What to do with a billion years of evolution

Size: px
Start display at page:

Download "What to do with a billion years of evolution"

Transcription

1 What to do with a billion years of evolution Melissa DeBiasse University of Florida Whitney Laboratory for Marine melissa.debiasse@gmail.com melissadebiasse.weebly.com

2 Acknowledgements University of Florida Ryan Lab PI: Joseph Ryan Alexandra Hernandez Jessica Whelpley DEEPC PI: Steven Haddock Monterey Bay Aquarium Research Institute Darren Schultz Jacob Winnikoff PI: Erik Thuesen The Evergreen State College Telissa Wilson Warren Francis University of Southern Denmark Funding NSF Dimensions of Biodiversity (154679, , )

3 Porifera nophora Ctenophora Placozoa Cnidaria Bilateria Ctenophora nophora Porifera Animals Placozoa Cnidaria Bilateria Choanoflagellata Philippe et al. 009 Pick et al. 010 Nosenko et al. 013 Pisani et al. 015 Dunn et al. 008 Ryan et al. 013, Hejnol et al. 009 Moroz et al. 014, Chang et al. 015 Whelan et al. 015, Torruella et al. 015 Simion et al. 017 Feuda et al. 017 Borowiec et al. 015, Whelan et al. 017, Arcila et al. 017 Shen et al. 017

4 hora hora Choanoflagellata Porifera Animals Placozoa Cnidaria Bilateria Who cares? Accurate species trees are important tools for understanding evolutionary history Evolution of neural cell types

5 hora Ctenophora hora Porifera Placozoa Cnidaria Cnidaria Bilateria Bilateria Porifera x Choanoflagellata Choanoflagellata Choanoflagellata x x Animals Placozoa Cnidaria Bilateria 1 origin, 1 loss 1 origin, losses Ctenophora Ctenophora Ctenophora Porifera Animals Animals Placozoa Cnidaria Cnidaria Bilateria Bilateria Porifera Choanoflagellata Animals Porifera Placozoa Cnidaria Bilateria Choanoflagellata Choanoflagellata Choanoflagellata Animals Placozoa Cnidaria Bilateria origins origins Evolution of neural cell types

6 Species trees estimated over different time scales species complex in cardinals 10 mya relationships among insects 500 mya shallow introgression rapid radiation RADseq/UCEs nucleotide alignments gene tree / species tree methods past origin of multicellularity >1 billion mya time present deep ancient splits saturation compositional heterogeneity methods???

7 ophora nophora nophora nophora Ctenophora Ctenophora Choanoflagellata Choanoflagellata Porifera Porifera Animals Placozoa Bilateria Animals Placozoa Cnidaria Cnidaria crown group mya

8 Dimensions of Biodiversity DEEPC: Diversity, Ecology, EcoPhysiology of Ctenophores low high low high low high low high

9 Dimensions of Biodiversity DEEPC: Diversity, Ecology, EcoPhysiology of Ctenophores Comprehensive ctenophore species phylogeny Reconstruct ancestral depths Identify evolutionary depth transitions Test loci for convergent evolution to depth Link genotype to phenotype

10 Promoting transparency and overcoming bias in phylogenetics OUTLINE DECISIONS BEFORE RUNNING ANALYSES TRANSPARENCY ACCOUNTABILITY reproducability collaboration education Melissa DeBiasse Joseph Ryan & Melissa DeBiasse Whitney Laboratory for Marine Bioscience - Ryan Lab #154597

11 Data processing & analysis pipeline RNA-Seq

12 Data processing & analysis pipeline RNA-Seq Assemble & translate transcriptome CCGGAACGAGCACAGCCA PGRAQP

13 Data processing & analysis pipeline RNA-Seq Assemble & translate transcriptome Filter non-target sequences >Trinity_134 PGRAQPPGRAQPPGRAQP PVRNQADCHAQIPGMAFTI PGRAQPPGRAQPPGRAQP PVRNQADCHAQIPGMAFTI BLAST database metazoa non-metazoa

14 Data processing & analysis pipeline RNA-Seq Assemble & translate transcriptome Filter non-target sequences Identify orthologous loci

15 Orthologs: evolved from a common ancestor by speciation red cteno 1 gold cteno 1 Orthologs blue cteno 1a blue cteno 1b

16 Orthologs: evolved from a common ancestor by speciation Paralogs: produced through a duplication event red cteno 1 gold cteno 1 blue cteno 1a blue cteno 1b Paralogs

17 Orthologs: evolved from a common ancestor by speciation Paralogs: produced through a duplication event Orthogroup: orthologs and paralogs from MRCA red cteno 1 gold cteno 1 blue cteno 1a blue cteno 1b Orthogroup

18 colors = species numbers = genes

19 X 3 X gene loss 1 3 colors = species numbers = genes

20 gene duplication 1 3 colors = species numbers = genes

21 what are the ideal orthogroups?

22 orthogroup 1

23 orthogroup

24 orthogroup 3

25 identifying orthology complicated by gene dup. & loss, rate variation, HGT, contamination, etc

26 Splitting colors = species numbers = genes

27 Lumping colors = species numbers = genes

28 no. of orthogroups OrthoFinder number of species in an orthogroup

29 no. of orthogroups Splitting + translation artifacts number of species in an orthogroup

30 no. of orthogroups Splitting + gene loss number of species in an orthogroup

31 no. of orthogroups Lumping + single-copy orthogroups number of species in an orthogroup

32 no. of orthogroups OrthoFinder groups w/ paralogs groups w/ no paralogs number of species in o.g.

33 Orthogroup filtering colors = species numbers = genes 3 3

34 Orthogroup filtering Minimum number of taxa (80%) colors = species numbers = genes 3 3

35 Orthogroup filtering Minimum number of taxa (80%) colors = species numbers = genes 3 3

36 Orthogroup filtering Minimum number of taxa (80%) Max n paralogs per species in an orthogroup () colors = species numbers = genes 3 3

37 Orthogroup filtering Minimum number of taxa (80%) Max n paralogs per species in an orthogroup () colors = species numbers = genes 3 3

38 Orthogroup filtering Minimum number of taxa (80%) Max n paralogs per species in an orthogroup () colors = species numbers = genes 3 3

39 Orthogroup filtering Minimum number of taxa (80%) Max n paralogs per species in an orthogroup () PhyloTreePruner colors = species numbers = genes 3 3

40 Orthogroup filtering Minimum number of taxa (80%) Max n paralogs per species in an orthogroup () PhyloTreePruner colors = species numbers = genes X X

41 Orthogroup filtering colors = species numbers = genes

42 Align & concatenate single-copy orthogroups colors = species numbers = genes

43 Use data matrix to infer species phylogeny multi-locus concatenated species tree

44 PIPELINE Illumina Trinity TransDecoder Alien Index Orthofinder PhyloTreePruner custom script RAxML/IQ-TREE/PB RNA-Seq Assemble Translate Filter Orthogroups Paralogs Concatenate Tree >Trinity_1357 CCGGAACGAGCACAGCCA >Trinity_1357_pep PGRAQPWLIAPQRAWGLQR BLAST database metazoa non-metazoa X

45 Thank you Questions? Mnemiopsis leidyi photo: Joseph Ryan

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other?

Phylogeny and systematics. Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Why are these disciplines important in evolutionary biology and how are they related to each other? Phylogeny and systematics Phylogeny: the evolutionary history of a species

More information

Orthology Part I: concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona

Orthology Part I: concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona Orthology Part I: concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona (tgabaldon@crg.es) http://gabaldonlab.crg.es Homology the same organ in different animals under

More information

Large-scale gene family analysis of 76 Arthropods

Large-scale gene family analysis of 76 Arthropods Large-scale gene family analysis of 76 Arthropods i5k webinar / September 5, 28 Gregg Thomas @greggwcthomas Indiana University The genomic basis of Arthropod diversity https://www.biorxiv.org/content/early/28/8/4/382945

More information

Processes of Evolution

Processes of Evolution 15 Processes of Evolution Forces of Evolution Concept 15.4 Selection Can Be Stabilizing, Directional, or Disruptive Natural selection can act on quantitative traits in three ways: Stabilizing selection

More information

08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega

08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega BLAST Multiple Sequence Alignments: Clustal Omega What does basic BLAST do (e.g. what is input sequence and how does BLAST look for matches?) Susan Parrish McDaniel College Multiple Sequence Alignments

More information

BLAST. Varieties of BLAST

BLAST. Varieties of BLAST BLAST Basic Local Alignment Search Tool (1990) Altschul, Gish, Miller, Myers, & Lipman Uses short-cuts or heuristics to improve search speed Like speed-reading, does not examine every nucleotide of database

More information

CHAPTERS 24-25: Evidence for Evolution and Phylogeny

CHAPTERS 24-25: Evidence for Evolution and Phylogeny CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology

More information

Session 5: Phylogenomics

Session 5: Phylogenomics Session 5: Phylogenomics B.- Phylogeny based orthology assignment REMINDER: Gene tree reconstruction is divided in three steps: homology search, multiple sequence alignment and model selection plus tree

More information

Orthology Part I concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona

Orthology Part I concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona Orthology Part I concepts and implications Toni Gabaldón Centre for Genomic Regulation (CRG), Barcelona Toni Gabaldón Contact: tgabaldon@crg.es Group website: http://gabaldonlab.crg.es Science blog: http://treevolution.blogspot.com

More information

Techniques for generating phylogenomic data matrices: transcriptomics vs genomics. Rosa Fernández & Marina Marcet-Houben

Techniques for generating phylogenomic data matrices: transcriptomics vs genomics. Rosa Fernández & Marina Marcet-Houben Techniques for generating phylogenomic data matrices: transcriptomics vs genomics Rosa Fernández & Marina Marcet-Houben DE NOVO Raw reads Sanitize Filter Assemble Translate Reduce reduncancy Download DATABASES

More information

8/23/2014. Phylogeny and the Tree of Life

8/23/2014. Phylogeny and the Tree of Life Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major

More information

Comparative Genomics II

Comparative Genomics II Comparative Genomics II Advances in Bioinformatics and Genomics GEN 240B Jason Stajich May 19 Comparative Genomics II Slide 1/31 Outline Introduction Gene Families Pairwise Methods Phylogenetic Methods

More information

MiGA: The Microbial Genome Atlas

MiGA: The Microbial Genome Atlas December 12 th 2017 MiGA: The Microbial Genome Atlas Jim Cole Center for Microbial Ecology Dept. of Plant, Soil & Microbial Sciences Michigan State University East Lansing, Michigan U.S.A. Where I m From

More information

Gene Families part 2. Review: Gene Families /727 Lecture 8. Protein family. (Multi)gene family

Gene Families part 2. Review: Gene Families /727 Lecture 8. Protein family. (Multi)gene family Review: Gene Families Gene Families part 2 03 327/727 Lecture 8 What is a Case study: ian globin genes Gene trees and how they differ from species trees Homology, orthology, and paralogy Last tuesday 1

More information

Molecular Phylogenetics and Evolution

Molecular Phylogenetics and Evolution Molecular Phylogenetics and Evolution 67 (2013) 223 233 Contents lists available at SciVerse ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev Deep metazoan

More information

Chapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships

Chapter 26: Phylogeny and the Tree of Life Phylogenies Show Evolutionary Relationships Chapter 26: Phylogeny and the Tree of Life You Must Know The taxonomic categories and how they indicate relatedness. How systematics is used to develop phylogenetic trees. How to construct a phylogenetic

More information

Homology and Information Gathering and Domain Annotation for Proteins

Homology and Information Gathering and Domain Annotation for Proteins Homology and Information Gathering and Domain Annotation for Proteins Outline Homology Information Gathering for Proteins Domain Annotation for Proteins Examples and exercises The concept of homology The

More information

SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION. Using Anatomy, Embryology, Biochemistry, and Paleontology

SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION. Using Anatomy, Embryology, Biochemistry, and Paleontology SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION Using Anatomy, Embryology, Biochemistry, and Paleontology Scientific Fields Different fields of science have contributed evidence for the theory of

More information

Inferring phylogeny. Constructing phylogenetic trees. Tõnu Margus. Bioinformatics MTAT

Inferring phylogeny. Constructing phylogenetic trees. Tõnu Margus. Bioinformatics MTAT Inferring phylogeny Constructing phylogenetic trees Tõnu Margus Contents What is phylogeny? How/why it is possible to infer it? Representing evolutionary relationships on trees What type questions questions

More information

Quantitative Genetics & Evolutionary Genetics

Quantitative Genetics & Evolutionary Genetics Quantitative Genetics & Evolutionary Genetics (CHAPTER 24 & 26- Brooker Text) May 14, 2007 BIO 184 Dr. Tom Peavy Quantitative genetics (the study of traits that can be described numerically) is important

More information

Unit 7: Evolution Guided Reading Questions (80 pts total)

Unit 7: Evolution Guided Reading Questions (80 pts total) AP Biology Biology, Campbell and Reece, 10th Edition Adapted from chapter reading guides originally created by Lynn Miriello Name: Unit 7: Evolution Guided Reading Questions (80 pts total) Chapter 22 Descent

More information

Evolution of Body Size in Bears. How to Build and Use a Phylogeny

Evolution of Body Size in Bears. How to Build and Use a Phylogeny Evolution of Body Size in Bears How to Build and Use a Phylogeny Lesson II Using a Phylogeny Objectives for Lesson II: 1. Overview of concepts 1. Simple ancestral state reconstruction on the bear phylogeny

More information

The comb jelly opsins and the origins of animal phototransduction. Corresponding authors: Davide Pisani

The comb jelly opsins and the origins of animal phototransduction. Corresponding authors: Davide Pisani Genome Biology and Evolution Advance Access published July 24, 2014 doi:10.1093/gbe/evu154 The comb jelly opsins and the origins of animal phototransduction Roberto Feuda 1*, Omar Rota-Stebelli 2 Todd

More information

BIO 221 Invertebrate Zoology I Spring Correction: Porifera. Lower Metazoan Clades: Choanoflagellata Porifera Placozoa Cnidaria Ctenophora

BIO 221 Invertebrate Zoology I Spring Correction: Porifera. Lower Metazoan Clades: Choanoflagellata Porifera Placozoa Cnidaria Ctenophora BIO 221 Invertebrate Zoology I Spring 2010 Stephen M. Shuster Northern Arizona University http://www4.nau.edu/isopod Lecture 6 Correction: Porifera a. Are distinct from the Placozoa by: 1. Have collar

More information

Evolutionary Bioinformatics

Evolutionary Bioinformatics Open Access: Full open access to this and thousands of other papers at http://www.la-press.com. Evolutionary Bioinformatics TreSpEx Detection of Misleading Signal in Phylogenetic Reconstructions Based

More information

Phylogenetic trees 07/10/13

Phylogenetic trees 07/10/13 Phylogenetic trees 07/10/13 A tree is the only figure to occur in On the Origin of Species by Charles Darwin. It is a graphical representation of the evolutionary relationships among entities that share

More information

BLAST Database Searching. BME 110: CompBio Tools Todd Lowe April 8, 2010

BLAST Database Searching. BME 110: CompBio Tools Todd Lowe April 8, 2010 BLAST Database Searching BME 110: CompBio Tools Todd Lowe April 8, 2010 Admin Reading: Read chapter 7, and the NCBI Blast Guide and tutorial http://www.ncbi.nlm.nih.gov/blast/why.shtml Read Chapter 8 for

More information

Chapter 22: Descent with Modification 1. BRIEFLY summarize the main points that Darwin made in The Origin of Species.

Chapter 22: Descent with Modification 1. BRIEFLY summarize the main points that Darwin made in The Origin of Species. AP Biology Chapter Packet 7- Evolution Name Chapter 22: Descent with Modification 1. BRIEFLY summarize the main points that Darwin made in The Origin of Species. 2. Define the following terms: a. Natural

More information

Bioinformatics tools for phylogeny and visualization. Yanbin Yin

Bioinformatics tools for phylogeny and visualization. Yanbin Yin Bioinformatics tools for phylogeny and visualization Yanbin Yin 1 Homework assignment 5 1. Take the MAFFT alignment http://cys.bios.niu.edu/yyin/teach/pbb/purdue.cellwall.list.lignin.f a.aln as input and

More information

Dr. Amira A. AL-Hosary

Dr. Amira A. AL-Hosary Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological

More information

Elements of Bioinformatics 14F01 TP5 -Phylogenetic analysis

Elements of Bioinformatics 14F01 TP5 -Phylogenetic analysis Elements of Bioinformatics 14F01 TP5 -Phylogenetic analysis 10 December 2012 - Corrections - Exercise 1 Non-vertebrate chordates generally possess 2 homologs, vertebrates 3 or more gene copies; a Drosophila

More information

BIOLOGY 432 Midterm I - 30 April PART I. Multiple choice questions (3 points each, 42 points total). Single best answer.

BIOLOGY 432 Midterm I - 30 April PART I. Multiple choice questions (3 points each, 42 points total). Single best answer. BIOLOGY 432 Midterm I - 30 April 2012 Name PART I. Multiple choice questions (3 points each, 42 points total). Single best answer. 1. Over time even the most highly conserved gene sequence will fix mutations.

More information

Homework Assignment, Evolutionary Systems Biology, Spring Homework Part I: Phylogenetics:

Homework Assignment, Evolutionary Systems Biology, Spring Homework Part I: Phylogenetics: Homework Assignment, Evolutionary Systems Biology, Spring 2009. Homework Part I: Phylogenetics: Introduction. The objective of this assignment is to understand the basics of phylogenetic relationships

More information

C3020 Molecular Evolution. Exercises #3: Phylogenetics

C3020 Molecular Evolution. Exercises #3: Phylogenetics C3020 Molecular Evolution Exercises #3: Phylogenetics Consider the following sequences for five taxa 1-5 and the known outgroup O, which has the ancestral states (note that sequence 3 has changed from

More information

Phylogenetics. Applications of phylogenetics. Unrooted networks vs. rooted trees. Outline

Phylogenetics. Applications of phylogenetics. Unrooted networks vs. rooted trees. Outline Phylogenetics Todd Vision iology 522 March 26, 2007 pplications of phylogenetics Studying organismal or biogeographic history Systematics ating events in the fossil record onservation biology Studying

More information

Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction. Lesser Tenrec (Echinops telfairi)

Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction. Lesser Tenrec (Echinops telfairi) Phylogenetics - Orthology, phylogenetic experimental design and phylogeny reconstruction Lesser Tenrec (Echinops telfairi) Goals: 1. Use phylogenetic experimental design theory to select optimal taxa to

More information

Homology. and. Information Gathering and Domain Annotation for Proteins

Homology. and. Information Gathering and Domain Annotation for Proteins Homology and Information Gathering and Domain Annotation for Proteins Outline WHAT IS HOMOLOGY? HOW TO GATHER KNOWN PROTEIN INFORMATION? HOW TO ANNOTATE PROTEIN DOMAINS? EXAMPLES AND EXERCISES Homology

More information

Animal Diversity. Features shared by all animals. Animals are multicellular, heterotrophic eukaryotes with tissues that develop from embryonic layers

Animal Diversity. Features shared by all animals. Animals are multicellular, heterotrophic eukaryotes with tissues that develop from embryonic layers Animal Diversity Animals are multicellular, heterotrophic eukaryotes with tissues that develop from embryonic layers Nutritional mode Ingest food and use enzymes in the body to digest Cell structure and

More information

Accepted Manuscript. Deep metazoan phylogeny: When different genes tell different stories

Accepted Manuscript. Deep metazoan phylogeny: When different genes tell different stories Accepted Manuscript Deep metazoan phylogeny: When different genes tell different stories Tetyana Nosenko, Fabian Schreiber, Maja Adamska, Marcin Adamski, Michael Eitel, Jörg Hammel, Manuel Maldonado, Werner

More information

Ctenophores peeking into the group of unidentified species

Ctenophores peeking into the group of unidentified species Ctenophores peeking into the group of unidentified species Morphological and molecular evidence reveal underestimated ctenophore species richness Majaneva Sanna, Hosia A, Halsband C, Lehtiniemi M, Majaneva

More information

1. General Features of Animals

1. General Features of Animals Chapter 32: An Overview of Animal Diversity 1. General Features of Animals 2. The History of Animals 1. General Features of Animals General Characteristics of Animals animals are multicellular eukaryotic

More information

Microbial Taxonomy and the Evolution of Diversity

Microbial Taxonomy and the Evolution of Diversity 19 Microbial Taxonomy and the Evolution of Diversity Copyright McGraw-Hill Global Education Holdings, LLC. Permission required for reproduction or display. 1 Taxonomy Introduction to Microbial Taxonomy

More information

Using phylogenetics to estimate species divergence times... Basics and basic issues for Bayesian inference of divergence times (plus some digression)

Using phylogenetics to estimate species divergence times... Basics and basic issues for Bayesian inference of divergence times (plus some digression) Using phylogenetics to estimate species divergence times... More accurately... Basics and basic issues for Bayesian inference of divergence times (plus some digression) "A comparison of the structures

More information

Report. Ghost Loci Imply Hox and ParaHox Existence in the Last Common Ancestor of Animals

Report. Ghost Loci Imply Hox and ParaHox Existence in the Last Common Ancestor of Animals Current Biology 22, 1951 1956, October 23, 2012 ª2012 Elsevier Ltd All rights reserved http://dx.doi.org/10.1016/j.cub.2012.08.023 Ghost Loci Imply Hox and ParaHox Existence in the Last Common Ancestor

More information

Major questions of evolutionary genetics. Experimental tools of evolutionary genetics. Theoretical population genetics.

Major questions of evolutionary genetics. Experimental tools of evolutionary genetics. Theoretical population genetics. Evolutionary Genetics (for Encyclopedia of Biodiversity) Sergey Gavrilets Departments of Ecology and Evolutionary Biology and Mathematics, University of Tennessee, Knoxville, TN 37996-6 USA Evolutionary

More information

1 ATGGGTCTC 2 ATGAGTCTC

1 ATGGGTCTC 2 ATGAGTCTC We need an optimality criterion to choose a best estimate (tree) Other optimality criteria used to choose a best estimate (tree) Parsimony: begins with the assumption that the simplest hypothesis that

More information

Big Idea #1: The process of evolution drives the diversity and unity of life

Big Idea #1: The process of evolution drives the diversity and unity of life BIG IDEA! Big Idea #1: The process of evolution drives the diversity and unity of life Key Terms for this section: emigration phenotype adaptation evolution phylogenetic tree adaptive radiation fertility

More information

How should we organize the diversity of animal life?

How should we organize the diversity of animal life? How should we organize the diversity of animal life? The difference between Taxonomy Linneaus, and Cladistics Darwin What are phylogenies? How do we read them? How do we estimate them? Classification (Taxonomy)

More information

UoN, CAS, DBSC BIOL102 lecture notes by: Dr. Mustafa A. Mansi. The Phylogenetic Systematics (Phylogeny and Systematics)

UoN, CAS, DBSC BIOL102 lecture notes by: Dr. Mustafa A. Mansi. The Phylogenetic Systematics (Phylogeny and Systematics) - Phylogeny? - Systematics? The Phylogenetic Systematics (Phylogeny and Systematics) - Phylogenetic systematics? Connection between phylogeny and classification. - Phylogenetic systematics informs the

More information

Chapter 5 Evolution of Biodiversity. Sunday, October 1, 17

Chapter 5 Evolution of Biodiversity. Sunday, October 1, 17 Chapter 5 Evolution of Biodiversity CHAPTER INTRO: The Dung of the Devil Read and Answer Questions Provided Module 14 The Biodiversity of Earth After reading this module you should be able to understand

More information

Orthologs Detection and Applications

Orthologs Detection and Applications Orthologs Detection and Applications Marcus Lechner Bioinformatics Leipzig 2009-10-23 Marcus Lechner (Bioinformatics Leipzig) Orthologs Detection and Applications 2009-10-23 1 / 25 Table of contents 1

More information

An Introduction to Animal Diversity

An Introduction to Animal Diversity Chapter 32 An Introduction to Animal Diversity PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Overview: Welcome to Your Kingdom The animal kingdom

More information

Phylogenetic relationship among S. castellii, S. cerevisiae and C. glabrata.

Phylogenetic relationship among S. castellii, S. cerevisiae and C. glabrata. Supplementary Note S2 Phylogenetic relationship among S. castellii, S. cerevisiae and C. glabrata. Phylogenetic trees reconstructed by a variety of methods from either single-copy orthologous loci (Class

More information

Origin and Evolution of Life

Origin and Evolution of Life Origin and Evolution of Life OCN 201 Science of the Sea Biology Lecture 2 The Handfish -BBC Blue Planet!1!1 Evolution Nothing in biology makes sense except in the light of evolution I am a creationist

More information

Outline. v Definition and major characteristics of animals v Dividing animals into groups based on: v Animal Phylogeny

Outline. v Definition and major characteristics of animals v Dividing animals into groups based on: v Animal Phylogeny BIOSC 041 Overview of Animal Diversity: Animal Body Plans Reference: Chapter 32 Outline v Definition and major characteristics of animals v Dividing animals into groups based on: Body symmetry Tissues

More information

An Introduction to Animal Diversity

An Introduction to Animal Diversity Chapter 32 An Introduction to Animal Diversity PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

Phylogenies & Classifying species (AKA Cladistics & Taxonomy) What are phylogenies & cladograms? How do we read them? How do we estimate them?

Phylogenies & Classifying species (AKA Cladistics & Taxonomy) What are phylogenies & cladograms? How do we read them? How do we estimate them? Phylogenies & Classifying species (AKA Cladistics & Taxonomy) What are phylogenies & cladograms? How do we read them? How do we estimate them? Carolus Linneaus:Systema Naturae (1735) Swedish botanist &

More information

10 Biodiversity Support. AQA Biology. Biodiversity. Specification reference. Learning objectives. Introduction. Background

10 Biodiversity Support. AQA Biology. Biodiversity. Specification reference. Learning objectives. Introduction. Background Biodiversity Specification reference 3.4.5 3.4.6 3.4.7 Learning objectives After completing this worksheet you should be able to: recall the definition of a species and know how the binomial system is

More information

A reconstruction of sexual modes throughout animal evolution

A reconstruction of sexual modes throughout animal evolution Sasson and Ryan BMC Evolutionary Biology (2017) 17:242 DOI 10.1186/s12862-017-1071-3 RESEARCH ARTICLE A reconstruction of sexual modes throughout animal evolution Daniel A. Sasson 1,2 and Joseph F. Ryan

More information

Climate, niche evolution, and diversification of the bird cage evening primroses (Oenothera, sections Anogra and Kleinia)

Climate, niche evolution, and diversification of the bird cage evening primroses (Oenothera, sections Anogra and Kleinia) Climate, niche evolution, and diversification of the bird cage evening primroses (Oenothera, sections Anogra and Kleinia) Margaret Evans, Post-doc; YIBS, EEB, Yale University Stephen Smith, PhD student;

More information

METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.

METHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern

More information

v Scientists have identified 1.3 million living species of animals v The definition of an animal

v Scientists have identified 1.3 million living species of animals v The definition of an animal Biosc 41 9/10 Announcements BIOSC 041 v Genetics review: group problem sets Groups of 3-4 Correct answer presented to class = 2 pts extra credit Incorrect attempt = 1 pt extra credit v Lecture: Animal

More information

Censusing the Sea in the 21 st Century

Censusing the Sea in the 21 st Century Censusing the Sea in the 21 st Century Nancy Knowlton & Matthieu Leray Photo: Ove Hoegh-Guldberg Smithsonian s National Museum of Natural History Estimates of Marine/Reef Species Numbers (Millions) Marine

More information

A. Incorrect! Form is a characteristic used in the morphological species concept.

A. Incorrect! Form is a characteristic used in the morphological species concept. CLEP Biology - Problem Drill 23: Evolutionary Processes No. 1 of 10 The biological-species concept is based on. (A) Form. (B) Similar size. (C) Similar appearance to all other individuals in the population.

More information

Biosc 41 9/10 Announcements

Biosc 41 9/10 Announcements Biosc 41 9/10 Announcements v Genetics review: group problem sets Groups of 3-4 Correct answer presented to class = 2 pts extra credit Incorrect attempt = 1 pt extra credit v Lecture: Animal Body Plans

More information

Instructor Information!

Instructor Information! Instructor Information Dr. Anne Boettger Office: 610-430-4601 email: aboettger@wcupa.edu Schmucker North 475 Office hours: Monday 1-2 pm Tuesday/Thursday 9-11am otherwise by appointment All pertinent information

More information

"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky

Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally

More information

Macroevolution Part I: Phylogenies

Macroevolution Part I: Phylogenies Macroevolution Part I: Phylogenies Taxonomy Classification originated with Carolus Linnaeus in the 18 th century. Based on structural (outward and inward) similarities Hierarchal scheme, the largest most

More information

Tree of Life iological Sequence nalysis Chapter http://tolweb.org/tree/ Phylogenetic Prediction ll organisms on Earth have a common ancestor. ll species are related. The relationship is called a phylogeny

More information

Evolution Problem Drill 09: The Tree of Life

Evolution Problem Drill 09: The Tree of Life Evolution Problem Drill 09: The Tree of Life Question No. 1 of 10 Question 1. The age of the Earth is estimated to be about 4.0 to 4.5 billion years old. All of the following methods may be used to estimate

More information

Chapter 32 Introduction to Animal Diversity. Copyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings

Chapter 32 Introduction to Animal Diversity. Copyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings Chapter 32 Introduction to Animal Diversity Welcome to Your Kingdom The animal kingdom extends far beyond humans and other animals we may encounter 1.3 million living species of animals have been identified

More information

SPECIATION. SPECIATION The process by which once species splits into two or more species

SPECIATION. SPECIATION The process by which once species splits into two or more species SPECIATION SPECIATION The process by which once species splits into two or more species Accounts for the diversity of life on earth If no speciation, there would only be species that was continuously evolving

More information

Unit 9: Evolution Guided Reading Questions (80 pts total)

Unit 9: Evolution Guided Reading Questions (80 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Unit 9: Evolution Guided Reading Questions (80 pts total) Chapter 22 Descent

More information

Open projects for BSc & MSc

Open projects for BSc & MSc Next Generation Sequencing New sequencing technologies enable biologists to obtain complete genome and New sequencing technologies enable biologists to obtain complete transcriptome data of non-model organisms.

More information

Molecular Phylogenetics (part 1 of 2) Computational Biology Course João André Carriço

Molecular Phylogenetics (part 1 of 2) Computational Biology Course João André Carriço Molecular Phylogenetics (part 1 of 2) Computational Biology Course João André Carriço jcarrico@fm.ul.pt Charles Darwin (1809-1882) Charles Darwin s tree of life in Notebook B, 1837-1838 Ernst Haeckel (1934-1919)

More information

EVOLUTION change in populations over time

EVOLUTION change in populations over time EVOLUTION change in populations over time HISTORY ideas that shaped the current theory James Hutton (1785) proposes that Earth is shaped by geological forces that took place over extremely long periods

More information

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome

The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG

More information

Anatomy of a species tree

Anatomy of a species tree Anatomy of a species tree T 1 Size of current and ancestral Populations (N) N Confidence in branches of species tree t/2n = 1 coalescent unit T 2 Branch lengths and divergence times of species & populations

More information

Chapters 25 and 26. Searching for Homology. Phylogeny

Chapters 25 and 26. Searching for Homology. Phylogeny Chapters 25 and 26 The Origin of Life as we know it. Phylogeny traces evolutionary history of taxa Systematics- analyzes relationships (modern and past) of organisms Figure 25.1 A gallery of fossils The

More information

Molecular phylogeny - Using molecular sequences to infer evolutionary relationships. Tore Samuelsson Feb 2016

Molecular phylogeny - Using molecular sequences to infer evolutionary relationships. Tore Samuelsson Feb 2016 Molecular phylogeny - Using molecular sequences to infer evolutionary relationships Tore Samuelsson Feb 2016 Molecular phylogeny is being used in the identification and characterization of new pathogens,

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological

More information

AP Biology Essential Knowledge Cards BIG IDEA 1

AP Biology Essential Knowledge Cards BIG IDEA 1 AP Biology Essential Knowledge Cards BIG IDEA 1 Essential knowledge 1.A.1: Natural selection is a major mechanism of evolution. Essential knowledge 1.A.4: Biological evolution is supported by scientific

More information

Comparative Bioinformatics Midterm II Fall 2004

Comparative Bioinformatics Midterm II Fall 2004 Comparative Bioinformatics Midterm II Fall 2004 Objective Answer, part I: For each of the following, select the single best answer or completion of the phrase. (3 points each) 1. Deinococcus radiodurans

More information

Theory a well supported testable explanation of phenomenon occurring in the natural world.

Theory a well supported testable explanation of phenomenon occurring in the natural world. Evolution Theory of Evolution Theory a well supported testable explanation of phenomenon occurring in the natural world. Evolution the process by which modern organisms changed over time from ancient common

More information

Anatomy of a tree. clade is group of organisms with a shared ancestor. a monophyletic group shares a single common ancestor = tapirs-rhinos-horses

Anatomy of a tree. clade is group of organisms with a shared ancestor. a monophyletic group shares a single common ancestor = tapirs-rhinos-horses Anatomy of a tree outgroup: an early branching relative of the interest groups sister taxa: taxa derived from the same recent ancestor polytomy: >2 taxa emerge from a node Anatomy of a tree clade is group

More information

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics

POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics - in deriving a phylogeny our goal is simply to reconstruct the historical relationships between a group of taxa. - before we review the

More information

Bio 1B Lecture Outline (please print and bring along) Fall, 2007

Bio 1B Lecture Outline (please print and bring along) Fall, 2007 Bio 1B Lecture Outline (please print and bring along) Fall, 2007 B.D. Mishler, Dept. of Integrative Biology 2-6810, bmishler@berkeley.edu Evolution lecture #5 -- Molecular genetics and molecular evolution

More information

C.DARWIN ( )

C.DARWIN ( ) C.DARWIN (1809-1882) LAMARCK Each evolutionary lineage has evolved, transforming itself, from a ancestor appeared by spontaneous generation DARWIN All organisms are historically interconnected. Their relationships

More information

GENETICS - CLUTCH CH.22 EVOLUTIONARY GENETICS.

GENETICS - CLUTCH CH.22 EVOLUTIONARY GENETICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF EVOLUTION Evolution is a process through which variation in individuals makes it more likely for them to survive and reproduce There are principles to the theory

More information

A mind is a fire to be kindled, not a vessel to be filled.

A mind is a fire to be kindled, not a vessel to be filled. A mind is a fire to be kindled, not a vessel to be filled. - Mestrius Plutarchus, or Plutarch, a leading thinker in the Golden Age of the Roman Empire (lived ~45 125 A.D.) Lecture 2 Distinction between

More information

Computational methods for predicting protein-protein interactions

Computational methods for predicting protein-protein interactions Computational methods for predicting protein-protein interactions Tomi Peltola T-61.6070 Special course in bioinformatics I 3.4.2008 Outline Biological background Protein-protein interactions Computational

More information

Goal 1: Develop knowledge and understanding of core content in biology

Goal 1: Develop knowledge and understanding of core content in biology Indiana State University» College of Arts & Sciences» Biology BA/BS in Biology Standing Requirements s Library Goal 1: Develop knowledge and understanding of core content in biology 1: Illustrate and examine

More information

Research Proposal. Title: Multiple Sequence Alignment used to investigate the co-evolving positions in OxyR Protein family.

Research Proposal. Title: Multiple Sequence Alignment used to investigate the co-evolving positions in OxyR Protein family. Research Proposal Title: Multiple Sequence Alignment used to investigate the co-evolving positions in OxyR Protein family. Name: Minjal Pancholi Howard University Washington, DC. June 19, 2009 Research

More information

8/23/2014. Introduction to Animal Diversity

8/23/2014. Introduction to Animal Diversity Introduction to Animal Diversity Chapter 32 Objectives List the characteristics that combine to define animals Summarize key events of the Paleozoic, Mesozoic, and Cenozoic eras Distinguish between the

More information

EVOLUTION. HISTORY: Ideas that shaped the current evolutionary theory. Evolution change in populations over time.

EVOLUTION. HISTORY: Ideas that shaped the current evolutionary theory. Evolution change in populations over time. EVOLUTION HISTORY: Ideas that shaped the current evolutionary theory. Evolution change in populations over time. James Hutton & Charles Lyell proposes that Earth is shaped by geological forces that took

More information

Evolution of Populations. Chapter 17

Evolution of Populations. Chapter 17 Evolution of Populations Chapter 17 17.1 Genes and Variation i. Introduction: Remember from previous units. Genes- Units of Heredity Variation- Genetic differences among individuals in a population. New

More information

CH 16: Evolution of Population

CH 16: Evolution of Population CH 16: Evolution of Population 16.1 Genes and Variation A. Introduction 1. Darwin s theory of evolution by natural selection explained how 2. What Darwin did not know was how were passed down through each

More information

Non-independence in Statistical Tests for Discrete Cross-species Data

Non-independence in Statistical Tests for Discrete Cross-species Data J. theor. Biol. (1997) 188, 507514 Non-independence in Statistical Tests for Discrete Cross-species Data ALAN GRAFEN* AND MARK RIDLEY * St. John s College, Oxford OX1 3JP, and the Department of Zoology,

More information

Overview of IslandPick pipeline and the generation of GI datasets

Overview of IslandPick pipeline and the generation of GI datasets Overview of IslandPick pipeline and the generation of GI datasets Predicting GIs using comparative genomics By using whole genome alignments we can identify regions that are present in one genome but not

More information

Phylogenetic Tree Reconstruction

Phylogenetic Tree Reconstruction I519 Introduction to Bioinformatics, 2011 Phylogenetic Tree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Evolution theory Speciation Evolution of new organisms is driven

More information