Prac%cal Bioinforma%cs for Life Scien%sts. Week 14, Lecture 28. István Albert Bioinforma%cs Consul%ng Center Penn State
|
|
- Heather Stanley
- 5 years ago
- Views:
Transcription
1 Prac%cal Bioinforma%cs for Life Scien%sts Week 14, Lecture 28 István Albert Bioinforma%cs Consul%ng Center Penn State
2 Final project A group of researchers are interested in studying protein binding loca%ons in a yet unknown genome. They hypothesize that observed phenotypic varia%ons will correlate with sequence varia%on of the bound loca%ons in this genome. The researchers perform two experimental procedures. 1. First they sequence the whole genome of the wild- type (normal, wt) phenotype with a paired end sequencing technology. 2. Second, they perform a chroma%n- immuno- precipita%on experiment that isolates DNA fragments corresponding to bound proteins. This second experiment is performed for both the wild- type (wt) phenotype and the mutant phenotype (m1).
3 Final project data (see course webpage) 1. The paired end whole- genome sequencing is stored in datasets r1.fq and r2.fq 2. ChIP- Seq data for the wild- type sample is stored in file p1.fq 3. ChIP- Seq data for the mutant sample is stored in file p2.fq
4 Ques%ons that need to be answered What is the es%mated size of your genome? How many binding loca%ons can you detect for each of the Chip- Seq datasets? Does the number of binding loca%ons vary? Can you observe any genomic varia%on between phenotypes in the bound loca%ons? Include a IGV screenshot of the loca%on of one binding site Tips: 1. there are many ways to solve the project. 2. there are fewer than 10 binding sites 3. at the bare minimum all ques%ons above may be be solved via three tools: velvet + bwa + samtools
5 Due date: next Thursday Project due by next Thursday (Dec 8 th ) Project related office hours on next Monday and Wednesday between 2 and 3pm Turn in all homework you might have missed (par%al credit will be given)
6 Classifica%on of metagenomics data One of the first ques%ons any life scien%st is asking what species is present in my data? Yet it may be the right ques%on just pubng a label makes the data more precise than it might be Current state of meta- genomics does not lend itself to accurate species level characteriza%on too many unknown bacteria too many unknown systema%c effects too many improperly designed experiments
7 We ll use and compare two classifica%on approaches BLAST à LCA (lowest common ancestor) à visualize with Megan (Metagenome Analyzer) Probabilis%c (bayesian) classifica%on for 16S rrna data via the RDP mul%classifier Download the data for lecture 28 from the course webpage
8 Megan Metagenome Analyzer Java based with a neat graphical user interface
9 Find and download the 16S rrna BLAST database
10 Run blast to generate the alignments We have two samples s1.fa and s2.fa that correspond to two condi%ons You can limit the number of alignments and use more threads if your computer can handle that à speeds up the process considerably
11 Our blast files This will need to be recognized by Megan to connect it to a taxonomy (we need to use a gi to taxonomy mapper) Neat feature: your original sequence names may also contain the taxonomy as a list, in which case Megan will parse that out. > [0]Bacteria;[1]Bacteroidetes;[2]Bacteroidia;[3]Bacteroidales;something In that case no addi%onal taxonomical informa%on is needed.
12 Result of the classifica%on You can also load up the s1.rma file directly
13 Classify at RDP Note: this classifies the sequences directly! No alignment step needed!
14 Results of the classifica%on
15 RPD mul%classifier from the command line Find and download the from the classifier webpage. It can generate combine the output for each file
16 Inves%ga%ng a bit more How do these methods work really: MEGAN à lowest common ancestor (read the Megan manual for more details) à but operates solely on sequence similarity - extract reads that map to a certain taxa and analyze the alignments RDP à breaks each sequence into words, and computes the likelyhood that a word comes from a certain taxa (it only works for 16s RNA data!)
Grundlagen der Bioinformatik Summer semester Lecturer: Prof. Daniel Huson
Grundlagen der Bioinformatik, SS 10, D. Huson, April 12, 2010 1 1 Introduction Grundlagen der Bioinformatik Summer semester 2010 Lecturer: Prof. Daniel Huson Office hours: Thursdays 17-18h (Sand 14, C310a)
More informationTaxonomical Classification using:
Taxonomical Classification using: Extracting ecological signal from noise: introduction to tools for the analysis of NGS data from microbial communities Bergen, April 19-20 2012 INTRODUCTION Taxonomical
More informationBioinformatics tools for phylogeny and visualization. Yanbin Yin
Bioinformatics tools for phylogeny and visualization Yanbin Yin 1 Homework assignment 5 1. Take the MAFFT alignment http://cys.bios.niu.edu/yyin/teach/pbb/purdue.cellwall.list.lignin.f a.aln as input and
More informationCS 6140: Machine Learning Spring What We Learned Last Week 2/26/16
Logis@cs CS 6140: Machine Learning Spring 2016 Instructor: Lu Wang College of Computer and Informa@on Science Northeastern University Webpage: www.ccs.neu.edu/home/luwang Email: luwang@ccs.neu.edu Sign
More informationTree Building Activity
Tree Building Activity Introduction In this activity, you will construct phylogenetic trees using a phenotypic similarity (cartoon microbe pictures) and genotypic similarity (real microbe sequences). For
More informationThe Importance of Systema2cs and Rassenkreis. Reading: Willi Hennig
The Importance of Systema2cs and Rassenkreis Reading: Throughout the class so far we seen that the distribu2on of an organism is the result of its biological history as well as geologic and clima4c history
More informationAssigning Taxonomy to Marker Genes. Susan Huse Brown University August 7, 2014
Assigning Taxonomy to Marker Genes Susan Huse Brown University August 7, 2014 In a nutshell Taxonomy is assigned by comparing your DNA sequences against a database of DNA sequences from known taxa Marker
More informationPGA: A Program for Genome Annotation by Comparative Analysis of. Maximum Likelihood Phylogenies of Genes and Species
PGA: A Program for Genome Annotation by Comparative Analysis of Maximum Likelihood Phylogenies of Genes and Species Paulo Bandiera-Paiva 1 and Marcelo R.S. Briones 2 1 Departmento de Informática em Saúde
More informationSec$on 9. Evolu$onary Rela$onships
Sec$on 9 Evolu$onary Rela$onships Sec$on 9 Learning Goals Explain why the ribosomal 16S gene is a good marker for molecular phylogene$c comparisons. Be able to interpret a phylogene$c tree. Explain the
More informationMicrobiome: 16S rrna Sequencing 3/30/2018
Microbiome: 16S rrna Sequencing 3/30/2018 Skills from Previous Lectures Central Dogma of Biology Lecture 3: Genetics and Genomics Lecture 4: Microarrays Lecture 12: ChIP-Seq Phylogenetics Lecture 13: Phylogenetics
More informationDesigning Information Devices and Systems II Fall 2018 Elad Alon and Miki Lustig Homework 9
EECS 16B Designing Information Devices and Systems II Fall 18 Elad Alon and Miki Lustig Homework 9 This homework is due Wednesday, October 31, 18, at 11:59pm. Self grades are due Monday, November 5, 18,
More informationSNPs versus sequences for phylogeography an explora:on using simula:ons and massively parallel sequencing in a non- model bird
SNPs versus sequences for phylogeography an explora:on using simula:ons and massively parallel sequencing in a non- model bird Michael G. Harvey, Brian T. Smith, Brant C. Faircloth, Travis C. Glenn, and
More informationTHEORY. Based on sequence Length According to the length of sequence being compared it is of following two types
Exp 11- THEORY Sequence Alignment is a process of aligning two sequences to achieve maximum levels of identity between them. This help to derive functional, structural and evolutionary relationships between
More informationCentrifuge: rapid and sensitive classification of metagenomic sequences
Centrifuge: rapid and sensitive classification of metagenomic sequences Daehwan Kim, Li Song, Florian P. Breitwieser, and Steven L. Salzberg Supplementary Material Supplementary Table 1 Supplementary Note
More informationComparison of Three Fugal ITS Reference Sets. Qiong Wang and Jim R. Cole
RDP TECHNICAL REPORT Created 04/12/2014, Updated 08/08/2014 Summary Comparison of Three Fugal ITS Reference Sets Qiong Wang and Jim R. Cole wangqion@msu.edu, colej@msu.edu In this report, we evaluate the
More informationIntroduc)on to RNA- Seq Data Analysis. Dr. Benilton S Carvalho Department of Medical Gene)cs Faculty of Medical Sciences State University of Campinas
Introduc)on to RNA- Seq Data Analysis Dr. Benilton S Carvalho Department of Medical Gene)cs Faculty of Medical Sciences State University of Campinas Material: hep://)ny.cc/rnaseq Slides: hep://)ny.cc/slidesrnaseq
More informationIntroduction to Engineering Analysis - ENGR1100 Course Description and Syllabus Monday / Thursday Sections. Fall '10.
Introduction to Engineering Analysis - ENGR1100 Course Description and Syllabus Monday / Thursday Sections Fall 2010 All course materials are available on the RPI Learning Management System (LMS) website.
More informationPhylogene)cs. IMBB 2016 BecA- ILRI Hub, Nairobi May 9 20, Joyce Nzioki
Phylogene)cs IMBB 2016 BecA- ILRI Hub, Nairobi May 9 20, 2016 Joyce Nzioki Phylogenetics The study of evolutionary relatedness of organisms. Derived from two Greek words:» Phle/Phylon: Tribe/Race» Genetikos:
More informationNaive Bayes classification
Naive Bayes classification Christos Dimitrakakis December 4, 2015 1 Introduction One of the most important methods in machine learning and statistics is that of Bayesian inference. This is the most fundamental
More informationPHYLOGENY AND SYSTEMATICS
AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 11 Chapter 26 Activity #15 NAME DATE PERIOD PHYLOGENY AND SYSTEMATICS PHYLOGENY Evolutionary history of species or group of related species SYSTEMATICS Study
More informationIntroduction to Bioinformatics. Shifra Ben-Dor Irit Orr
Introduction to Bioinformatics Shifra Ben-Dor Irit Orr Lecture Outline: Technical Course Items Introduction to Bioinformatics Introduction to Databases This week and next week What is bioinformatics? A
More informationComputational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
More informationIntroduction to Bioinformatics Online Course: IBT
Introduction to Bioinformatics Online Course: IBT Multiple Sequence Alignment Building Multiple Sequence Alignment Lec1 Building a Multiple Sequence Alignment Learning Outcomes 1- Understanding Why multiple
More informationA. Incorrect! In the binomial naming convention the Kingdom is not part of the name.
Microbiology Problem Drill 08: Classification of Microorganisms No. 1 of 10 1. In the binomial system of naming which term is always written in lowercase? (A) Kingdom (B) Domain (C) Genus (D) Specific
More informationDifferential Equations MTH 205
A Course Title & Number MTH 205 B Pre/Co requisite(s) MTH 104 C Number of credits 3 0 3 D Faculty Name Ayman Badawi E Term/ Year Fall 2014 F Sections CRN Days Time Location UTR 11:00 11:50 Office Hours:
More informationUVA CS / Introduc8on to Machine Learning and Data Mining
UVA CS 4501-001 / 6501 007 Introduc8on to Machine Learning and Data Mining Lecture 13: Probability and Sta3s3cs Review (cont.) + Naïve Bayes Classifier Yanjun Qi / Jane, PhD University of Virginia Department
More informationPhysics 1A, Lecture 2: Math Review and Intro to Mo;on Summer Session 1, 2011
Physics 1A, Lecture 2: Math Review and Intro to Mo;on Summer Session 1, 2011 Your textbook should be closed, though you may use any handwrieen notes that you have taken. You will use your clicker to answer
More informationMolecular and Cellular Biology
You Do Not Need to write down the following infos because all the following slides and all lecture notes will be uploaded at the link: http://itbe.hanyang.ac.kr This/today s file will be uploaded next
More informationCSCE 155N Fall Homework Assignment 2: Stress-Strain Curve. Assigned: September 11, 2012 Due: October 02, 2012
CSCE 155N Fall 2012 Homework Assignment 2: Stress-Strain Curve Assigned: September 11, 2012 Due: October 02, 2012 Note: This assignment is to be completed individually - collaboration is strictly prohibited.
More informationMay bring 1 sheet of paper with notes!! Both sides!! Printed/handwritten/whatever.. I don t really care
http://www.youtube.com/watch?v=p5_msrdg3hk This Class (Lecture 25): Death by Black Hole: Spaghettification Next Class: Compact Objects in the Solar System Night Obs due today HW9 due Monday Exam 2 next
More information4-1: Biodiversity and Evolution
4-1: Biodiversity and Evolution After this lecture you should be able to Explain the importance of biological diversity to an ecosystem. Classify species based on taxonomic categories. Explain how evolution
More informationWelcome to BIOL 572: Recombinant DNA techniques
Lecture 1: 1 Welcome to BIOL 572: Recombinant DNA techniques Agenda 1: Introduce yourselves Agenda 2: Course introduction Agenda 3: Some logistics for BIOL 572 Agenda 4: Q&A section Agenda 1: Introduce
More informationTeacher: Cheely/ Harbuck Course: Biology Period(s): All Day Week of: 1/12/15 EOCEP Lesson Plan/5E s
EOCEP Lesson Plan/5E s Day of the Week Monday Curriculum 2005 SDE Support Doc Standard:: B-4: The student will demonstrate an understanding of the molecular basis of heredity. Indicator: B-4.5 Goals (Objectives
More informationGEP Annotation Report
GEP Annotation Report Note: For each gene described in this annotation report, you should also prepare the corresponding GFF, transcript and peptide sequence files as part of your submission. Student name:
More informationRepor4ng Quality of Results
Analyzing Timing A,er you set the 4ming constraints such as clocks, input delays, and output delays, it is a good idea to use the check_4ming command to check for 4ming setup problems and 4ming condi4ons
More informationActive Learning and Optimized Information Gathering
Active Learning and Optimized Information Gathering Lecture 7 Learning Theory CS 101.2 Andreas Krause Announcements Project proposal: Due tomorrow 1/27 Homework 1: Due Thursday 1/29 Any time is ok. Office
More informationURP 4273 Section 3058 Survey Of Planning Information Systems (3 Credits) Spring 2017
URP 4273 Section 3058 Survey Of Planning Information Systems (3 Credits) Spring 2017 Instructor: Office Periods: Stanley Latimer 466 ARCH Phone: 352 294-1493 e-mail: latimer@geoplan.ufl.edu Monday Thursday,
More informationSynteny Portal Documentation
Synteny Portal Documentation Synteny Portal is a web application portal for visualizing, browsing, searching and building synteny blocks. Synteny Portal provides four main web applications: SynCircos,
More informationSoyBase, the USDA-ARS Soybean Genetics and Genomics Database
SoyBase, the USDA-ARS Soybean Genetics and Genomics Database David Grant Victoria Carollo Blake Steven B. Cannon Kevin Feeley Rex T. Nelson Nathan Weeks SoyBase Site Map and Navigation Video Tutorials:
More informationTaxonomy. Content. How to determine & classify a species. Phylogeny and evolution
Taxonomy Content Why Taxonomy? How to determine & classify a species Domains versus Kingdoms Phylogeny and evolution Why Taxonomy? Classification Arrangement in groups or taxa (taxon = group) Nomenclature
More informationGene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji
Gene Regula*on, ChIP- X and DNA Mo*fs Statistics in Genomics Hongkai Ji (hji@jhsph.edu) Genetic information is stored in DNA TCAGTTGGAGCTGCTCCCCCACGGCCTCTCCTCACATTCCACGTCCTGTAGCTCTATGACCTCCACCTTTGAGTCCCTCCTC
More informationMachine Learning: Homework 5
0-60 Machine Learning: Homework 5 Due 5:0 p.m. Thursday, March, 06 TAs: Travis Dick and Han Zhao Instructions Late homework policy: Homework is worth full credit if submitted before the due date, half
More informationTranscrip:on factor binding mo:fs
Transcrip:on factor binding mo:fs BMMB- 597D Lecture 29 Shaun Mahony Transcrip.on factor binding sites Short: Typically between 6 20bp long Degenerate: TFs have favorite binding sequences but don t require
More informationCS 6140: Machine Learning Spring What We Learned Last Week. Survey 2/26/16. VS. Model
Logis@cs CS 6140: Machine Learning Spring 2016 Instructor: Lu Wang College of Computer and Informa@on Science Northeastern University Webpage: www.ccs.neu.edu/home/luwang Email: luwang@ccs.neu.edu Assignment
More informationSequencing alignment Ameer Effat M. Elfarash
Sequencing alignment Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. aelfarash@aun.edu.eg Why perform a multiple sequence alignment? MSAs are at the heart of comparative genomics
More informationCS 6140: Machine Learning Spring 2016
CS 6140: Machine Learning Spring 2016 Instructor: Lu Wang College of Computer and Informa?on Science Northeastern University Webpage: www.ccs.neu.edu/home/luwang Email: luwang@ccs.neu.edu Logis?cs Assignment
More informationCS173 Lecture B, November 3, 2015
CS173 Lecture B, November 3, 2015 Tandy Warnow November 3, 2015 CS 173, Lecture B November 3, 2015 Tandy Warnow Announcements Examlet 7 is a take-home exam, and is due November 10, 11:05 AM, in class.
More informationFunctional Genomics Research Stream. Lecture: May 5, 2009 The Road to Publication
Functional Genomics Research Stream Lecture: May 5, 2009 The Road to Publication Final Lab Issues Lab Hours this Week: Wednesday 10 AM - 6 PM Thursday 10 AM - 6 PM One Hour Required (sign in, sign out)
More informationEsri UC2013. Technical Workshop.
Esri International User Conference San Diego, California Technical Workshops July 9, 2013 CAD: Introduction to using CAD Data in ArcGIS Jeff Reinhart & Phil Sanchez Agenda Overview of ArcGIS CAD Support
More informationLecture 3: Finite Automata
Administrivia Lecture 3: Finite Automata Everyone should now be registered electronically using the link on our webpage. If you haven t, do so today! I d like to have teams formed by next Wednesday at
More informationBiological Networks: Comparison, Conservation, and Evolution via Relative Description Length By: Tamir Tuller & Benny Chor
Biological Networks:,, and via Relative Description Length By: Tamir Tuller & Benny Chor Presented by: Noga Grebla Content of the presentation Presenting the goals of the research Reviewing basic terms
More informationEBI web resources II: Ensembl and InterPro
EBI web resources II: Ensembl and InterPro Yanbin Yin Fall 2015 h.p://www.ebi.ac.uk/training/online/course/ 1 Homework 3 Go to h.p://www.ebi.ac.uk/interpro/training.html and finish the second online training
More informationMiGA: The Microbial Genome Atlas
December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From
More informationMathematics 96 (3581) CA (Class Addendum) 1: Commutativity Mt. San Jacinto College Menifee Valley Campus Spring 2013
Mathematics 96 (3581) CA (Class Addendum) 1: Commutativity Mt. San Jacinto College Menifee Valley Campus Spring 2013 Name This class handout is worth a maximum of five (5) points. It is due no later than
More information08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega
BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments
More informationCS612 - Algorithms in Bioinformatics
Fall 2017 Databases and Protein Structure Representation October 2, 2017 Molecular Biology as Information Science > 12, 000 genomes sequenced, mostly bacterial (2013) > 5x10 6 unique sequences available
More informationMicrobes and you ON THE LATEST HUMAN MICROBIOME DISCOVERIES, COMPUTATIONAL QUESTIONS AND SOME SOLUTIONS. Elizabeth Tseng
Microbes and you ON THE LATEST HUMAN MICROBIOME DISCOVERIES, COMPUTATIONAL QUESTIONS AND SOME SOLUTIONS Elizabeth Tseng Dept. of CSE, University of Washington Johanna Lampe Lab, Fred Hutchinson Cancer
More informationCSC411 Fall 2018 Homework 5
Homework 5 Deadline: Wednesday, Nov. 4, at :59pm. Submission: You need to submit two files:. Your solutions to Questions and 2 as a PDF file, hw5_writeup.pdf, through MarkUs. (If you submit answers to
More informationBiology Day 15. Monday, September 22 Tuesday, September 23, 2014
Biology Day 15 Monday, September 22 Tuesday, September 23, 2014 Title: Cell Video Notes A Then, underneath, answer the following: 1. Write down today s FLT. 2. What are the three parts of the cell theory?
More informationHydrologic Engineering Applications of Geographic Information Systems
Hydrologic Engineering Applications of Geographic Information Systems Davis, California Objectives: The participant will acquire practical knowledge and skills in the application of GIS technologies for
More informationMath.3336: Discrete Mathematics. Combinatorics: Basics of Counting
Math.3336: Discrete Mathematics Combinatorics: Basics of Counting Instructor: Dr. Blerina Xhabli Department of Mathematics, University of Houston https://www.math.uh.edu/ blerina Email: blerina@math.uh.edu
More informationIntroduction to Evolutionary Concepts
Introduction to Evolutionary Concepts and VMD/MultiSeq - Part I Zaida (Zan) Luthey-Schulten Dept. Chemistry, Beckman Institute, Biophysics, Institute of Genomics Biology, & Physics NIH Workshop 2009 VMD/MultiSeq
More informationAlgorithmics and Bioinformatics
Algorithmics and Bioinformatics Gregory Kucherov and Philippe Gambette LIGM/CNRS Université Paris-Est Marne-la-Vallée, France Schedule Course webpage: https://wikimpri.dptinfo.ens-cachan.fr/doku.php?id=cours:c-1-32
More informationECE321 Electronics I
ECE321 Electronics I Lecture 1: Introduction to Digital Electronics Payman Zarkesh-Ha Office: ECE Bldg. 230B Office hours: Tuesday 2:00-3:00PM or by appointment E-mail: payman@ece.unm.edu Slide: 1 Textbook
More informationEBI web resources II: Ensembl and InterPro. Yanbin Yin Spring 2013
EBI web resources II: Ensembl and InterPro Yanbin Yin Spring 2013 1 Outline Intro to genome annotation Protein family/domain databases InterPro, Pfam, Superfamily etc. Genome browser Ensembl Hands on Practice
More informationProblem Set #2 Due: 1:00pm on Monday, Oct 15th
Chris Piech PSet #2 CS109 October 5, 2018 Problem Set #2 Due: 1:00pm on Monday, Oct 15th For each problem, briefly explain/justify how you obtained your answer in order to obtain full credit. Your explanations
More informationLabs: Chelsea Ackroyd Office Location: FMAB 005 Office Hours: M 08:45 11:45 AM or by appointment
Introduction to Geographic Information Systems (GEOG 3140 and 314) & GIS Fundamentals (GEOG 6139) Fall 2017 Section 002 M 01:25 02:45 PM Section 003 M 03:00 4:20 PM Section 004 W 01:25 02:45 PM M Lib 1150
More informationAnnotation Error in Public Databases ALEXANDRA SCHNOES UNIVERSITY OF CALIFORNIA, SAN FRANCISCO OCTOBER 25, 2010
Annotation Error in Public Databases ALEXANDRA SCHNOES UNIVERSITY OF CALIFORNIA, SAN FRANCISCO OCTOBER 25, 2010 1 New genomes (and metagenomes) sequenced every day... 2 3 3 3 3 3 3 3 3 3 Computational
More informationInstructor: Dr. Darryl Kropf 203 S. Biology ; please put cell biology in subject line
Biology 2020 PRINCIPLES OF CELL BIOLOGY Spring 2004 In Principles of Cell Biology, we will explore the structure, function, and evolution of living cells, including prokaryotes (archae and eubacteria)
More informationAnnouncements Monday, September 18
Announcements Monday, September 18 WeBWorK 1.4, 1.5 are due on Wednesday at 11:59pm. The first midterm is on this Friday, September 22. Midterms happen during recitation. The exam covers through 1.5. About
More informationN U C L : R E A C T O R O P E R A T I O N A N D R E G U L A T O R Y P O L I C Y, I
N U C L 6 0 6 0 : R E A C T O R O P E R A T I O N A N D R E G U L A T O R Y P O L I C Y, I FALL 2013 INSTRUCTORS: Gregory Moffitt & Ryan Schow LECTURES: MONDAY & WEDNESDAY 11:50 AM 1:10 PM MEB 1206 OFFICE
More informationInvestigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST
Investigation 3: Comparing DNA Sequences to Understand Evolutionary Relationships with BLAST Introduction Bioinformatics is a powerful tool which can be used to determine evolutionary relationships and
More informationURP 4273 Section 8233 Introduction to Planning Information Systems (3 Credits) Fall 2017
URP 4273 Section 8233 Introduction to Planning Information Systems (3 Credits) Fall 2017 Instructor: Office Periods: Stanley Latimer 466 ARCH Phone: 352 294-1493 e-mail: latimer@geoplan.ufl.edu Monday
More informationChapter 19: Taxonomy, Systematics, and Phylogeny
Chapter 19: Taxonomy, Systematics, and Phylogeny AP Curriculum Alignment Chapter 19 expands on the topics of phylogenies and cladograms, which are important to Big Idea 1. In order for students to understand
More informationCWMS Modeling for Real-Time Water Management
Hydrologic Engineering Center Training Course on CWMS Modeling for Real-Time Water Management August 2018 Davis, California The Corps Water Management System (CWMS) is a software and hardware system to
More informationAS The Astronomical Universe. Prof. Merav Opher - Fall 2013
SYLLABUS AS 102 - The Astronomical Universe Prof. Merav Opher - Fall 2013 Course Catalog Summary: The birth and death of stars; red giants, white dwarfs, black holes; our galaxy, the Milky Way, and other
More informationTopics in General Chemistry Chemistry 103 Fall 2017
Topics in General Chemistry Chemistry 103 Fall 2017 Instructor: Professor Oertel, N280 Science Center, 775-8989, catherine.oertel@oberlin.edu Class meeting: MWF 11-11:50 am, Science Center A255 Laboratory
More informationLast updated: Copyright
Last updated: 2012-08-20 Copyright 2004-2012 plabel (v2.4) User s Manual by Bioinformatics Group, Institute of Computing Technology, Chinese Academy of Sciences Tel: 86-10-62601016 Email: zhangkun01@ict.ac.cn,
More informationCPSC 340: Machine Learning and Data Mining. Regularization Fall 2017
CPSC 340: Machine Learning and Data Mining Regularization Fall 2017 Assignment 2 Admin 2 late days to hand in tonight, answers posted tomorrow morning. Extra office hours Thursday at 4pm (ICICS 246). Midterm
More information1. HyperLogLog algorithm
SUPPLEMENTARY INFORMATION FOR KRAKENHLL (BREITWIESER AND SALZBERG, 2018) 1. HyperLogLog algorithm... 1 2. Database building and reanalysis of the patient data (Salzberg, et al., 2016)... 7 3. Enabling
More informationBiology 559R: Introduction to Phylogenetic Comparative Methods Topics for this week (Jan 27 & 29):
Biology 559R: Introduction to Phylogenetic Comparative Methods Topics for this week (Jan 27 & 29): Statistical estimation of models of sequence evolution Phylogenetic inference using maximum likelihood:
More informationCLASSIFICATION UNIT GUIDE DUE WEDNESDAY 3/1
CLASSIFICATION UNIT GUIDE DUE WEDNESDAY 3/1 MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 2/13 2/14 - B 2/15 2/16 - B 2/17 2/20 Intro to Viruses Viruses VS Cells 2/21 - B Virus Reproduction Q 1-2 2/22 2/23
More informationWeek 10! !
Week 10! 10-24-2013! Annotated Bibliography! Sources of papers! 3 papers! Peer-reviewed scientific literature (no review articles)! No more than 2 from:! the same author! the same journal! 2 of the 3 must
More informationEBI web resources II: Ensembl and InterPro
EBI web resources II: Ensembl and InterPro Yanbin Yin http://www.ebi.ac.uk/training/online/course/ 1 Homework 3 Go to http://www.ebi.ac.uk/interpro/training.htmland finish the second online training course
More informationA Bayesian taxonomic classification method for 16S rrna gene sequences with improved species-level accuracy
Gao et al. BMC Bioinformatics (2017) 18:247 DOI 10.1186/s12859-017-1670-4 SOFTWARE Open Access A Bayesian taxonomic classification method for 16S rrna gene sequences with improved species-level accuracy
More information2MHR. Protein structure classification is important because it organizes the protein structure universe that is independent of sequence similarity.
Protein structure classification is important because it organizes the protein structure universe that is independent of sequence similarity. A global picture of the protein universe will help us to understand
More informationBergey s Manual Classification Scheme. Vertical inheritance and evolutionary mechanisms
Bergey s Manual Classification Scheme Gram + Gram - No wall Funny wall Vertical inheritance and evolutionary mechanisms a b c d e * * a b c d e * a b c d e a b c d e * a b c d e Accumulation of neutral
More informationALDEx: ANOVA-Like Differential Gene Expression Analysis of Single-Organism and Meta-RNA-Seq
ALDEx: ANOVA-Like Differential Gene Expression Analysis of Single-Organism and Meta-RNA-Seq Andrew Fernandes, Gregory Gloor, Jean Macklaim July 18, 212 1 Introduction This guide provides an overview of
More informationSupplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc
Supplemental Data. Perea-Resa et al. Plant Cell. (22)..5/tpc.2.3697 Sm Sm2 Supplemental Figure. Sequence alignment of Arabidopsis LSM proteins. Alignment of the eleven Arabidopsis LSM proteins. Sm and
More informationCSE373: Data Structures and Algorithms Lecture 2: Proof by & Algorithm Analysis. Lauren Milne Summer 2015
CSE373: Data Structures and Algorithms Lecture 2: Proof by Induc@on & Algorithm Analysis Lauren Milne Summer 2015 Today Did everyone get email sent on Monday about TA Sec@ons star@ng on Thursday? Homework
More informationDisplaying Latitude & Longitude Data (XY Data) in ArcGIS
Displaying Latitude & Longitude Data (XY Data) in ArcGIS Created by Barbara Parmenter and updated on 2/15/2018 If you have a table of data that has longitude and latitude, or XY coordinates, you can view
More informationC3020 Molecular Evolution. Exercises #3: Phylogenetics
C3020 Molecular Evolution Exercises #3: Phylogenetics Consider the following sequences for five taxa 1-5 and the known outgroup O, which has the ancestral states (note that sequence 3 has changed from
More informationCrowdsourcing Mul/- Label Classifica/on. Jonathan Bragg University of Washington
Crowdsourcing Mul/- Label Classifica/on Jonathan Bragg University of Washington Collaborators Dan Weld University of Washington Mausam University of Washington à IIT Delhi Overview What is mul?- label
More informationBiology 211 (2) Week 1 KEY!
Biology 211 (2) Week 1 KEY Chapter 1 KEY FIGURES: 1.2, 1.3, 1.4, 1.5, 1.6, 1.7 VOCABULARY: Adaptation: a trait that increases the fitness Cells: a developed, system bound with a thin outer layer made of
More informationPrerequisite: Math 40 or Math 41B with a minimum grade of C, or the equivalent.
MATH 80 Intermediate Algebra #0630 El Camino College Room: MCS 219A MTWTH 11:30 12:40pm Fall 2011 Instructor: GREG FRY email: gfry@elcamino.edu Voice Mail: 310-660-3573 (5220) Office: MCS 104U Office Hours:
More informationMath.3336: Discrete Mathematics. Applications of Propositional Logic
Math.3336: Discrete Mathematics Applications of Propositional Logic Instructor: Dr. Blerina Xhabli Department of Mathematics, University of Houston https://www.math.uh.edu/ blerina Email: blerina@math.uh.edu
More informationData Structures & Database Queries in GIS
Data Structures & Database Queries in GIS Objective In this lab we will show you how to use ArcGIS for analysis of digital elevation models (DEM s), in relationship to Rocky Mountain bighorn sheep (Ovis
More informationIntegration by Parts Logarithms and More Riemann Sums!
Integration by Parts Logarithms and More Riemann Sums! James K. Peterson Department of Biological Sciences and Department of Mathematical Sciences Clemson University September 16, 2013 Outline 1 IbyP with
More informationEnsemble of Climate Models
Ensemble of Climate Models Claudia Tebaldi Climate Central and Department of Sta7s7cs, UBC Reto Knu>, Reinhard Furrer, Richard Smith, Bruno Sanso Outline Mul7 model ensembles (MMEs) a descrip7on at face
More informationSequencing alignment Ameer Effat M. Elfarash
Sequencing alignment Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. amir_effat@yahoo.com Why perform a multiple sequence alignment? MSAs are at the heart of comparative genomics
More information