric populations. Carlson et al. (2016) found that surface activity was associated with air temperature and not relative humidity. This explains our wide range of relative humidity values ( %) during P. hoffmani capture. I would also be hesitant to consider the difference in relative humidity between allopatric and sympatric to be reflective of P. hoffmani populations (Figure 9) because this difference (p= ) could be an artifact of sampling sympatric populations during weather conditions that promote high relative humidity rather than the species response to that condition. The similar depth of leaf litter between allopatric and sympatric populations could be a result of both populations choosing forested hills with similar canopy cover density. Another explanation is that the occupied plots have a leaf litter depth that maintains soil moisture by trapping moisture on the forest floor. Both of these explanations may increase prey availability and ultimately salamander abundance, with invertebrate abundance documented to increase with moisture (Best & Welsh, 2014). Allegheny populations had slightly longer SVL measurements (average=45.98 mm, n=43) compared to the population monitored by Carlson et al. s (2016) where they found that the average SVL was 43.7 mm (n=107). One of our sites (Kittaning, Pennsylvania) had unusually large individuals, which may contribute to the difference. Phylogeography The cyt-b dataset exhibited some genetic diversity, but not much (pi= ). The low Fst value (Fst= ) suggests a lack of genetic divergence between populations (Alcala & Rosenberg, 2017) and the negative Fu s Fs statistic (-2.771) suggests an excess of rare alleles (Bayer et al., 2012). In areas that were recently expanded into, this excess of rare alleles (negative Fu s Fs) and lower genetic diversity 53

67 would be expected (Bayer et al., 2012). The Kittaning population had the lowest sequence diversity, lowest haplotype diversity, and the lowest Fu s Fs statistic value in the cyt-b dataset (Table 8). This makes sense looking at the map of the populations (Figure 5), with the Kittaning population furthest east. This population also had the largest body lengths, so these individuals may have possessed a measure of fitness that allowed for recent expansion into that area. The populations with the most genetic diversity were the Trusal population (pi= , Hd=0.83) and the Game Lands population ( , Hd=1.00). Additionally, Trusal had the highest number of nucleotide differences and degree of divergence from other populations, with the most being between the Game Lands. Because older populations are expected to have higher genetic diversity, these statistics suggest that these two populations have been established the longest out of the sampled populations (D Aoust-Messier & Lesbarreres, 2015). Factors that affect genetic diversity within a population include effective population size, mutation rates, and immigration while factors that affect genetic differentiation between populations is affected by gene flow and time since divergence (Zhou et al., 2013). Populations differentiation over time due to genetic drift, and therefor are expected to have a higher degree of differentiation the longer the populations are separated (Zhou et al., 2013; D Aoust-Messier & Lesbarreres, 2015). Lack of genetic diversity in the COI dataset for P. hoffmani populations was not expected, but allowed for reasonable conclusions regarding the age of these populations. I speculate that the observed low genetic diversity is due to recent expansion into new habitat following glacier retreats and therefor we are observing populations that have not had the time to accumulate within population diversity and genetic differentiation between populations. 54

68 Phylogenetic reconstruction using COI (Figure 12) showed expected relationships in regards to COI genetic diversity estimates, with all P. hoffmani samples falling on a straight line on a single clade. The cyt-b topology (Figure 13) recovered some structure for samples and was relatively consistent with the relationships recovered in the concatenated dataset (Figure 15), which is expected due to the lack of structure with COI. The Median-Joining Network (Figure 14) of cyt-b had a clearly defined ancestral haplotype, which can be found in each population, with several descendent haplotypes extending outward (Zhou et al., 2013). The Trusal population appears to have the most complex evolutionary history compared to the other populations, with multiple descendent haplotypes present. This trend aligns with the genetic diversity results, suggesting this population is the oldest. According to the genetic diversity statistics and the phylogenetic structure of COI and cyt-b, there is not strong support for deep genetic structure among Allegheny Plateau populations, and genetic differentiation is not strongly correlated with geographic distance. The intermediate Plethodon (KC1031 and KC1023) are hypothesized to be hybrid individuals between P. cinereus and P. hoffmani. Interestingly, during one of my first days sampling in Pine Ridge Park, I found three Plethodon salamanders under the same rock, one of which was P. cinereus while the other two were P. hoffmani. One of the P. hoffmani individuals had eggs visible. I did not find intermediates at this park, but the lack of cover object divergence during breeding season may be common enough to promote interspecific reproductive efforts. It is important to note that mitochondrial DNA is inherited maternally, therefor, a hybrid would be genetically identified as the maternal species rather than a mix of both. Lehtinen et al. (2016) discovered widespread 55

69 hybridization between P. cinereus and Plethodon electromorphus in Ohio using single nucleotide polymorphisms (SNPs) from three nuclear genes. Morphologically, the hybrid individuals were not significantly different than pure P. cinereus but were significantly different from pure P. electromorphus. The authors state that the hybrids would be misidentified as P. cinereus in the field. The intermediates discovered in our study have 19 costal grooves, a closer number to P. cinereus (18) than to P. hoffmani (21), so it is interesting that the maternal lineage is P. hoffmani. These findings inspired me to undertake a nuclear assessment of these intermediate individuals genotypes in the following chapter. 56

70 CHAPTER 5 CO-OCCURRENCE, MICROHABITAT ASSOCIATIONS, AND HYBRIDIZATION OF PLETHODON HOFFMANI AND PLETHODON CINEREUS IN WESTERN PENNSYLVANIA Introduction Plethodon Species Interactions Interactions between species that were previously isolated and have come into contact as a result of range shifts or expansion is inevitable (Iannella et al., 2017; Chunco, 2014). Consequences of these interactions are dependent on how closely related these species are and could result in hybridization, further speciation, and even extinction (Chunco, 2014). For species that occupy a similar niche, interspecific competition may affect whether these species can co-occur or whether one will exclude the other from that particular area (Bringloe et al., 2016). Among Plethodon salamanders, co-occurrence of species in this genus has resulted in varied responses including enhanced aggression between species, competitive exclusion, habitat differentiation and resource partitioning, character displacement, and hybridization (Dietloff et al., 2013). Interspecific competition can greatly affect the distribution of terrestrial salamander species, often limiting competing species' geographic ranges (Deitloff et al., 2013). The competition-relatedness hypothesis, which is credited to Darwin (1985), states that closely related species will compete more than distantly related species, ultimately limiting co-existence (Mayfield & Levine, 2010). There have been several cases where Plethodon species co-occur under similar niche spaces and enhanced interspecific aggression is observed. For example, Dietloff et al. (2013) found that 57

71 Plethodon electromorphus and Plethodon cinereus individuals in Ohio were more aggressive in sympatry compared to individuals that were allopatric. The researchers found that aggressive behavior at some sympatric sites was associated with morphological character divergence, but there was no evidence of different food resource use or cover object refuge differentiation (Dietloff et al., 2013). These species typically exclude each other throughout their distribution, so when inhabiting the same areas, intense competition is likely the driver of this exaggerated behavior (Dietloff et al., 2013). P. cinereus uses chemical signals to establish and maintain territories (Simons & Felgenhauer, 1992). Mathis et al. (1998) performed intraspecific laboratory experiments with P. cinereus to assess territorial behavior by exposing individuals to each other in the roles of resident and intruder. They found that residents made attacks, while intruders actively avoided conflict. Further, they found that individuals had the ability to recognize their own and a conspecific s scent mark (Mathis et al., 1998). The principle of competitive exclusion suggests that two species cannot coexist when they occupy the same niche, are not interbreeding, and one population is growing more than the other (Thurow, 1976). This principle could be driving Plethodon species that exclude other species of Plethodon, but many species are found in sympatry suggesting niche partitioning may be taking place. Farallo and Miles (2016) compared microhabitat requirements and habitat selectionfor a widespread Plethodon species (P. cinereus), and two microendemic Plethodon species (P. sherando and P. hubrichti) throughout the Appalachian Mountains within the range of all three species. They found that P. sherando utilizes microhabitat that is different from P. cinereus, which may be how these species coexist in contact zones (Farallo & Miles, 2016). 58

72 Another result of recent distribution overlap of closely related species is character displacement, which has been found to occur in sympatric Plethodon species. P. cinereus and P. shenandoah had species-specific differences in head shape across three mountains in the Shenandoah Mountains (Myers & Adams, 2008). In Ohio, morphology in allopatric and sympatric populations of P. cinereus and P. electromorphus differed in Ohio, with head shape differences being location-specific and divergence and convergence occurring unpredictably with a similar food resource use across study (Dietloff et al., 2013). These varied results highlight the differences in selection pressures across different locations which maybe be depedent on the age of contact zones (Dietloff et al., 2013), making localized ecological assessments an important component of cooccurrence studies. Hybridization in Plethodon Salamanders Many Plethodon pairs undergo extensive hybridization in narrow zones of contact where closely related species are not completely reproductively isolated, which can take millions of years to become established (Highton, 1995). Studies that have assessed for hybridization between sympatric Plethodon species have provided evidence that this is not an uncommon phenomenon. Hybridization between P. richmondi and P. electromorphus was confirmed in contact zones using morphology and allozyme data (Highton, 1999). Additionally, symmetrical hybridization between P. cinereus and P. electromorphus Ohio populations was verified using mitochondrial DNA, nuclear DNA, and morphology. The extent of hybridization was underestimated using morphology and coloration alone, emphasizing the importance of genetic analysis (Lehtinen et al., 2016). Hybridization between P. cinereus and P. sherando populations was assessed using 59

73 mtdna and morphology, with no evidence for introgression (Bayer et al., 2012), unfortunately nuclear genetic assessment was not included and may have resulted in underestimated results. Introgression may be evidence of current or historical hybridization (Weisrock et al., 2005). Introgression is traditionally the movement of alien alleles across geographic distance, but is now commonly used to refer to mixing of alleles between sympatric species (Arntzen et al., 1998). Range shifts and distributional overlap in response to glacial advances suggests that many closely related species may have experienced continuous exposure to different lineages with the potential for hybridization in the past, which would be evident using molecular analyses (Weisrock et al., 2005). Evidence of historical hybridization has been uncovered in incongruent genealogies for several amphibians (Vogal & Johnson, 2008; Nelson et al., 2017; Sequeira et al., 2011; Liu et al., 2010; Chen et al., 2009; Weisrock et al., 2005). Using a single genetic marker may underestimate the evolutionary history of an organism due to variations in the rate of evolution for genes, therefore, it is suggested that multiple genes are included in drawing conclusion (Patwardhan et al., 2014). Research Objectives and Species of Interest In this chapter, I used genetic markers and repeated count surveys to explore species interaction between P. hoffmani and P. cinereus in Blue Spruce County Park, Pennsylvani. This study was developed as part of an iterative approach to research the two intermediate Plethodon salamanders that were discovered in the spring of 2017 (Chapter 4). Plethodon hoffmani typically have 21 costal grooves and P. cinereus have 18 costal grooves; two individuals that exihibited a pattern like P. hoffmani and had 19 60

74 costal grooves are referred to as intermediates. Maternally, these two individuals were P. hoffmani according to mtdna analysis, but without nuclear assessment, I could not confidently confirm that the paternal lineage was also P. hoffmani. This raised the question as to whether these species are hybridizing. I hypothesized that these closely related species are hybridizing as a consequence of incomplete reproductive isolation, and the hybrid offspring exibited intermediate phenotype. If these species are hybridizing, then I hypothesize that P. hoffmani and P. cinereus are not utilizing habitat differently and are active in similar microhabitat conditions when surface active. Plethodon hoffmani and P. cinereus have similar reproductive cycles when they co-occur. All species deposit their eggs in early summer (May or June), P. cinereus mates in spring and fall, and P. hoffmani mates primarily in the spring and rarely in the fall. Both species eggs hatch in September, with P. cinereus hatchlings surfacing earlier than P. hoffmani (Angle, 1969). Consequently, there is a lack of temporal reproductive isolation between P. cinereus and P. hoffmani, which may promote hybridization if Blue Spruce County Park populations. Study Area Blue Spruce County Park was established by Indiana County in 1966, but has been used recreationally since the early 1900s. This 650-acre public park is managed by Indiana County Parks & Trails of west-central Pennsylvania. The park contains over five miles of trails, designated hunting areas, and a 12-acre trout-stocked lake, making it a recreational area for Indiana County residents (IndianaCountyParks.org, accessed May 10 th, 2018). Recreational use of the park promotes habitat conservation for P. hoffmani populations within the park. 61

75 Methods Data Collection During the Fall of 2017 (September-November), I conducted repeated count surveys in Blue Spruce County Park, Pennsylvania for Plethodon salamanders in order to characterize occupied habitat and surface active conditions for P. cinereus, P.hoffmani, and intermediate Plethodon individuals. Using ArcMap (ESRI, 2011), 10 points were randomly placed on two hillsides where P. hoffmani populations had been detected in the spring of 2017 and 30 points were randomly placed throughout the rest of the park. Each point was spaced at least 20 meters apart to promote independence from each other, with the knowledge that P. hoffmani exhibits high site fidelity and is recaptured within a few meters of previous capture events (Carlson et al., 2016). Each point was located using a GPS unit that had the coordinates for each point loaded onto it beforehand. During the first round of sampling, eight of the points were discarded due to inaccessibility or unsuitable habitat for salamander presence (i.e. road, water source, trail path), leaving 32 points (Figure 16). Once the point was located, a 36 m 2 plot was outlined using flagging tape and brightly colored stakes in all four cardinal directions (square plots were 6 x 6 m and covered a total area of 1,152 m 2 in the park). 62

76 Figure 16. Randomly placed points in Blue Spruce County Park. 10 points were placed in historically known hillsides (circles) and 22 additional points were place in the surrounding area of the park. Plot characteristics were recorded including: (1) elevation as determined using a GPS unit, (2) aspect using a compass in degrees, (3) slope using an inclinometer, (4) number of living trees over 2 meters in height, and (5) canopy cover using a densiometer. Each plot was visited five or six times, during daylight hours ( ) every 7-14 days. At each visit, the following variables that could influence the detection of Plethodon salamanders were collected: (1) visually estimated percentage coverage of leaf litter, (2) visually estimated percentage coverage of bare soil, (3) visually estimated percentage coverage of herbaceous plants, (4) visually estimated percentage coverage of course woody debris, (5) visually estimated percentage coverage rock, (6) air temperature with a Kestrel 3000, (7) relative humidity with a Kestrel 3000, (8) average leaf litter depth (out of 4 measurements) using a ruler in inches, and (9) average soil temperature 63

77 (out of 4 measurements) using a temperature probe in Celsius. All plots were searched exhaustively. The time of day was recorded at the beginning of the search as well as at the end of the search to determine the length of each search effort. Cover objects (rocks and logs) were lifted to look for salamanders during the search. Leaf litter was not raked through to prevent disturbing the habitat. The number of rocks lifted and the number of logs lifted was recorded. Only one investigator performed all searches to reduce observer error. When salamanders were encountered, the individuals were placed in bags on top of the cover object and adults were processed at the end of the search. Juveniles were not encountered and were not intended to be included due to the cryptic nature of Plethodon juveniles. Each adult Plethodon salamander was identified to species by morphological features including coloration and costal groove count. Individuals with 18 coastal grooves were characterized as P. cinereus, individuals with 21 costal grooves were characterized as P. hoffmani, and individuals with 19 costal grooves and no middorsal stripe were characterized as intermediates between the two species. P. glutinosus was also encountered and recorded as present but we did not capture individuals. Additional measurements included snout-vent length (SVL) (mm), total length (mm), and weight (g). Tissue samples were taken from the tip of each captured salamander s tail for DNA sequencing. Tissue was stored in a buffer solution of 0.25 M EDTA ph 7.5, 20% DMSO, and saturated NaCl. Salamanders were returned to their point of capture after being processed. Statistical Analyses All analyses were run in the program R (R Development Core Team, 2008). I intended to use the data from this study design to run N-Mixture models (Royle, 2004) 64

78 using the unmarked package (Fiske & Chandler, 2011) to model detection and abundance for each species in response to environmental variables. Low detection of P. hoffmani (n=5) and intermediate Plethodon (n=6) during sampling prevented N-Mixture modeling. P. cinereus was relatively abundant (n=32) but I was not interested in modeling this species without comparative data. The pastecs package (Grosjean & Ibanez, 2014) and the stat.desc command was used to calculate summary statistics for habitat characteristics and weather conditions at capture locations for P. cinereus, P. hoffmani, and intermediates during this season. A redundancy analysis was run using the vegan package (Oksanen et al., 2012) to infer relationships between habitat characteristics and Plethodon community structure. Finally, I compared microhabitat tolerance for each species using data from the spring and the fall using a Welches t-test or a Mann Whitney test. To determine which test to use, I performed a Shapiro-Wilks test for normality. For normally distributed data, I used a Welches t-test and abnormally distributed data, I used a Mann Whitney test. DNA Sequencing and Alignment Genomic DNA was extracted from tissue samples using a PureLink Genomic DNA Mini Kit (Invitrogen by life technologies). Polymerase chain reaction (PCR) was used to amplify a portion of the cytochrome oxidase subunit I (COI, 636 bp) mitochondrion protein-coding gene, the glyceraldehyde-3-phosphate dehydrogenase (GAPD, 435 bp) nuclear protein-coding gene, and the pro-opiomelanocortin (POMC, 341 bp) nuclear protein-coding gene for each sample. I used primers that were optimized in previous studies for Plethodon (Table 9). COI PCR reactions were 25 µl and made up of µl of nuclease-free autoclaved H 2 O, µl of mm MgCl2,

79 µm of both primers (forward and reverse), µl mm dntps, µl of U/uL Taq polymerase, and 1.5 µl of genomic DNA. GAPD and POMC PCR reactions were 25 µl and made up of µl DreamTaq PCR Master Mix (2X), µl of nuclease-free autoclaved H 2 O, µm of both primers (forward and reverse), and 2 µl of genomic DNA. COI cycling parameters followed Bayer et al. s (2012) protocol and GAPD and POMC cycling parameters followed Lehtinen et al. s (2016) protocol (Table 10). Table 9 Primers Used Gene Primer Sequence Reference COI (LepF1- Forward AATTAACCCTCACTAAAGATTCAACCAATC ATAA AGATATTGG Bayer et al T3) COI Reverse TAAACTTCTG GATGT CCAAAAAATCA Bayer et al (LepR1) GAPD Forward TGCCCTCAATGACAATTTTGTGAAAC Lehtinen et al GAPD Reverse CATCAAGTCCACAACACGGTTGCTGTA Lehtinen et al POMC Forward ATATGTCATGAGCCATTTTCGCTGGAA Bonett et al POMC Reverse GGCATTTTTGAAAAGAGTCATTAGAGG Bonett et al

80 Table 10 Cycling Parameters for PCR Gene Start Denaturing, Annealing, Extending Cycle COI 94⁰C for 5 mins 94⁰C for 30 secs, 53.5⁰C for 1 min, 72⁰C for 1.5 mins (x 34) GAPD 94⁰C for 3 mins 94⁰C for 30 secs, 56⁰C for 40 secs, 72⁰C for 45 secs (x 35) POMC 94⁰C for 3 mins 94⁰C for 30 secs, 55⁰C for 30 secs, 72⁰C for 1 min (x 37) Final Extension 72⁰C for 5 mins 72⁰C for 5 mins 72⁰C for 10 mins Agarose (1.5%) gel electrophoresis was used to validate the presence of PCR product and 2-µL of ExoSAP-IT was added to each PCR reaction tube to remove unincorporated nucleotides. All samples were sequenced at Eurofins Scientific (Louisville, Kentucky, USA). Forward and reverse sequence data were combined into contiguous fragment using the De Nova Assemble function and then trimmed in the program Geneious (Kearse et al., 2012). Assembled contigs were aligned using the ClustalW feature in MEGA 7 (Tamura et al. 2015). Some of the COI sequences that were included in Chapter 4 were used. Individuals were checked for VIE tags to prevent recapture data. Sequences were translated into amino acids and assessed for premature stop codons using MEGA 7 and then exported for further analyses. Genetic Diversity I computed pairwise differences among salamanders using a p-distance method with a 95% partial deletion of gaps and missing data in the program MEGA 7. Sequence 67

81 diversity, DNA divergence, and gene flow among and within each species and intermediates was inferred using the program DnaSP v6 (Librado & Rozas, 2009). Within each dataset, I analyzed the total dataset as a single group, and putative P. hoffmani sequences, putative P. cinereus sequences, intermediates, mtdna P. hoffmani, and mtdna P. cinereus each as a single group. Diversity was measured by the number of variable sites (S), nucleotide diversity (pi), and haplotype diversity (Hd). Comparing genetic diversity between populations can be used to infer relative age of populations, with increased genetic diversity expected to correlate to the length of time populations have been established. (D Aoust-Messier & Lesbarreres, 2015). DNA divergence was assessed between each group by measures of pairwise nucleotide differences, the average nucleotide substitutions per site (Dxy) and the net nucleotide substitutions per site (Da) (Wakeley, 1996) between populations. Gene flow was inferred by the pairwise Fst value. An Fst value closer to 0 indicates no differentiation among populations and a high probability of gene flow, while an Fst value closer to 1 indicates high degree of differentiation among populations and reduced probability of gene flow (Alcala & Rosenberg, 2017). F1 Hybrid Identification To identify if intermediates represented first generation (F1) hybrids, the chromatogram of each intermediate was scanned using the program Codon Code Aligner ( to identify heterozygous single nucleotide polymorphisms (SNPs). 68

82 Phylogenetic Reconstruction A Median-Joining network was constructed in the program POPART (Leigh & Bryant, 2015) to visualize haplotype relationships among Plethodon samples in Blue Spruce County Park. Additional Plethodon sequences were added to each alignment from Genbank using MEGA 7 and are provided in Appendix E. Maximum likelihood analysis was performed in the program RaxML v7.2.8 (Stamatakis, 2014) using a GTR+GAMMA distribution with each codon partioned for 1,000 bootstraps. Bayesian inference analysis was performed in MrBayes (Huelsenbeck & Ronquist, 2005). The best model of substitution for each codon position was selected using Akaike information criterion (AIC) values calculated in the program jmodeltest (Darriba et al., 2012) (Table 10). Bayesian inference analysis was performed with 4 Markov chains for 10,000,000 generations sampled every 10,000 generations. The consensus topology was visualized and edited into the program FigTree v Table 10 Models of Nucleotide Substitution used in Bayesian Inference Analyses as inferred using jmodeltest Gene Codon 1 Codon 2 Codon 3 COI HKY GTR GTR GAPD GTR+I HKY F81 POMC F81 HKY HKY+G 69

83 Results Plethodon Detection Capture rate was low for P. hoffmani (n=5) and intermediates (n=6). P. cinereus had the highest rate of capture (n=32). A map of occupied plots for each species can be seen in Figure 17. Legend RB VR * Intermediate Figure 17. Capture localities for P. cinereus (RB), P. hoffmani (VR), and intermediates in Blue Spruce County Park, PA. Ecological Summary Statistics and RDA The average value, range, and standard deviation for occupied plot characteristics for each species group are summarized in Table 11. The redundancy analysis showed that Plethodon community was related to elevation, with P. cinereus found at lower elevations (Figure 18 p=0.057). In Table 12, summary statistics for surface-active 70

84 conditions are shown. Intermediates (air= C; soil= C) and P. cinereus (air= C; soil=15.08 C) appear to be surface active during similar average air and soil temperatures that are slightly cooler than P. hoffmani (air= C; soil= C). Table 11 Average Value and Range of Habitat Characteristics of occupied Plethodon plots in Blue Spruce County Park, PA Variables P. hoffmani (n=3) Intermediates (n=6) P. cinereus (n=13) Elevation (m) 403 ( , sd=10.58) 395 ( , sd=7.72) 387 ( , sd= 15.82) Aspect 190 ( , sd=30) Slope (14 27, sd=6.81) # of Cover Objects ( , sd=15.381) 211 ( , sd=58.9) (14 37, sd=8.47) ( , sd=10.95) 176 (70 340, sd=78.69) (8 33, sd=17.62) ( , sd=12.99) 71

85 RDA of Plethodon in Blue Spruce County Park RDA Elevation X..of.COs Slope Intermediate + VR + Redback RDA1 Figure 18. Redundancy analysis showing the effect of habitat variables on Plethodon community structure. VR= Plethodon hoffmani, Redback= Plethodon cinereus. Table 12 Surface Active Conditions of P. hoffmani, P. cinereus, and Intermediates Variables P. hoffmani (n=5) Intermediates (n=6) P. cinereus (n=32) Air Temperature ( , ( , ( , ( C) sd=12.253) sd= 13.92) sd=11.054) Soil Temperature ( C) ( , sd= 4.241) ( , sd=4.25) ( , sd=3.34) Relative Humidity (%) ( , sd=8.142) ( , sd=19.19) ( , sd=12.62) Leaf Litter Depth (cm) 4.75 (3-6.5, sd=1.541) ( , sd=1.530) 3.8 (1 6.25, sd=1.471) Soil Saturation (1=dry 4= soaking) 2.2 (2 3, sd= 0.447) 2.83 (2 4, sd=0.753) 2.53 (1 4, sd=0.671) 72

86 Morphological Assessment SVL did not differ between intermediates and P. cinereus (t=0.9374, df=20.46, p=0.3595; Figure 3) but the average was slightly larger for intermediates (41.88) compared to the average for P. cinereus (39.82). SVL differed significantly between intermediates and P. hoffmani (t= , df=18.964, p= ; Figure 19), with P. hoffmani being larger (average SVL=47.68). As expected, SVL for P. cinereus and P. hoffmani also differed significantly (t= , df= , p=9.45e-05; Figure 19). Predicted.Species Intermediate RB VR 50 Snout Vent Length (mm) Figure 19. Comparison of SVL for intermediates (n= 13), P. cinereus (RB; n= 20), and P. hoffmani (VR; n= 9) in Blue Spruce County Park, PA during the fall (2017) Species Microclimate Tolerance Intermediate RB VR Species Soil temperature data was combined from spring (chapter 4) and fall (this chapter) to infer temperature tolerance of each species and the intermediates. Leaf litter depth was also assessed considering its role in maintaining moisture levels on the forest floor. I 73

87 included 37 P. cinereus, 35 P. hoffmani, and 5 intermediate capture data were included in the analyses. There was no significant difference between soil temperature in occupied plots for P. cinereus and P. hoffmani (W=730.5, p=0.3523; Figure 20), P. hoffmani and intermediates (W=87, p=1; Figure 5) or P. cinereus and intermediates (t=-0.716, df=4.7908, p=0.5074; Figure 20). There was no significant difference between leaf litter depth in occupied plots for P. cinereus and P. hoffmani (t= , df=68.682, p=0.147; Figure 21), P. hoffmani and intermediates (t=-0.80, df=5.3748, p=0.4575; Figure 21), or P. cinereus and intermediates (t=-0.068, df=5.0898, p=0.9483; Figure 21). Species INTER RB VR 20 Average Soil Temperature INTER RB VR Species Figure 20. Average soil temperature at capture for Plethodon in the Allegheny Plateau. INTER= Intermediate, RB= P.cinereus, VR= P. hoffmani 74

88 Species INTER RB VR 6 Average Leaf Litter Depth INTER RB VR Species Figure 21. Average leaf litter depth at capture for Plethodon in the Allegheny Plateau. INTER= Intermediate, RB= P.cinereus, VR= P. hoffmani Air temperature and relative humidity were also compared, but may be variable due to season and therefor should not be heavily weighted as species-specific variation. Relative humidity did not differ between fall active P. cinereus and fall active intermediates (t=-0.80, df=4.4775, p=0.4623; Figure 22) but there was a significant difference between fall active P. cinereus and spring active P. hoffmani (W=21, p= ; Figure 22) and between fall active intermediates and spring active P. hoffmani (W=284.5, p= ; Figure 22). Air temperature was significantly different between fall active P. cinereus and spring active P. hoffmani (W = 894.5, p= ; Figure 23) but was not different between fall active intermediates and spring active P. hoffmani (W=100, p=0.3131; Figure 23) and not different between fall active 75

89 intermediates and fall active P. cinereus (W=102, p=0.7266; Figure 23). Species INTER RB VR Relative Humidity INTER RB VR Species Figure 22. Relative humidity during capture events for Plethodon salamanders. INTER=Intermediates, RB=P. cinereus, VR=P. hoffmani. Intermediates and a majority of P. cinereus were captured in the fall and a majority of P. hoffmani were captured in the spring. 76

90 Species INTER RB VR 20 Air Temperature 10 INTER RB VR Species Figure 23. Air temperature during capture events for Plethodon salamanders. INTER=Intermediates, RB=P. cinereus, VR=P. hoffmani. Intermediates and a majority of P. cinereus were captured in the fall and a majority of P. hoffmani were captured in the spring. Genetic Diversity Genetic diversity was calculated for six different groupings of samples: all Plethodon, P. hoffmani, P. cinereus, intermediates, mtdna P. hoffmani, mtdna P. cinereus sequences for each gene (COI, GAPD, and POMC; Table 13). Prior to analysis, intermediate COI sequences were compared to verified species to identify the maternal lineage, to allow for assessment by maternal lineage as well as putative lineage. Twenty-seven Plethodon COI sequences (635 bps) were analyzed for genetic diversity within and among each species group (Table 13). The mean pairwise distance between Plethodon COI samples was (sequence pairwise distances in Appendix F). There was no genetic diversity among putative P. hoffmani and putative P. cinereus COI 77

91 datasets. Genetic diversity was relatively high among the intermediate COI dataset (Hs= , Pi=0.0399), with values similar to the total dataset analysis (Hd= 0.53, Pi= ). When intermediates were included in their mtdna-assigned maternal lineage, P. cinerus mtdna sequences exhibited an increase in genetic diversity (Hd=0.356, Pi= ). P. hoffmani mtdna sequence did have a higher degree of genetic diversity compared to putative P. hoffmani. Twenty-six Plethodon GAPD sequences (467 bps) were analyzed for genetic diversity within and among each species group (Table 13). There was a 16-base pair insertion or deletion event between P. hoffmani and P. cinereus, with P. cinereus having 16 bp deletion compared with P. hoffmani. The mean pairwise distance between Plethodon GAPD samples was (sequence pairwise distances in Appendix G). A 16 base pair indel was found in the alignment, preventing a clean amino acid translation. Sequences with a 16 bp deletion were blasted and identified as P. cinereus sequences. Putative P. hoffmani exhibited no genetic diversity and putative P. cinereus had a higher degree of genetic diversity (Hd= 0.40, Pi= ). Genetic diversity was relatively high among the intermediate GAPD dataset (Hs= 0.448, Pi= ), with values similar to the total dataset analysis (Hd= , Pi= ). When intermediates were included in their blasted maternal lineage, P. cinereus mtdna sequences exhibited a slight increase in genetic diversity (Hd=0.5556, Pi= ) compared to putative P. cinereus (Hd=0.40, Pi= ). P. hoffmani mtdna sequences had an increased genetic diversity as well (Hd=0.118, Pi= ), which was zero for putative P. hoffmani samples. MtDNA P. hoffmani samples had a significant Tajima s D value ( ). Intermediates had the highest Fu s F statistic (8.346). 78

92 Twenty-six Plethodon POMC sequences (341 bps) were analyzed for genetic diversity within and among each species group (Table 6). The mean pairwise distance between Plethodon POMC samples was (sequence pairwise distances in Appendix H). Putative P. hoffmani exhibited no genetic diversity and putative P. cinereus had a higher degree of genetic diversity (Hd= 0.80, Pi= ). Genetic diversity was relatively high among the intermediate POMC dataset (Hd= , Pi= ), with values similar to the total dataset analysis (Hd= 0.563, Pi= ). When intermediates were included in their assigned maternal lineage, P. cinereus mtdna sequences exhibited a slight decrease in genetic diversity (Hd=0.694, Pi= ) compared to putative P. cinereus (Hd=0.80, Pi= ). P. hoffmani mtdna sequences had an increased genetic diversity (Hd= , Pi= ), which was zero for putative P. hoffmani samples. Intermediates had the highest Fu s F statistic (7.044). 79

93 Table 13 Genetic Diversity per gene for P. hoffmani, P. cinereus, intermediates, mtdna P. hoffmani, and mtdna P. cinereus in Blue Spruce County Park, Pennsylvania Gene Species n Haplotypes Variable Hd Pi Sites COI ALL COI P. hoffmani COI P. cinereus COI Intermediates COI P. hoffmani mtdna COI P. cinereus mtdna GAPD ALL GAPD P. hoffmani GAPD P. cinereus GAPD Intermediates GAPD P. hoffmani mtdna GAPD P. cinereus mtdna POMC ALL POMC P. hoffmani POMC P. cinereus POMC Intermediates POMC P. hoffmani POMC mtdna P. cinereus mtdna Note: Pi= nucleotide diversity per site Fst values were high in COI groups except for between P. hoffmani and intermediates (Table 14). Comparatively, nuclear gene groups had much lower Fst values. COI showed the highest degree of divergence between all groups (Dxy> ; Table 14), while nuclear genes had much lower degrees of divergence across all groups (Dxy< ; Table 14). Fst and Dxy values were highest for all genes in the putative P. hoffmani and P. cinereus group. Fst and Dxy values were lowest for all genes in the 80

94 putative P. hoffmani and intermediate group. Table 14 Gene Flow (Fst, Nm) Estimates and DNA Divergence (Dxy, Da) Between Species Groups Gene Species Group n Fst, Nm Dxy Da COI P. hoffmani x n= , P. cinereus n= COI P. hoffmani x n= , Intermediates n= COI P. cinereus x n= , Intermediates n= COI P. cinereus n= , mtdna x P. hoffmani mtdna n= GAPD P. hoffmani x n= , P. cinereus n=5 GAPD P. hoffmani x n= , Intermediates n= GAPD P. cinereus x n= , Intermediates n= GAPD P. cinereus n= , mtdna x P. hoffmani mtdna n= POMC P. hoffmani x n= , P. cinereus n= POMC P. hoffmani x n= , Intermediates n= POMC P. cinereus x n= , Intermediates n= POMC P. cinereus mtdna x P. hoffmani mtdna n=9 n= , Dxy= average nucleotide substitutions between populations Da= net nucleotide substitutions between populations F1 Hybrid Identification Chromatograms from intermediate nuclear loci were scanned for heterozygosity at interspecific SNP regions. Six SNPs were identified for GAPD and 5 SNPs were 81

95 identified for POMC, with a total of 11 SNPs scanned. Double peaks did not occur at any of these regions, except for one. This site was also heterozygous for putative P. hoffmani, so more sampling from allopatric populations is needed to determine if this is arepresentative of heterozygosity. No F1 hybrids were detected. Phylogenetic Reconstruction The median-joining networks exposed incongruence between haplotypes for each gene. The COI dataset (Figure 24, left network) showed a split among intermediate haplotypes (purple) between morphological P. hoffmani (red) and P. cinereus (green). In the GAPD dataset (Figure 24, top right network), intermediates that were identified as P. hoffmani using COI shared GAPD haplotypes with P. cinereus and vise versa. A morphological P. cinereus sample shared its GAPD haplotype with morphological P. hoffmani. In the POMC dataset (Figure 8, bottom right network), morphologically identified P. cinereus and P. hoffmani did not share haplotypes but there was incongruence for COI barcoded intermediates. 82

96 Figure 24. Median-joining networks for COI, GAPD, and POMC Blue Spruce County Park samples. Intermediates are grouped by their mtdna lineages for the nuclear genes. VR= P. hoffmani, RB= P. cinereus Twenty-nine sequences were included in the COI dataset, 27 Plethodon from Blue Spruce County Park and two sequences from Genbank. Two P. cinereus (KC3002 and KC1021) and 4 P. hoffmani (KC3001, KC1024, KC1022, and KC1010) sequences were verified to species in the previous chapter. Intermediates were assigned to maternal lineages with strong posterior probability and maximum likelihood support values (PP: 1.00, ML: 100; Figure 25). Four intermediates had P. cinereus haplotypes and 11 intermediates had P. hoffmani haplotypes (Figure 25). Two P. cinereus intermediates were divergent from the rest of the P. cinereus clade (PP: 1.00, ML: 100; Figure 25). 83

97 Figure 25. COI BI phylogeny of Plethodon salamanders in Blue Spruce County Park. Maximum likelihood bootstrap scores and posterior probabilities are displayed above the branch. Samples from this study begin with KC. Green samples are P. hoffmani, red samples are P. cinereus, pink samples are intermediates, and blue samples are from Genbank. Forty-five sequences were included in the GAPD dataset, with 26 sequences representing Plethodon from Blue Spruce County Park. Hybrids between P. cinereus and P. electromorphus were included as well as pure P. cinereus and P. electromorphus (Lehtinen et al., 2016). The maximum likelihood topology and Bayesian inference topology were slightly different, with more structure displayed in the maximum likelihood phylogeny for the P. hoffmani sequences (Figure 26, denoted with *). Incongruence among GAPD haplotypes and COI haplotypes is evident. KC1704 was morphologically identified as P. cinereus, COI verified as P. cinereus, but is displayed as P. hoffmani in the GAPD dataset (Figure 26). KC1729 was morphologically identified as an intermediate, COI verified as P. cinereus, and displayed as P. hoffmani in the GAPD phylogeny (Figure 26). 84

98 Figure 26. GAPD BI phylogeny of Plethodon Salamanders in Blue Spruce County Park. Maximum likelihood bootstrap scores and posterior probabilities are displayed above the branch. Samples from this study begin with KC. Green samples are P. hoffmani, red samples are P. cinereus, pink samples are intermediates, and blue samples are from Genbank. Asterisks (*) indicate incongruence between ML and BI topologies with low posterior probability scores and high Bayesian inference scores. Plethodon cinerus x Plethodon electromorphus indicates hybrids from Ohio (Lehtinen et al., 2016). Samples from Blue Spruce County Park begin with KC. Forty sequences were included in the POMC phylogenetic analyses, with 26 sequences representing Plethodon from Blue Spruce County Park. The Bayesian inference analysis and maximum likelihood analysis constructed similar topologies with the exception of a polytomy being displayed in the Bayesian inference topology and a dichonomy for P. serratus and P. cinereus in the maximum likelihood topology. Structure was the same for the rest of the topologies and had high support values in the P. hoffmani clade (PP: 1.00, ML: 100; Figure 27). The P. cinereus clade received lower support values (PP: 0.70, ML: 63; Figure 27) and was highly supported to split into two subclades (PP: 0.98, ML: 91 and PP: 1.00, ML: 97; Figure 27). Incongruence between the COI dataset was identified for three intermediate samples. KC1729 was verified as P. cinereus using COI and associated with putative P. hoffmani in the POMC topology 85

99 (Figure 27). KC1734 was verified as P. hoffmani using COI and associated with putative P. cinereus in the POMC topology (Figure 27). KC1742 was verified as P. hoffmani using COI and associated with putative P. cinereus in the POMC topology (Figure 27). Table 15 shows incongruence among four Plethodon sequences among morphology and genealogies. Figure 27. POMC BI phylogeny of Plethodon salamanders in Blue Spruce County Park. Maximum likelihood bootstrap scores and posterior probabilities are displayed above the branch. Samples from this study begin with KC. Green samples are P. hoffmani, red samples are P. cinereus, pink samples are intermediates, and blue samples are from Genbank. Asterisks (*) indicate incongruence between ML and BI topologies with low posterior probability scores and high Bayesian inference scores. Maximum likelihood analysis did not form a polytomy between P. serratus, P. cinereus and P. hoffmani by separating P. serratus and P. cinereus into dichonomies (PP: 58). Plethodon cinerus x Plethodon electromorphus indicates hybrids from Ohio (Lehtinen et al., 2016). Samples from Blue Spruce County Park begin with KC. 86

100 Table 15 Incongruent Samples in Phylogenetic Analyses SAMPLE ID MORPHOLOGY COI GAPD POMC KC1704 P. cinereus P. cinereus P. hoffmani P. cinereus KC1729 Intermediate P. cinereus P. hoffmani P. hoffmani KC1734 Intermediate P. hoffmani P. hoffmani P. cinereus KC1742 Intermediate P. hoffmani P. cinereus P. cinereus Species Interactions Discussion Lower detection of P. hoffmani and higher detection of P. cinereus in Blue Spruce County Park prevented a robust statistical analysis of co-occurrence patterns, with habitat preference and physiological tolerance likely driving the low detection of P. hoffmani. Species are typically restricted to patches in response to suitable habitat requirements and because of the tendency for organisms to aggregate in order to enhance reproductive success and for predatory defense (McGarvey et al., 2016). Models that incorporate detection probability are a powerful new tool for organisms that cannot be detected reliable, but it is still difficult to reliably inventory rare species (Bowering et al., 2018), such as P. hoffmani. Terrestrial salamanders are estimated to be surface active 2-32 % of the time, with vertical emigration decreasing detection probability (O Donnell & Semlitsch, 2015) and therefore making abundance estimates difficult to obtain. Further, detection probability can be affected by various other factors including survey effort, observer experience and motivation, species crypsis, and habitat complexity (O Donnell & Semlitsch, 2015). Recent studies have tried to increase the probability of capture by using pitfall traps and artificial cover boards, but this could be biasing for capture of roaming individuals or territorial individuals (O Donnell & Semlitsch, 2015). 87

101 Many studies have successfully utilized repeated count surveys using plots to estimate detection probability and abundance of terrestrial salamanders (O Donnell et al., 2014; O Donnell et al., 2015), but it is not done with rare species. O Donnell et al. (2015) suggests that survey location and survey protocol aims to maximize detection probability so that population parameter estimates are more reliable, which is easier to do for species found across the study area if a random sampling approach is utilized. In this study, the patchy distribution of P. hoffmani made it difficult to apply widely used survey methods and obtain reasonable count data, a common issue for rare species (McGarvey et al., 2016). For example, in a study done by Bailey et al. (2004) in Great Smokey Mountain National Park, 10 species of amphibians were encountered, but only 7 species had enough data to be analyzed for species-specific detection probabilities and abundance estimates. Although Royle (2004) claims that sparse count data can be analyzed with N- Mixture models, my attempt at ranking models for P. hoffmani suggested that the null model was the best model for detection. One approach is combining count data for all plethodontid salamanders, as was done by Costa et al. (2016) in northwestern Italy, but I think that generalizes salamander ecology too much. I considered pulling all of my Plethodon data into a total count dataset to analyze the data but that does not get at my question of how are the two species co-occurring or excluding one another in the park. Furthermore, terrestrial salamander species have been documented to utilize microhabitat conditions differently in sympatry (Farallo & Miles, 2016). One of the sampled plots in Blue Spruce County Park was occupied by P. hoffmani, P. cinereus and an intermediate, suggesting there is overlap in habitat preferences or physiological tolerance, but P. cinereus must have a wider range that 88

102 allows for its wider spread occurrence in the park. The redundancy analysis could not reject the null hypothesis, which was that species community data was not related to habitat variables. Our limited data suggests that these species and the intermediates are not selecting sites differently but more data is needed because the lack of detection for intermediates and P. hoffmani indicate that there is a limiting factor present. Possible restrictive variables that were not sampled for include ph, soil moisture, and invertebrate community structure and abundance. When the fall and spring datasets were combined, P. hoffmani and P. cinereus did not utilize cover objects differently by temperature and they did not select plots differently by the depth of leaf litter. Leaf litter likely plays a role in soil moisture stability, canopy cover, and invertebrate abundance (Welsh & Best, 2014). The weather conditions indicated drier and warmer air conditions when P. hoffmani was surface active compared to P. cinereus. Intermediates had a very wide range of value for air temperature that overlapped with both species. Because soil temperature was the same for all three groups, I hypothesize that individuals are surface active during warmer air temperatures if they have access to cover objects that can maintain temperatures necessary for survival. Again, most of the data for each species was collected during different seasons, so air temperature and relative humidity could be cofounding variables from season or sampling occasion that are not directly influencing salamander activity. It is also important to note that the sampling season was dependent on P. hoffmani activity patterns and did not account for P. cinereus activity in the summer, which would be expected to be warmer and drier conditions. 89

103 Morphology and F1 Hybridization Morphologically, the intermediates are closer to P. cinereus. Lehtinen et al. (2016) found evidence for hybridization between P. cinereus and P. electromorphus and stated that hybrids resembled P. cinereus and would be incorrectly identified as pure P. cinereus without genetic analysis. Although the Blue Spruce County Park intermediates were not identified as F1 hybrids, the incongruence among genealogies suggests historical introgression may have occurred between P. hoffmani and P. cinereus (Wiens et al., 2006; Chen et al., 2009). With some of the intermediates verified to P. hoffmani using COI, two possible explanations become apparent. First, intermediates may be P. cinereus lacking a middorsal stripe demonstrating historic introgression of P. hoffmani into the mitogenome resulting in incongruence in the geneology. Or, intermediates are recent descendants of viable F1 hybrids and have the intermediate phenotype as a result, with admixture possibly being more evident in other regions of the genome that were not sampled. Many papers have found incongruence among genealogies across a larger scale, and have identified a small portion of F1s (Vogel & Johnson, 2008; Storfer et al., 2004; Chen et al., 2009). For example two F1 hybrids were found across nine populations of Bufo toads in the B. americanus complex (Vogel & Johnson, 2008). In another example, five hybrid Ambystoma salamanders were found across 6 ponds, with some hybrids possessing intermediate characters and others resembling the more common species (Storfer et al., 2004). A single F1 hybrid was found in a study looking at four species of high elevation Tibetan megophyrid frogs that exhibited incongruence among genealogies (Chen et al., 2009). In areas of sympatry, amphibians are expected to select the correct mate more often than not, therefor accidental interspecific reproduction should be a rare 90

104 occurrence. Therefore, the lack of F1 hybrids in our dataset does not necessarily indicate that hybridization is not occurring in Blue Spruce County Park and more sampling efforts should focus on this area to expand sample size. Genetic Diversity and Phylogenetic Reconstruction The lack of genetic diversity for putative P. hoffmani and P. cinereus COI sequences makes it difficult to estimate which population has been in Blue Spruce County Park the longest but the increased genetic diversity (Pi= , Hd=0.356) for mtdna P. cinereus suggests the P. cinereus population is older. The increase in diversity when mtdna P. cinereus was analyzed is reflected in phylogenetic analyses, with two intermediate samples (KC1725 & KC1741) diverging from the rest of P. cinereus in the COI topology and forming a descendent haplotype in the median-joining network. The high degree of diversity in the intermediate dataset suggests multiple cryptic species included rather than a single species having a varied phenotype. This is evident by the similarity in genetic diversity among intermediates (Pi=0.0399, Hd=0.4571) and among the total dataset (Pi= , Hd=0.53). Phylogenetic relationships recovered in the COI topology for intermediates in Blue Spruce County Park reflect more than one species under that morphotype, with several intermediate samples clustering in both P. hoffmani and P. cinereus group. The nuclear genes both showed no genetic diversity among putative P. hoffmani sequences, which is expected because nuclear genes evolve slower than mitochondrial genes (Chen et al., 2009). The increased genetic diversity for nuclear genes compared to mtdna in putative P. cinereus and mtdna P. cinereus sequences is likely a result of admixture and introgression, which has resulted in complex relationships in the Median- 91

105 Joining network, such as the putative P. cinereus having a GAPD P. hoffmani haplotype. More sampling throughout the range of sympatry for these species is suggested to infer degree of admixture between P. hoffmani and P. cinereus. Due to its slow rate of evolution, I do not consider the increased nuclear genetic diversity an indicator of increased population age. Fst values indicated that putative P. hoffmani and P. cinereus had a high degree of genetic differentiation, with the least differentiation between P. hoffmani and intermediates, likely due to the fact that most of the intermediates were maternally verified as P. hoffmani. MtDNA markers have higher Fst values compared to nuclear markers, so including nuclear markers is often considered not worth the time and money for inferring population genetic structure (Zhou et al., 2013). I found this to be true for my results, with the exception of POMC dataset (Fst= ) having a higher Fst value between P. hoffmani and intermediates than the COI dataset (Fst= ). Genetic Divergence was highest for putative P. hoffmani and P. cinereus for all three genes. The COI dataset had a substantially higher degree of divergence compared to the nuclear genes, which is depicted well in the Median-Joining Network (Figure 8), with more mutations between haplotypes in the COI. The higher rate of divergence in the COI dataset between P. cinereus and P. hoffmani compared to the nuclear datasets is due to the fact that divergence will appear in mitochondrial DNA four times faster than nuclear DNA, a result attributed differences in rates of coalescence (Vogel & Johnson, 2008). In the GAPD dataset, it was not possible to translate sequences to amino acids due to insertion events that correlated with species. P. hoffmani had an additional 16-base pairs in the center of the sequence frame. GAPD is used in the 6 th enzyme of glycolysis 92

106 (Ramzan et al., 2013), so a mutation in this gene that is fixed obviously is not deleterious. Insertion and deletion (indel) events are fundamental processes to genomic evolution and are more common in mammal sequences with a high G+C content (Taylor et al., 2004). Mutations can result in a loss of protein function, where less of the protein is created or the function is compromised, or a gain of protein function, where a new function is acquired (mcb.berkeley.edu). A link between effective population size and rate of insertion was described by Sung et al., (2016), with mutation rate being inversely proportional to effective population size. Small effective population sizes result in an increased power of genetic drift, causing mutations to be fixed more readily (Sung et al., 2016). With Plethodon populations hypothesized to have undergone extensive range shifts in response to climate change, dispersal events may have resulted in small effective population sizes and therefore, less time for natural selection to reduce mutation rates. Because of its rapid rate of evolution, mitochondrial DNA is suitable for estimating population level relationships and resolving evolutionary relationships among closely related species (Chen et al., 2009). Unfortunately, nuclear genes are rarely included in population genetic studies because of their low variability and incongruence among genealogies is often overlooked (Chen et al., 2009). Incongruence among genealogies in this study suggests that P. hoffmani and P. cinereus have experienced historical introgression (Wiens et al., 2006; Chen et al., 2009). Introgression is gene flow between species that leads to viable and fertile offspring (Wiens et al., 2006; Chen et al., 2009). It is suggested that incongruence in clades that have posterior probability scores above 70 are considered to be strongly supported (Wiens et al., 2006), as is the case with our samples. In some cases, mitochondrial DNA from one species may replace another s, 93

107 with little to no change in the nuclear genome or a lack of morphological differences (Chen et al., 2009). This is termed 'ghost of hybrids past' by Wilson & Bernatchez (1998) (Chen et al., 2009), and has been encountered in many taxa groups. For example, McGuire et al. (2007) found that 2/3 of the reticulate collared lizard (Crotaphytus reticulatus) populations had fixed mitochondrial DNA from Crotaphytus collaris. Our results show incongruence between mitochondrial DNA and nuclear DNA (KC1704, KC1729, KC1734, and KC1742) but also between nuclear genes (KC1704 and KC1734), suggesting that admixture between P. hoffmani and P. cinereus is affecting both nuclear and mitochondrial genomes. Postzygotic isolation in amphibians sets in after significant genetic differentiation (Orozco-terWengel et al., 2013), so distributional overlap in the past may have increased the likelihood of hybridization between P. hoffmani and P. cinereus, whereas now, the species have differentiated enough to reduce hybridization occurrence, resulting in a lack of evidence for F1 hybrids. Wiens et al. (2006) estimated that reproductive isolation occurs in species pairs that have a common ancestor of at least 15.7 million years ago. The estimated common ancestor for P. hoffmani and P. cinereus is million years ago, a time frame estimated to be rare for hybridization in Plethodon ( million years ago) (Wiens et al., 2006). Species pairs with a common ancestor million years ago commonly experience hybridization (Wiens et al., 2006), therefore, hybridization may have been occurring more often during range expansion and contraction in response to the Pleistocene glaciation events during the last 2 million years, explaining incongruence among genealogies in this study. In an attempt to find a pure P. hoffmani sequence for both POMC and GAPD, I sequenced allopatric P. hoffmani 94

108 samples from Kittanning, Pennsylvania. When the sequences were blasted in MEGA, one of the GAPD sequences had a P. cinereus haplotype, highlighting that contemporary distributions are temporary and species may have overlapped with other species in the past that are no longer overlapping. Another explanation for incongruent genealogies is incomplete lineage sorting (Schumer et al., 2016; Abbott et al., 2016; Chen et al., 2009; Vogel & Johnson, 2008; Wiens et al., 2006). Ancient hybridization was traditionally verified by incongruence in gene trees, but Abbott et al., (2016) presses the importance of recognizing that this could be an artifact of incomplete lineage sorting as well. Incomplete lineage sorting is detected when topology variations are equally sorted, while asymmetrical support for a particular topology indicates gene flow between species in the process of differentiating (Schumer et al., 2016). The number of incongruent samples in our dataset (n=4) is not enough to infer if topological variation is asymmetrical or equally sorted. The idea that interspecific hybridization is a rare phenomenon is changing with the growing list of examples of introgression across all taxa groups (Sequeira et al., 2011). Genetic introgression is well documented in mammals, fish, and birds, but amphibians have received very little attention until recently (Dufresnes et al., 2016). Gene flow between interspecific populations may be a result of a lack of conspecific mates (Vogel & Johnson, 2008) and the consequence could be outbreeding depression and ultimately decreased fitness (Dufresnes et al., 2016). A more common hypothesis for introgression in North American herpetofauna is the inevitable species range shifts in response to climate change during the Pleistocene and Holocene resulting in distribution overlap for closely related species (Sequeira et al., 2011). Where reproductive barriers 95

109 have not fully formed, the consequences of interspecific gene flow is porous species boundaries (Sequeira et al., 2011). 96

110 CHAPTER 6 CONCLUSION AND SUGGESTED RESEARCH Conclusion This study highlights that Plethodon hoffmani and Plethodon cinereus do not exhibit habitat differentiation in Blue Spruce County Park and in the sampled populations in the Allegheny Plateau, and it is still unclear what variable predicts whether P. hoffmani and P. cinereus will co-occur in this region. Behavioral mechanisms may be excluding P. cinereus in allopatric populations, with territorialism being exaggerated over time. If this is the case, I would expect that the age of the population would play a role in the degree of exclusion. Our results suggested that the oldest and the newest population are allopatric, therefor age does not appear to be driving exclusion in this area. Southern populations of P. hoffmani completely exclude P. cinereus, so if age were contributing, population in the Allegheny Plateau may be in the process of settling into the expected exclusion pattern in the future. More sampling in Blue Spruce County Park is needed to rule out ongoing hybridization. Terrestrial salamanders are very abundant in forests, if hybridization is occurring but is rare, a large number of individuals would need to be sequenced. I did not find evidence for F1 hybridization, but did find support for historical introgression that resulted in incongruent genealogies for P. hoffmani and P. cinereus. This raises concern because of the widespread use of mtdna in genetic studies, especially with DNA barcoding being widely used to identify cryptic species. I suggest that future genetic studies include both mitochondrial and nuclear genes in genetic analyses to rule out incongruent genealogies that may result in unreliable species verification. Global climatic 97

111 fluctuation has resulted in rapid speciation events followed by closely related species distribution overlap with new habitat opening up, therefore it is likely that widespread ancient hybridization occurrence has been underestimated without genetic analyses. Future Research For those considering P. hoffmani research, I would like to share my views on the limitations of this study and suggest future research objectives. This data is limited to a single season from a single year, therefore a more temporally extensive study is needed in order to validate comparative speculations. Also, access to additional populations would increase the validity of the results for Allegheny populations. I can only summarize the observations of these few populations. Extensive sampling through the range of P. hoffmani is needed to infer dispersal routes into the Allegheny Plateau. I suggest using mitochondrial gene cyt-b to infer changes in diversity across the landscape. GAPD and POMC should continue to be sequenced so that incongruent genealogies are detected and introgressed mitochondrial loci are not misleading in species identification. A species distribution model would be useful in identifying areas with a high probability of species occurrence. This species is hypothesized to have migrated up the Susquehanna River and down the western branch into the Allegheny Plateau, therefor, sampling efforts should focus on that route to prove or disprove that hypothesis. Continued monitoring of P. hoffmani and P. cinereus in Blue Spruce County Park is warranted. Future research should consider using adaptive cluster sampling to estimate abundance and detection probability for P. hoffmani. An additional location for P. hoffmani was discovered outside of the expected hillsides, so more sampling could occur on this hillside as well as in the two hills outlined. Adaptive cluster sampling is often 98

112 used to sample for rare forest dwelling species such as lichen, rare trees, and rare plants (Bowering et al., 2018). When a rare species is detected, additional survey effort is targeted in surrounding plots, taking advantage of the idea that rare species will reproductively cluster together, making abundance estimates more reliable (Bowering et al., 2018). This approach has been praised for reducing labor efforts and maximizing datasets in a short period of time (Bowering et al., 2018). For example, a recent random sampling survey effort at Big Triangle Pond required 12 person-days, meter sample transects, and 1116 trees only found 5 thalli, the organism they were surveying for (Bowering et al., 2018). In a similar study, McCarthy (2010) surveyed 75 1-ha plots of habitat that was considered suitable for a rare thalli species, and found 25 samples over the course of 51 days, with 62 plots unoccupied. The adaptive cluster sampling design was applied to the same species in a different area, and 398 thalli were found over the course of the study, averaging thalli per day per person, while the previous example averaged 0.56 thali per person per day (Bowering et al., 2018). McGarvey et al. (2016) compared systematic and random sampling designs for clustered populations and found systematic sampling to be much more precise for abundance estimates, with random surveying requiring 3-5 times larger transect samples to give equal precision. The biggest issue with systematic sampling is the obvious bias expected, while a random sampling design is unbias (McGarvey et al., 2016). I also suggest that future habitat-centered research include soil moisture measurements when comparing Plethodon species, with cutaneous respiration dependent on proper moisture levels (Peterman & Semlitsch, 2013; Farallo & Miles, 2016). A laboratory study looking at water-balance response in P. hoffmani and P. cinereus 99

113 suggested that P. hoffmani can recover from dehydration much better than P. cinereus (Brown et al., 1977), a mechanism that may be excluding P. cinereus from drier areas inhabited by P. hoffmani. Carlson et al., (2016) collected data on humidity and temperature between P. hoffmani and P. cinereus at a sympatric population in southcentral Pennsylvania, and found no evidence for differences between the two species. Highton (1999) stated that there are two genetically differentiated groups of P. cinereus, one in the Allegheny Plateau, and another in the eastern Valley and Ridge region. He hypothesizes that the eastern P. cinereus group is adapted to a wetter environment, and therefor is not co-occurring with P. hoffmani in that region, while the populations in the Allegheny Plateau are able to tolerate drier conditions and therefor co-occur with P. hoffmani. In the light of climate change, P. cinereus ability to tolerate drier conditions in the Allegheny Plateau region could be beneficial. In the Plethodon, the males use premaxillary teeth to break the female s skin and then mental gland secretions are rubbed onto the wound to promote reproduction (Wiens et al., 2006). Chemical cues are important for species recognition and courtship (Weins et al., 2006), therefor understanding pheromone composition for P. hoffmani and P. cinereus may provide evidence for reproductive barriers that are not currently known. I suggest future research looks at the amino acid composition in pheromones of both species. P. hoffmani and P. cinereus have overlapping breeding seasons, so an absence of pheromone differentiation promote hybridization in sympatry. This work successfully utilized barcoding techniques for Plethodontid species verification, but also highlighted the importance of utilizing nuclear genes as well as mitochondrial genes. When verifying a cryptic species using COI, there is a chance that 100

114 the nuclear genome will verify it as a different species. Plethodon species have complex evolutionary histories, with distributional shifts in response to climate variation, increasing chances of hybridization between pairs of species that have not completely developed reproductive barriers. Our results of admixed genomes provide insight into some of the consequences of closely related species co-occuring, hybridization and introgression. 101

115 References Abbott, R. J., Barton, N. H., & Good, J. M. (2016). Genomics of hybridization and its evolutionary consequences. Molecular Ecology, 25(11), Adams, D. C., & Rohlf, F. J. (2000). Ecological character displacement in Plethodon: Biomechanical differences found from a geometric morphometric study. Proceedings of the National Academy of Sciences, 97(8), Alcala, N., & Rosenberg, N. A. (2017). Mathematical constraints on FST: biallelic markers in arbitrarily many populations. Genetics, 206(3), AmphibiaWeb University of California, Berkeley, CA, USA. Andrew, J., Alonso, R., & César, A. J. A. (2011). DNA barcoding identifies a third invasive species of Eleutherodactylus (Anura: Eleutherodactylidae) in Panama City, Panama. Zootaxa, 2890, Arntzen, J. W., Wijer, P., Jehle, R., Smit, E., & Smit, J. (1998). Rare hybridization and Introgression in smooth and palmate newts (Salamandridae: Triturus vulgaris and T. helveticus). Journal of Zoological Systematics and Evolutionary Research, 36(3), Baecher, Joseph Alexander. (2017). Natural Environmental Gradients Predict the Microhabitat Use, Fine-Scale Distribution, and Abundance of Three Woodland Salamanders in an Old-Growth Forest (Unpublished dissertation). Eastern Kentucky University. Bailey, L. L., Simons, T. R., & Pollock, K. H. (2004). Estimating site occupancy and species detection probability parameters for terrestrial salamanders. Ecological Applications, 14(3),

116 Bank, M. S., Crocker, J. B., Davis, S., Brotherton, D. K., Cook, R., Behler, J., & Connery, B. (2006). Population decline of northern dusky salamanders at Acadia National Park, Maine, USA. Biological Conservation, 130(2), Bayer, C. S., Sackman, A. M., Bezold, K., Cabe, P. R., & Marsh, D. M. (2012). Conservation genetics of an endemic mountaintop salamander with an extremely limited range. Conservation Genetics, 13(2), Best, M. L., & Welsh Jr, H. H. (2014). The trophic role of a forest salamander: impacts on invertebrates, leaf litter retention, and the humification process. Ecosphere, 5(2), Bonett, R. M., Chippindale, P. T., Moler, P. E., Van Devender, R. W., & Wake, D. B. (2009). Evolution of gigantism in amphiumid salamanders. PLoS One, 4(5), e5615. Bowering, R., Wigle, R., Padgett, T., Adams, B., Cote, D., & Wiersma, Y. F. (2018). Searching for rare species: A comparison of Floristic Habitat Sampling and Adaptive Cluster Sampling for detecting and estimating abundance. Forest Ecology and Management, 407, 1-8. Bringloe, T. T., Adamowicz, S. J., Harvey, V. F., Jackson, J. K., & Cottenie, K. (2016). Detecting signatures of competition from observational data: a combined approach using DNA barcoding, diversity partitioning and checkerboards at small spatial scales. Freshwater Biology, 61(5), Brown, P. S., Hastings, S. A., & Frye, B. E. (1977). A comparison of the water-balance response in five species of plethodontid salamanders. Physiological Zoology, 50(3),

117 Bruce, R. C. (1982). Egg-laying, larval periods and metamorphosis of Eurycea bislineata and E. junaluska at Santeetlah Creek, North Carolina. Copeia, Canestrelli, D., Porretta, D., Lowe, W. H., Bisconti, R., Carere, C., & Nascetti, G. (2016). The tangled evolutionary legacies of range expansion and hybridization. Trends in Ecology & Evolution, 31(9), Carlson, B. E., Thawley, C. J., & Graham, S. P. (2016). Natural history of the valley and ridge salamander (Plethodon hoffmani): demography, movement, microhabitats, and abundance. Herpetological Conservation and Biology, 11(2), Caruso, N. M., Jacobs, J. F., & Rissler, L. J. (2017). An experimental approach to understanding elevation limits in a montane terrestrial salamander, Plethodon montanus. biorxiv, Che, J., Chen, H. M., Yang, J. X., Jin, J. Q., Jiang, K. E., Yuan, Z. Y., & Zhang, Y. P. (2012). Universal COI primers for DNA barcoding amphibians.molecular Ecology Resources, 12(2), Chen, W., Bi, K., & Fu, J. (2009). Frequent mitochondrial gene introgression among high elevation Tibetan megophryid frogs revealed by conflicting gene genealogies. Molecular Ecology, 18(13), Chunco, A. J. (2014). Hybridization in a warmer world. Ecology and Evolution, 4(10), Costa, A., Crovetto, F., & Salvidio, S. (2016). European plethodontid salamanders on the forest floor: local abundance is related to fine-scale environmental factors. Herpetol Conserv Biol, 11,

118 Crawford, A. J., Cruz, C., Griffith, E., Ross, H., Ibáñez, R., Lips, K. R., & Crump, P. (2013). DNA barcoding applied to ex situ tropical amphibian conservation programme reveals cryptic diversity in captive populations. Molecular Ecology Resources, 13(6), Crawford, A. J., Lips, K. R., & Bermingham, E. (2010). Epidemic disease decimates amphibian abundance, species diversity, and evolutionary history in the highlands of central Panama. Proceedings of the National Academy of Sciences, 107(31), Crocker, J. B., Bank, M. S., Loftin, C. S., & Jung Brown, R. E. (2007). Influence of observers and stream flow on Northern Two-Lined Salamander (Eurycea bislineata bislineata) relative abundance estimates in Acadia and Shenandoah National Parks, USA. Journal of Herpetology, 41(2), Cushman, S. A. (2006). Effects of habitat loss and fragmentation on amphibians: a review and prospectus. Biological Conservation, 128(2), D Aoust-Messier, A. M., & Lesbarreres, D. (2015). A peripheral view: post glacial history and genetic diversity of an amphibian in northern landscapes. Journal of Biogeography, 42(11), Darriba D, Taboada GL, Doallo R, Posada D jmodeltest Davic, R. D., & Welsh Jr, H. H. (2004). On the ecological roles of salamanders. Annual Review of Ecology, Evolution, and Systematics, Deitloff, J., Adams, D. C., Olechnowski, B. F., & Jaeger, R. G. (2008). Interspecific aggression in Ohio Plethodon: implications for competition. Herpetologica, 64(2),

119 Delmore, K. E., Hübner, S., Kane, N. C., Schuster, R., Andrew, R. L., Câmara, F., & Irwin, D. E. (2015). Genomic analysis of a migratory divide reveals candidate genes for migration and implicates selective sweeps in generating islands of differentiation. Molecular Ecology, 24(8), Dufresnes, C., Pellet, J., Bettinelli-Riccardi, S., Thiébaud, J., Perrin, N., & Fumagalli, L. (2016). Massive genetic introgression in threatened northern crested newts (Triturus cristatus) by an invasive congener (T. carnifex) in Western Switzerland. Conservation Genetics, 17(4), Dunn, E. R. (1926). The salamanders of the family Plethodontidae (Vol. 7). Smith college. ESRI (2011). ArcGIS Desktop: Release 10. Redlands, CA: Environmental Systems Research Institute Farallo, V. R., & Miles, D. B. (2016). The Importance of Microhabitat: A Comparison of Two Microendemic Species of Plethodon to the Widespread P. cinereus. Copeia, 104(1), Fisher-Reid, M. C., & Wiens, J. J. (2011). What are the consequences of combining nuclear and mitochondrial data for phylogenetic analysis? Lessons from Plethodon salamanders and 13 other vertebrate clades. BMC Evolutionary Biology, 11(1), 300. Fiske, I., & Chandler, R. (2011). Unmarked: an R package for fitting hierarchical models of wildlife occurrence and abundance. Journal of Statistical Software, 43(10),

120 Futuyma, D. J. (2013). Evolution. Third edition. Sunderland, Massachusetts U.S.A: Sinauer Associates, Inc. Publishers. Gavin, D. G., Fitzpatrick, M. C., Gugger, P. F., Heath, K. D., Rodríguez Sánchez, F., Dobrowski, S. Z.,... & Blois, J. L. (2014). Climate refugia: joint inference from fossil records, species distribution models and phylogeography. New Phytologist, 204(1), Grobman, A. B. (1944). The distribution of the salamanders of the genus Plethodon in eastern United States and Canada. Annals of the New York Academy of Sciences, 45(1), Grosjean, P., & Ibanez, F. (2014). Pastecs: Package for analysis of space-time ecological series. R package version Grosjean, S., Ohler, A., Chuaynkern, Y., Cruaud, C., & Hassanin, A. (2015). Improving biodiversity assessment of anuran amphibians using DNA barcoding of tadpoles. Case studies from Southeast Asia. Comptes Rendus Biologies, 338(5), Highton, R., Hastings, A. P., Palmer, C., Watts, R., Hass, C. A., Culver, M., & Arnold, S. J. (2012). Concurrent speciation in the eastern woodland salamanders (genus Plethodon): DNA sequences of the complete albumin nuclear and partial mitochondrial 12s genes. Molecular Phylogenetics and Evolution, 63(2), Highton, R. (1972). Distributional interactions among eastern North American salamanders of the genus Plethodon. In The distributional history of the biota of the southern Appalachians. Part III: Vertebrates (Vol. 4, pp ). Virginia Polytechnic Institute and State University. 107

121 Highton, R. (1986). Plethodon hoffmani Highton Valley and ridge salamander. Catalogue of American Amphibians and Reptiles, Highton, R. (1995). Speciation in eastern North American salamanders of the genus Plethodon. Annual Review of Ecology and Systematics, 26(1), Highton, R. (1999). Hybridization in the contact zone between Plethodon richmondi and Plethodon electromorphus in northern Kentucky. Herpetologica, Highton, R. (2005). Declines of eastern North American woodland salamanders (Plethodon). Amphibian declines: the conservation status of United States species, Highton, R. T. (1962). Revision of North American salamanders of the genus Plethodon. University of Florida. Hodgson, G. R. (2008). Amphibians as metrics of critical biological thresholds in forested headwater streams of the Pacific Northwest, USA.Freshwater Biology, 53(7), Huelsenbeck, J. P., & Ronquist, F. (2001). MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics, 17(8), IndianaCountyParks.org. Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Mentjies, P., & Drummond, A. (2012). Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, 28(12),

122 Knapp, S. M., Haas, C. A., Harpole, D. N., & Kirkpatrick, R. L. (2003). Initial effects of clearcutting and alternative silvicultural practices on terrestrial salamander abundance. Conservation Biology, 17(3), Kozak, K. H., Weisrock, D. W., & Larson, A. (2006). Rapid lineage accumulation in a non-adaptive radiation: phylogenetic analysis of diversification rates in eastern North American woodland salamanders (Plethodontidae: Plethodon). Proceedings of the Royal Society of London B: Biological Sciences, 273(1586), Kuchta, S. R., Brown, A. D., Converse, P. E., & Highton, R. (2016). Multilocus phylogeography and species delimitation in the Cumberland Plateau Salamander, Plethodon kentucki: Incongruence among data sets and methods. PloS one, 11(3), e Lehtinen, R. M., Steratore, A. F., Eyre, M. M., Cassagnol, E. S., Stern, M. L., & Edgington, H. A. (2016). Identification of widespread hybridization between two terrestrial salamanders using morphology, coloration, and molecular markers. Copeia,104(1), Leigh, JW, Bryant D (2015). PopART: Full-feature software for haplotype network construction. Methods Ecol Evol 6(9): Librado, P., & Rozas, J. (2009). DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics, 25(11), Litvinchuk, S. N., & Borkin, L. J. (2003). Variation in number of trunk vertebrae and in count of costal grooves in. Contributions to Zoology, 72(4),

123 Liu, K., Wang, F., Chen, W., Tu, L., Min, M. S., Bi, K., & Fu, J. (2010). Rampant historical mitochondrial genome introgression between two species of green pond frogs, Pelophylax nigromaculatus and P. plancyi. BMC Evolutionary Biology, 10(1), 201. Lyons, M. P., Shepard, D. B., & Kozak, K. H. (2016). Determinants of Range Limits in Montane Woodland Salamanders (Genus Plethodon). Copeia, 104(1), Marsh, D. (2009). Evaluating methods for sampling stream salamanders across multiple observers and habitat types. Applied Herpetology, 6(3), Maerz, J. C., Nuzzo, V. A., & Blossey, B. (2009). Declines in Woodland Salamander Abundance Associated with Non Native Earthworm and Plant Invasions. Conservation Biology,23(4), Mathis, A., Deckard, K., & Duer, C. (1998). Laboratory evidence for territorial behavior by the southern red-backed salamander, Plethodon serratus: influence of residency status and pheromonal advertisement. The Southwestern Naturalist, 1-5. Mayfield, M. M., & Levine, J. M. (2010). Opposing effects of competitive exclusion on the phylogenetic structure of communities. Ecology letters, 13(9), Mcb.berkley.edu.( ecture6_chapter8_screenviewing.pdf.) McCarthy, J., (2010). The distribution and relative abundance of the boreal felt lichen (Erioderma pedicellatum (Hue) P.M. Jørg) in the forests of the Avalon Peninsula, Newfoundland. Report submitted to Wildlife Division, Parks and Natural Areas Division, Department of Environment and Conservation, Government of Newfoundland and Labrador. 110

124 McCartney Melstad, E., & Shaffer, H. B. (2015). Amphibian molecular ecology and how it has informed conservation. Molecular ecology, 24(20), McGarvey, R., Burch, P., & Matthews, J. M. (2016). Precision of systematic and random sampling in clustered populations: habitat patches and aggregating organisms. Ecological applications, 26(1), Meyer, C. P., & Paulay, G. (2005). DNA barcoding: error rates based on comprehensive sampling. PLoS Biology, 3, Milanovich, J. R., Peterman, W. E., Nibbelink, N. P., & Maerz, J. C. (2010). Projected loss of a salamander diversity hotspot as a consequence of projected global climate change. PLoS One, 5(8), e Misava Y The method of counting costal grooves. In: Matsui M et ah,eds. Current Herpetologyin East Asia, Kioto, Herpet. Soc, Japan, Moskwik, M. (2014). Recent elevational range expansions in plethodontid salamanders (Amphibia: Plethodontidae) in the southern Appalachian Mountains. Journal of Biogeography, 41(10), Murphy, R. W., Crawford, A. J., Bauer, A. M., Che, J., Donnellan, S. C., Fritz, U., Haddad, C. F. B., Nagy, Z. T., Poyarkov, N. A., Vences, M., Wang, W., & Zhang, Y. P. (2013). Cold Code: the global initiative to DNA barcode amphibians and nonavian reptiles. Molecular Ecology Resources, 13, Natoli, A., Phillips, K. P., Richardson, D. S., & Jabado, R. W. (2017). Low genetic diversity after a bottleneck in a population of a critically endangered migratory marine turtle species. Journal of Experimental Marine Biology and Ecology, 491,

125 Nelson, S. K., Niemiller, M. L., & Fitzpatrick, B. M. (2017). Co-occurrence and Hybridization between Necturus maculosus and a Heretofore Unknown Necturus in the Southern Appalachians. Journal of Herpetology, 51(4), Netting, M. G. (1939). The ravine salamander, Plethodon richmondi Netting and Mittleman, in Pennsylvania. In Proceedings of the Pennsylvania Academy of Science (Vol. 13, pp ). Penn State University Press. Nosil, P. (2012). Ecological speciation. Oxford University Press. O Donnell, K. M., III, Thompson, F. R., & Semlitsch, R. D. (2015). Partitioning Detectability Components in Populations Subject to Within-Season Temporary Emigration Using Binomial Mixture Models. Plos ONE, 10(3), doi: /journal.pone O'Donnell, K. M., Thompson, F. R., & Semlitsch, R. D. (2014). Predicting variation in microhabitat utilization of terrestrial salamanders. Herpetologica, 70(3), O'Donnell, K. M., & Semlitsch, R. D. (2015). Advancing terrestrial salamander population ecology: the central role of imperfect detection. Journal of Herpetology, 49(4), Oksanen, J.R., R. Blanchet, R. Kindt, P. Legendre, P.R. Minchin, R.B. O Hara, G.L. Simpson, P. Solymos, M. Henry, H. Stevens, H. Wagner (2012) Vegan: Community Ecology Package. Department of Statistics and Mathematics Vienna University of Economics and Business Administration, Vienna. Available from: 112

126 Orozco terwengel, P., Andreone, F., Louis, E., & Vences, M. (2013). Mitochondrial introgressive hybridization following a demographic expansion in the tomato frogs of Madagascar, genus Dyscophus. Molecular ecology, 22(24), Pelletier, T. A., & Carstens, B. C. (2016). Comparing range evolution in two western Plethodon salamanders: glacial refugia, competition, ecological niches, and spatial sorting. Journal of biogeography, 43(11), Pereyra, M. O., Baldo, D., Blotto, B. L., Iglesias, P. P., Thomé, M. T., Haddad, C. F., & Faivovich, J. (2016). Phylogenetic relationships of toads of the Rhinella granulosa group (Anura: Bufonidae): a molecular perspective with comments on hybridization and introgression. Cladistics, 32(1), Petranka, J. W., Eldridge, M. E., & Haley, K. E. (1993). Effects of timber harvesting on southern Appalachian salamanders. Conservation biology, 7(2), Peterman, W. E., & Semlitsch, R. D. (2013). Fine-scale habitat associations of a terrestrial salamander: the role of environmental gradients and implications for population dynamics. PLoS One, 8(5), e R Development Core Team (2008). R: A language and environment for statistical computing. R Foundation for Statistical Computing,Vienna, Austria. ISBN , URL Ramzan, R., Weber, P., Linne, U., & Vogt, S. (2013). GAPDH: the missing link between glycolysis and mitochondrial oxidative phosphorylation?. Ratnasingham, S., & Hebert, P. D. (2007). BOLD: The Barcode of Life Data System ( barcodinglife. org). Molecular Ecology Resources, 7(3),

127 Royle, J. A. (2004). N mixture models for estimating population size from spatially replicated counts. Biometrics, 60(1), Ruben, J. A., & Boucot, A. J. (1989). The origin of the lungless salamanders (Amphibia: Plethodontidae). American Naturalist, Ryan, M. J., Giermakowski, J. T., Latella, I. M., & Snell, H. L. (2017). No Evidence of Hybridization Between the Arizona Toad (Anaxyrus microscaphus) and Woodhouse s Toad (A. woodhousii) in New Mexico, USA. Herpetological Conservation and Biology, 12(2), Schumer, M., Cui, R., Powell, D. L., Rosenthal, G. G., & Andolfatto, P. (2016). Ancient hybridization and genomic stabilization in a swordtail fish. Molecular Ecology, 25(11), Semlitsch, R. D. (1983). Growth and metamorphosis of larval red salamanders (Pseudotriton ruber) on the Coastal Plain of South Carolina. Herpetologica, Sequeira, F., Sodré, D., Ferrand, N., Bernardi, J. A., Sampaio, I., Schneider, H., & Vallinoto, M. (2011). Hybridization and massive mtdna unidirectional introgression between the closely related Neotropical toads Rhinella marina and R. schneideri inferred from mtdna and nuclear markers. BMC Evolutionary Biology, 11(1), 264 Shepard, D. B., & Burbrink, F. T. (2011). Local-scale environmental variation generates highly divergent lineages associated with stream drainages in a terrestrial salamander, Plethodon caddoensis. Molecular Phylogenetics and Evolution, 59(2),

128 Simons, R. R., & Felgenhauer, B. E. (1992). Identifying areas of chemical signal production in the red-backed salamander, Plethodon cinereus. Copeia, Sites Jr, J. W., Morando, M., Highton, R., Huber, F., & Jung, R. E. (2004). Phylogenetic relationships of the endangered Shenandoah Salamander (Plethodon shenandoah) and other salamanders of the Plethodon cinereus group (Caudata: Plethodontidae). Journal of Herpetology, 38(1), Smith, M., Poyarkov, N. A., & Hebert, P. D. (2008). DNA barcoding: CO1 DNA barcoding amphibians: take the chance, meet the challenge. Molecular Ecology Resources, 8(2), Smith, A. M., & Green, M. D. (2005). Dispersal and the metapopulation paradigm in amphibian ecology and conservation: are all amphibian populations metapopulations?.ecography, 28(1), Southerland, M. T., Jung, R. E., Baxter, D. P., Chellman, I. C., Mercurio, G., & Vølstad, J. H. (2004). Stream salamanders as indicators of stream quality in Maryland, USA. Applied Herpetology, 2(1), Stamatakis, A. (2014). RAxML version 8: a tool for phylogenetic analysis and postanalysis of large phylogenies. Bioinformatics, 30(9), Sullivan, B. K., Wooten, J., Schwaner, T. D., Sullivan, K. O., & Takahashi, M. (2015). Thirty years of hybridization between toads along the Agua Fria River in Arizona: I. Evidence from morphology and mtdna. Journal of Herpetology, 49(1),

129 Sung, W., Ackerman, M. S., Dillon, M. M., Platt, T. G., Fuqua, C., Cooper, V. S., & Lynch, M. (2016). Evolution of the insertion-deletion mutation rate across the tree of life. G3: Genes, Genomes, Genetics, 6(8), Suzuki, Y., Tomozawa, M., Koizumi, Y., Tsuchiya, K., & Suzuki, H. (2015). Estimating the molecular evolutionary rates of mitochondrial genes referring to Quaternary ice age events with inferred population expansions and dispersals in Japanese Apodemus. BMC Evolutionary Biology, 15(1), 187. Tamura, K., Kumar, S., Stecher, G. (2016). MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 33(7), Taylor, M. S., Ponting, C. P., & Copley, R. R. (2004). Occurrence and consequences of coding sequence insertions and deletions in mammalian genomes. Genome Research, 14(4), Thesing, B. D., Noyes, R. D., Starkey, D. E., & Shepard, D. B. (2016). Pleistocene climatic fluctuations explain the disjunct distribution and complex phylogeographic structure of the Southern Red-backed Salamander, Plethodon serratus. Evolutionary Ecology, 30(1), Thurow, G. (1976). Aggression and competition in eastern Plethodon (Amphibia, Urodela, Plethodontidae). Journal of Herpetology, Tilley, S. G. (1973). Desmognathus ochrophaeus. Catalogue of American Amphibians and Reptiles (CAAR). 116

130 Vazquez, V. M., Rothermel, B. B., & Pessier, A. P. (2009). Experimental infection of North American plethodontid salamanders with the fungus Batrachochytrium dendrobatidis. Diseases of Aquatic Organisms, 84(1), 1-7. Vieites, D. R., Min, M. S., & Wake, D. B. (2007). Rapid diversification and dispersal during periods of global warming by plethodontid salamanders. Proceedings of the National Academy of Sciences, 104(50), Vogel, L. S., & Johnson, S. G. (2008). Estimation of hybridization and introgression frequency in toads (genus: Bufo) using DNA sequence variation at mitochondrial and nuclear loci. Journal of Herpetology, 42(1), Wake, D. B., & Hanken, J. A. M. E. S. (2004). Direct development in the lungless salamanders: what are the consequences for developmental biology, evolution and phylogenesis?. International Journal of Developmental Biology, 40(4), Wakeley, J. (1996). The variance of pairwise nucleotide differences in two populations with migration. Theoretical population biology, 49(1), Walls, S. C., Barichivich, W. J., & Brown, M. E. (2013). Drought, deluge and declines: the impact of precipitation extremes on amphibians in a changing climate. Biology, 2(1), Weisrock, D. W., Kozak, K. H., & Larson, A. (2005). Phylogeographic analysis of mitochondrial gene flow and introgression in the salamander, Plethodon shermani. Molecular Ecology, 14(5), Wiens J, Engstrom T, Chippindale P (2006) Rapid diversification, incomplete isolation, and the speciation clock in North American Salamanders (genus Plethodon): testing the hybrid swarm hypothesis of rapid radiation. Evolution 60:

131 Xia, Y. U. N., Gu, H. F., Peng, R. U. I., Chen, Q. I. N., Zheng, Y. C., Murphy, R. W., & Zeng, X. M. (2012). COI is better than 16S rrna for DNA barcoding Asiatic salamanders (Amphibia: Caudata: Hynobiidae). Molecular Ecology Resources, 12(1), Zamudio, K. R., Bell, R. C., & Mason, N. A. (2016). Phenotypes in phylogeography: Species traits, environmental variation, and vertebrate diversification. Proceedings of the National Academy of Sciences, 113(29), Zhang, P., & Wake, D. B. (2009). Higher-level salamander relationships and divergence dates inferred from complete mitochondrial genomes. Molecular Phylogenetics and Evolution, 53(2), Zhou, X., Xie, Y., Zhang, Z. H., Wang, C. D., Sun, Y., Gu, X. B.,... & Yang, G. Y. (2013). Analysis of the genetic diversity of the nematode parasite Baylisascaris schroederi from wild giant pandas in different mountain ranges in China. Parasites & vectors, 6(1),

132 Appendix A Euclidean Distance Between Spring Populations Table 16 Euclidean Distance Between Spring Populations Site Kittani ng (n=5) Young Townsh ip (n=4) Tanom a (n=4) Trusal (n=4) Blue Spruce 1 (n=5) Game Lands 332 (n=3) Camero n County (n=2) Bear Cave (n=1) Pine Ridge (n=1) Blue Spruce Kittani ng (n=5) Young Towns hip (n=4) Tanom a (n=4) Trus al (n=4) 119 Blue Spru ce 1 (n=5) Game Lands 332 (n=3) Cam eron Coun ty (n=2) Bear Cave (n=1 ) Pine Ridg e (n=1 ) NA NA NA NA NA NA NA NA NA (n=1) Note Distance (km) Between Populations Included in ML and BI Topology Construction. (spring 2017)

133 Appendix B Genbank Sequences for Spring Phylogenies Table 17 Genbank Sequences for Spring Phylogenies Gene Species Genbank Accession Number COI Plethodon websteri Plethodon serratus Plethodon glutinosus Plethodon glutinosus Plethodon glutinosus Plethodon montanus Plethodon teyahalee Plethodon cinereus Plethodon cinereus Plethodon cinereus Plethodon cinereus Plethodon cinereus Plethodon cinereus Plethodon cinereus Plethodon hubrichti Plethodon hubrichti Plethodon hubrichti Pseudotriton ruber KU KU KU KU KU KU KU EF EF EF EF EF EF EF JF JF JF KU Cyt-b Plethodon hubrichti Plethodon hubrichti Plethodon hubrichti Plethodon serratus Plethodon serratus Plethodon serratus Plethodon hoffmani Plethodon hoffmani Plethodon virginia Plethodon Virginia Plethodon cinereus Plethodon cinereus Plethodon cinereus Plethodon shenandoah Plethodon shenandoah Plethodon shenandoah Plethodon nettingi Plethodon nettingi AY AY DQ KM AY KM AY DQ99499 AY AY EF AY JF DQ AY AY DQ DQ

134 Cyt-b (continued) Concatonated Plethodon netting Plethodon richmondi Plethodon richmondi Plethodon richmondi Plethodon electromorphus Plethodon electromorphus Plethodon electromorphus Plethodon patraeus Plethodon elongatus Plethodon elongatus Plethodon cinereus AY AY AY AY AY AY AY AY AY NC_ AY Note: Genbank Sequences used in Phylogenetic Reconstruction. (spring 2017) 121

135 Appendix C Cyt-b Pairwise Distances Table 18 Cyt-b Pairwise Distances Note Pairwise distances between cyt-b sequences included from Allegheny Plateau populations + Cameron County. (spring 2017) 122

136 Appendix D Concatonated Cyt-b and COI Pairwise Distances Table 19 Concatonated Cyt-b and COI Pairwise Distances Note Pairwise distance between concatenated samples from this study. KC2004 and KC1021 are P. cinereus and the rest are P. hoffmani. (spring 2017) 123

137 Appendix E Genbank Sequences for Fall Phylogenies Table 20 Genbank Sequences for Fall Phylogenies Gene Species Genbank Accession Number COI Plethodon hubrichti Plethodon hubrichti JF JF GAPD Plethodon kentucki Plethodon kentucki Plethodon kentucki Plethodon electromorphus Plethodon electromorphus Plethodon cinereus x electromorphus Plethodon cinereus x electromorphus Plethodon cinereus x electromorphus Plethodon cinereus x electromorphus Plethodon cinereus x electromorphus Plethodon cinereus x electromorphus Plethodon cinereus x electromorphus Plethodon cinereus x electromorphus Plethodon cinereus x electromorphus Plethodon cinereus x electromorphus Plethodon cinereus Plethodon cinereus KU KU KU KU KU KU KU KU KU KU KU KU KU KU KU KU KU POMC Plethodon elongatus Plethodon serratus Plethodon serratus Plethodon serratus Plethodon cinereus x electromorphus Plethodon cinereus x electromorphus Plethodon cinereus x electromorphus Plethodon cinereus Plethodon cinereus Plethodon cinereus Plethodon cinereus Plethodon electromorphus Plethodon electromorphus Plethodon electromorphus EU KM KM KM KU KU KU KU KU KU KU KU KU KU Note Genbank Sequences added to alignments for phylogenetic analyses. (fall 2017) 124

138 Appendix F Blue Spruce COI Pairwise Distances Table 21 Blue Spruce COI Pairwise Distances Note COI Pairwise Distance (Mean: 0.046) (fall 2017) 125