Nature Methods: doi: /nmeth Supplementary Figure 1

Transcription

1 Supplementary Figure 1 Two strategies for application of LOVTRAP. The LOV domain is never entirely open or closed, but rather is in equilibria that favor the open or closed forms in the light and dark, respectively. As shown by Yao et al. 1, 1.6% of LOV2 molecules are in the open conformation in the dark and about 9% are in the closed conformation in the light. Based on this, the configuration with LOV2 on mitochondria (Strategy I) produces essentially no free protein in the dark, because LOV can be kept in excess over Zdk-POI. This offers an advantage for proteins that need to be tightly controlled, such as lethal proteins or proteins where a small amount of free material in the dark produces undesired biological effects. In Strategy I, the amount of protein released upon irradiation will be highly dependent on the ratio of LOV2:Zdk. With a ratio of [LOV2]/[Zdk1]=10:1, about 20% of the POI can be released with light. For Strategy II, about 90% of the protein will be released by light, regardless of the ratio Zdk:LOV2. However, even in the dark there will be a small amount of unbound LOV-POI in the cytosol. When this strategy is used with Zdk1, LOV2 can only be fused to the C-terminus of the POI, because the C-terminus of LOV2 needs to be kept free for Zdk1 binding.

2 Supplementary Figure 2 Crystal structures of LOV2:Zdk complexes. Overall structures and close-up views of interactions between the C-terminal part of the Jα helix (in purple) and Zdk proteins. The residues involved in contacts are shown in ball-and-stick representation and labelled. Dashed black lines represent hydrogen bonds. Zdk1 binds to residues of the LOV globular domain and also requires an interaction with the C-terminus of the LOV2 Jα helix for tight binding. Zdk2 and Zdk3 bind similarly and have similar sequences in the variable region, but they do not require interaction with the LOV2 C-terminus. They bind at a site near that of Zdk1, but with a different orientation.

3 Supplementary Figure 3 Effects of C-terminal Jα modification on LOV2-Zdk1 binding. Effects of LOV2 Jα helix mutations on binding. 1 = Binding tested by radiometric binding assay; 2 = Binding tested using LOVTRAP mitochondrial localization in living cells; 3 = Binding tested using Bio-Layer Interferometry assay. Modifications on the end of the Jα helix abolished the binding. Green: LOV2 core domain; Blue: Jα helix; Gray: Zdk1.

4 Supplementary Figure 4 Activation kinetics of LOVTRAP with different Zdk variants. Zdk1, 2 or 3 was attached to the outer membrane of mitochondria via a TOM20 fragment, and mcherry was attached to LOV2 (for Zdk1, mcherry was attached to N-terminus of LOV2, while for Zdk2 and 3, mcherry was attached to both the N- and C- termini). When Zdk1 was used, substantial fluorescent protein was released after 100 ms of blue light irradiation, and equilibrium was reached within 500 ms irradiation. However, for the systems using Zdk2 or 3, release was slower and only partial release was achieved (b), likely due to the non-negligible affinity of these Zdk variants for the lit-state of LOV2. When using Zdk1, proteins need to be attached to N- terminus of LOV2, but for Zdk2 or 3, either terminus of LOV2 can be used. Scale bar: 10µm.

5 Supplementary Figure 5 Effectiveness of mutations that mimic the dark-state of LOV2. Lov2 was labeled with mcherry fluorescent protein and Zdk1 was anchored at mitochondria. Fluorescence was monitored at a region of the cytosol away from mitochondria. Black: wild-type LOV2, from Figure 1; Red: LOV2 dark state mutant C450A; Blue: Because the widely used C450A dark state mutant shows some response to light, we combined the C450A mutation with other mutations that stabilize the closed form of LOV2 (C450A, L514K, G528A, L531E, andn538e). When this superdark mutant was used in the mcherry- LOV2 construct, light no longer had an effect.

6 Supplementary Figure 6 Protein control by LOVTRAP. (a) HEK293 cells with LOV2 attached to the plasma membrane and Zdk attached to mcherry (left). Fluorescence in a region in cytosol (circle) monitored before, during and after blue light irradiation (right). (b) Reversible cell protrusion produced by light-induced release of constitutively active Zdk-Vav2. (c) Cell area before, during and after light-induced release of constitutively active Vav2 (7 cells), Rac1 (7 cells), RhoA (4 cells) and Control (5 cells). Wilcoxon rank test and permutation test were performed to the medians before and during irradiation. For both tests: p < 1e-6 (Vav2, Rac1, RhoA) and p= (Control). (d) Edge velocity (calculated from 2,017 edge locations sampled in 7 cells) during light-induced release of constitutively active Rac1. Dark blue line indicates median, band indicates 95% confidence interval. (e) Release of constitutively active RhoA led to irreversible contraction and reversible decrease in ruffling. (f) Quantitation of Vav2 effects on ruffling. White = percent cells in which ruffling was induced, blue = percent cells with no obvious effect on ruffling. Cells were transfected either with LOVTRAP (Vav2, n=14) or with LOV and Zdk1 only (Control, n=18). (g) Inhibition of ruffling by RhoA(Q63L), graphed as in (f). Control = expression of LOV2 and Zdk1 only (n= 9), RhoA = LOVTRAP (n= 18). All scale bars 10µm.

7 Supplementary Figure 7 Cell edge morphodynamic changes upon construct activation. Normalized velocities over time (for all three states). Each velocity profile was normalized by its respective median value for the dark state. Center dark colored line indicates median, band indicates 95% confidence interval about median, calculated from n edge locations sampled in m cells. Vav2 n=2,606, m=7 ; Rac1 n = 2,017, m=7; RhoA n=1,637, m=4; Control n=989, m=5.

8 Supplementary Figure 8 The effect of LOVTRAP on cell edge velocity. The effects of Rac1 LOVTRAP (a) and Vav2 LOVTRAP (b) on cell edge velocity (normalized using the basal level before photoactivation). No dependence was observed between cell edge velocity and the expression level of the proteins.

9 Supplementary Figure 9 Effects of LOVTRAP on expression of endogenous Rac1. Endogenous Rac1 expression is shown in the presense of LOVTRAP Vav2, RhoA, and Rac1. Control cells were transfected with LOV2 and Zdk1 only and non-transfected cells were not transfected with any DNA.

10 Supplementary Figure 10 Effect of LOVTRAP on protrusion speeds; Basal line analysis for LOVTRAP Vav2, Rac1 and RhoA. Median cell edge velocity distributions for cells expressing LOVTRAP Vav2, Rac1, RhoA or Control (Zdk1/LOV2 only) calculated from n edge locations sampled in m cells. The blue box represents the 25th to 75th percentile and the center red line represents the median. The whiskers cover 99.3 of the data range and the red points represent outliers. Vav2 n=38,133, m=7; Rac1 n=21,157, m=4; RhoA n=27,213, m=7; Control n=29,148 m=7. We performed the Kruskal-Wallis test to exam the null hypothesis that the all points come from the same distribution. With a p-value of , the test was unable to reject the null hypothesis at a significant level of 29.61%, showing that the cells were indistinguishable from control cells.

11 Supplementary Figure 11 Effects of LOVTRAP on mitochondrial superoxide generation. Mitochondrial superoxide generation is shown in the presense of LOVTRAP Vav2, LOVTRAP RhoA, and LOVTRAP Rac1 in the dark. Control cells were transfected with LOV2 and Zdk1 only and non-transfected cells were not transfected with any DNA. Mitochondrial superoxide generation was measured using MitoSOX Red in flow cytometry 2. In the dark, expression of LOVTRAP Vav2, Rac1 or RhoA had little effect on mitochondrial superoxide generation.

12 Supplementary Figure 12 Effects of LOVTRAP on mitochondrial membrane potential. Mitochondrial membrane potential is shown in the presence of LOVTRAP Vav2, LOVTRAP RhoA, and LOVTRAP Rac1 in the dark. Control cells were transfected with LOV2 and Zdk1 only and non-transfected cells were not transfected with any DNA. Expression of LOVTRAP Vav2, Rac1 or RhoA had little effect on mitochondrial membrane potential. Membrane potential was measured using DilC1(5) Red using flow cytometry. 3

13 Supplementary Figure 13 Time-frequency analysis with Hilbert-Huang decomposition algorithm. Upper box: Hilbert-Huang Transform (HHT) algorithm. Left panel: Synthetic test signal generated as a mixture of noise and several sinusoidal waves with distinct frequencies at different times [1Hz for all times, 3Hz from 0-6 sec and sec, 5Hz and 10Hz from 6-12 sec]. The 1Hz and 10Hz waves have twice the amplitude of the remaining ones. Middle panel: Decomposition of the test signal by the EMD algorithm into 8 intrinsic modes. Right panel: Spectrogram of the test signal after the numerical computation of the Hilbert transform of each mode and its respective analytical signal. Workflow for the time-frequency analysis of the cell edge motion. Cell edge is divided into windows, each tracked over time and velocities calculated. The HHT algorithm is then applied to the velocity profiles, each generating a spectrogram. An average spectrogram representative of the whole cell is calculated by bootstrapping the mean amplitude for each time-frequency pair from all individual spectrograms.

14 Supplementary Figure 14 Time-Frequency analysis of cell edge motion. (a) Left, representative kymograph of cell edge velocity during an experiment with release of Vav2 between 1800 s and 3600 s in pulses of 50 s blue light alternating with 250 s of dark (equals 3.3 mhz blue light pulses). Above kymograph, distribution of edge velocity along cell periphery for each time point (blue line, median velocity; red band, 95% confidence about median). Right, spectrogram derived from velocities in left panel. Right, power density as a function of temporal frequency, collected during pulsatile release of Vav2. Center line indicates median density, band indicates 95% confidence interval about median, calculated from n = 1686 edge locations sampled in m = 5 cells. (b) Representative spectrogram of cells stimulated with 3.3mHz, 4mHz, 6.7mHz and 10mHz blue light pulses. Each panel contains spectral data from n = 2044 edge locations. (c) Representative spectrogram of cells with acutely stimulated activation of constitutively active Rac1Q61L (data from n = 357 edge locations); endogenous Rac1 via release of TIAM-1 DH/PH domain (data from n = 1546 edge locations); of constitutively active VAV2 in the presence of the PI3K inhibitor LY (data from n = 2350 edge locations); and of VAV2 K401A mutant with impaired binding to PI3K-generated phospholipid products (data from n = 1439 edge locations).

15 Supplementary Figure 15 Hypothesis re mechano-chemical signaling pathways driving cell edge oscillations. Vav2 is upstream of proteins controlling assembly and contraction that drive cell protrusion and retraction, and downstream of a mechanochemical feedback response modulating the local concentration of Vav2 signals at the cell edge.

16 Supplementary table 1: List of atom-atom interactions between the residues of the LOV2 domain J helix and the Zdk reagents as calculated by PDBsum. 4 Chain Residue Atom Chain Residue Atom Distance (Å) LOV2-Zdk1 complex (PDB ID: 5EFW) Hydrogen bonds A Glu545 O C Ala12 N 3.34 A Leu546 O' C Gly13 N 2.85 A Leu546 O'' C Arg11 N Non-bonded contacts A Lys544 C C Arg11 N A Lys544 O C Arg11 C 3.66 A Lys544 O C Arg11 N 3.39 A Lys544 O C Arg11 C 3.27 A Lys544 O C Arg11 N A Lys544 O C Arg11 N A Glu545 O C Arg11 C 3.63 A Glu545 O C Arg11 C 3.72 A Glu545 O C Ala12 N 3.34 A Leu546 C C Arg11 C 3.77 A Leu546 C C Ala12 N 3.86 A Leu546 C C Gly13 N 3.78 A Leu546 O' C Ala12 N 3.80 A Leu546 O' C Gly13 N 2.85 A Leu546 O' C Gly13 C 3.44 A Leu546 C C Phe35 C A Leu546 C 1 C Phe35 C A Leu546 C 1 C Phe35 C A Leu546 O'' C Arg11 C 3.16 A Leu546 O'' C Arg11 C 3.59 A Leu546 O'' C Arg11 C 3.80 A Leu546 O'' C Arg11 N LOV2-Zdk2 complex (PDB ID: 5DJT) Non-bonded contacts A Ala543 C B Tyr17 O 3.85 A Ala543 O B Trp24 C 3.20 A Ala543 C B Phe28 C 3.77 A Lys544 C B Trp24 C A Lys544 C B Trp24 N A Lys544 C B Trp24 C LOV2-Zdk3 complex (PDB ID: 5DJU) Hydrogen bonds A Leu546 O'' B Lys27 N 2.53 Non-bonded contacts A Ala543 C B Phe28 C 3.90 A Ala543 O B Trp24 C 3.52 A Lys544 C B Trp24 C 3.71 A Lys544 C B Trp24 C 3.75 A Lys544 C B Trp24 C A Lys544 C B Trp24 C A Lys544 C B Trp24 C A Lys544 C B Trp24 N A Lys544 C B Trp24 C A Leu546 C B Lys27 N 3.59 A Leu546 O' B Lys27 N 3.86 A Leu546 C B Tyr17 C A Leu546 C B Tyr17 O 3.19 A Leu546 O'' B Tyr17 C A Leu546 O'' B Lys27 N 2.53 A Leu546 O'' B Lys27 C 3.66 A Leu546 O'' B Lys27 C 3.52

17 Supplementary Table 2: Comparing the half-life of LOVTRAP with time constants reported in literature LOV2 variants Half-life measured in LOVTRAP (t 1/2 ) Time constant reported in literature (τ) I427T 1.7±0.6 NA V416T 5.0± I427V 5.5± WT 18.5± , 81 7 V416I 239± V416L 496± Note: 1. t 1/2 = τ ln2=0.69 τ 2. Half-life measurements in this study were conducted in living HeLa cells at 37 o C, producing shorter values than those measured with purified proteins at room temperature in other studies. 2,4 3. Protein diffusion rate, which played a role in our assays within cells, had a larger effect on shorter half lives.

18 Supplementary Table 3: DNA fragments used to construct the plasmids in Supplementary Table 1 Fragment used Protein Species Residues Accession Number LOV2 NPH1-1 Avena sativa AAC VAV2 DH/PH/C1 VAV2 Mus musculus NP_ Rac1 Rac1 Homo sapiens NP_ RhoA RhoA Homo sapiens NP_ TIAM1 DH/PH TIAM1 Homo sapiens NP_ NTOM TOM20 Homo sapiens 1-35 NP_ NLyn Lyn Mus musculus 1-16 NP_034877

19 Supplementary Table 4: Primers used to construct Z-library Primer ZL-U141 ZL-B143 ZL-5-66 ZL-3-57 sequence ATG GTG GAT AAC AAA TTC AAT AAA GAA NNK NNK NNK GCC NNK NNK GAA ATC NNK NNK CTG CCA AAC CTG AAT NNK NNK CAG NNK NNK GCC TTC ATC NNK AGC CTG NNK GAT GAT CCA TCT CAG AGC GCC AAT CTG CTG GCC GTC GTC GTC GTC CTT GTA GTC GCT GCC GCC CTG GAA ATA CAG ATT TTC ACC GCC ATG ATG ATG ATG ATG ATG GCT ACC ACC AGA ACC ACC TTT TGG GGC CTG GGC ATC GTT CAG TTT TTT GGC TTC GGC CAG CAG ATT GGC GC TTCTAATACGACTCACTATAGGGACAATTACTATTTACAATTACA ATG GTG GAT AAC AAA TTC AAT AAA GAA TTA ATA GCC GGT GGA CAT TCC CAT ACC TTT GTC GTC GTC GTC CTT GTA GTC GC

20 Supplementary Table 5: X-ray crystallography data collection and refinement statistics LOV2-Zdk1 complex LOV2-Zdk2 complex LOV2-Zdk3 complex Data collection Space group P I4 P Cell dimensions a, b, c (Å) 54,7, 54.7, , 110.1, , 74.5, 81.9 α, β, γ ( ) 90.0, 90.0, , 90.0, , 90.0, 90.0 Resolution (Å) ( )* ( )* ( )* No. unique reflections 17,450 44,465 26,342 R merge (0.528) (0.360) (0.374) I /σi 10.3 (3.3) 15.5 (4.2) 6.7 (2.1) Completeness (%) 99.4 (100.0) 99.6 (99.7) 96.9 (88.3) Redundancy 5.8 (6.3) 5.7 (5.9) 3.0 (2.2) Wilson B (Å 2 ) Refinement Molecules per a.u. 3 (1:2 complex) 2 (1:1 complex) 4 (2 1:1 complex) Resolution (Å) No. unique reflections 17,445 44,463 26,338 R work / R free / / / No. atoms Protein Ligand Water / Ions 94 / / / 5 B-factors Protein Ligand Water + Ions R.m.s. deviations Bond lengths (Å) Bond angles ( ) Ramachandran favored (%) outliers (%) Clashscore * Values in parentheses are for highest-resolution shell.

21 Supplementary Table 6: Plasmids used in this paper ptrap001 ptriex-ntom20-lov2 Fig. 3, Suppl. Fig. 6, Suppl. Fig. 7, Suppl. Fig. 8, Suppl. Fig. 9, Suppl. Fig. 10, Suppl. Fig. 11, Suppl. Fig. 12, Suppl. Fig. 14, Movie 5, Movie 6, Movie 7, Movie 8 ptrap002 ptriex-ntom20-mvenus-zdk1 Fig. 2, Suppl. Fig. 4, Suppl. Fig. 5, Movie 2, Movie 3 ptrap003 ptriex-ntom20-mvenus-zdk2 Supl. Fig. 4 ptrap004 ptriex-ntom20-mvenus-zdk3 Supl. Fig. 4 ptrap005 ptriex-mcherry-lov2 Fig. 2, Suppl. Fig. 4, Suppl. Fig. 5, Suppl. Fig.6, Movie 2, Movie 4 ptrap006 ptriex-mcherry-lov2-mcherry Suppl. Fig. 4 ptrap007 ptriex-mcherry-lov2 C450A Suppl. Fig. 5 ptrap008 ptriex-mcherry-lovsd Suppl. Fig. 5, Movie 3 ptrap009 ptriex-mcherry-lov2 I427V Fig.2 ptrap010 ptriex-mcherry-lov2 V416I Fig.2 ptrap011 ptriex-mcherry-lov2 I427T Fig.2 ptrap012 ptriex-mcherry-lov2 V416T Fig.2 ptrap013 ptriex-mcherry-lov2 V416L Fig.2 ptrap014 PTriEx-NLyn-Venus-Zdk1 Suppl. Fig.6, Movie 4 ptrap015 ptriex-mcherry-zdk1-vav2 DH/PH/C1 Fig. 3, Suppl. Fig. 6, Suppl. Fig. 7, Suppl. Fig. 8,Suppl. Fig. 10, Suppl. Fig. 12, Suppl. Fig. 14, Movie 5, Movie 8 ptrap016 ptriex-mcherry-zdk1-rac1 Q61L Fig. 3, Suppl. Fig. 6, Suppl. Fig. 7, Suppl. Fig. 8,Suppl. Fig. 10, Suppl. Fig. 12, Suppl. Fig. 14, Movie 6 ptrap017 ptriex-mcherry-zdk1-rhoa Q63L Suppl. Fig. 6, Suppl. Fig. 7,Suppl. Fig. 10, Suppl. Fig. 12, Movie 7 ptrap018 ptriex-mcherry-zdk1-vav2 Fig. 3, Suppl. Fig. 14 DH/PH/C1 K401A ptrap019 ptriex-mcherry-zdk1-tiam1 DH/PH Fig. 3, Suppl. Fig. 14 ptrap020 PTriEx-NLyn-Venus Fig.3, Suppl. Fig. 6, Suppl. Fig. 7, Suppl. Fig. 8,Suppl. Fig. 10, Suppl. Fig. 14, Movie 5, Movie 8, ptrap021 ptriex-mcherry-zdk1 Suppl. Fig. 6, Suppl. Fig. 7, Suppl. Fig. 10, Suppl. Fig. 12 ptrap022 ptriex-mvenus-zdk1-vav2 Suppl. Fig. 9, Suppl. Fig. 11 DH/PH/C1 ptrap023 ptriex-mvenus-zdk1-rac1 Q61L Suppl. Fig. 9, Suppl. Fig. 11 ptrap024 ptriex-mvenus-zdk1-rhoa Q63L Suppl. Fig. 9, Suppl. Fig. 11 ptrap025 ptriex-mvenus-zdk1 Suppl. Fig. 9, Suppl. Fig. 11

22 SUPPLEMENTARY NOTE The mitochondrion-anchored molecules should be expressed in excess over the free component, to sequester the POI completely. There can be two configurations for LOVTRAP, as discussed in detail below. Due to a small equilibrium amount of lit-state LOV2 in the dark 1, the ratio between the two components has different effects in each of the two strategies. Here we focus on Zdk1 only. The fraction of LOV2 molecules that are in the closed conformation is given by m = [LOV] close,tot [LOV] tot Where [LOV] tot is the total concentration of the LOV2 domain expressed in the cells, and [LOV] close,tot is the concentration of LOV2 molecules that are in the closed conformation. According to Yao et al. 1, in the dark, 98.4% of LOV2 molecules are in in the closed form and 1.6% are in the open form. Thus m dark =0.984, while in the light, m light =0.09 Strategy I (LOV2 domain is attached to the mitochondria and the POI is fused to Zdk): The ratio between the two components of the system is given by n = [LOV] tot [POI Zdk] tot Where [POI Zdk] tot is the total protein concentrations of Zdk POI fusion protein expressed in the cells. Zdk binds LOV2 molecules in the closed conformation with affinity of 26.2 nm, while it does not bind LOV2 molecules in the open conformation with detectable affinity. The affinity of Zdk molecules and LOV2 molecules in the closed conformation is given by Kd = [POI Zdk] unbound[lov] close,unbound [POI Zdk LOV] Where [POI Zdk] unbound is the concentration of POI Zdk fusion that does not bind to LOV2, [LOV] close,unbound is the concentration of LOV2 that is in the closed conformation but does not bind to Zdk, and [POI Zdk LOV] is the concentration of the POI Zdk~LOV2 complex.

23 Given that [LOV] close,unbound + [POI Zdk LOV] = [LOV] close,tot = m[lov] tot = mn[poi] tot, and [POI] unbound + [POI Zdk LOV] = [POI] tot The concentration of unbound POI can be calculated by [POI] unbound = (mn 1)[POI] tot Kd + {(mn 1)[POI] tot + Kd} 2 + 4Kd[POI] tot 2 Equation 1 Strategy II: (Zdk is attached to the mitochondria and LOV2 is fused to the POI): The ratio between the two components of the system is given by n = [Zdk] tot [LOV POI] tot Similar to the calculation above, [LOV] close,unbound + [Zdk LOV POI] = [LOV] close,tot = m[lov] tot = m[poi] tot [POI] unbound = [POI] tot [Zdk LOV POI] [Zdk] tot = n[lov POI] tot = [Zdk] unbound + [Zdk LOV POI] And Thus Kd = [LOV] close,unboun d[zdk] unbound [Zdk LOV POI] [POI] unbound = (m + n 1)[POI] tot Kd + {(m + n)[poi] tot + Kd} 2 2 4mn[POI] tot 2 Equation 2

24 References 1. Yao, X., Rosen, M.K. and Gardner, K.H. Estimation of the available free energy in a LOV2-J alpha photoswitch. Nat Chem Biol, (8): p Mukhopadhyay, P., et al. Simultaneous detection of apoptosis and mitochondrial superoxide production in live cells by flow cytometry and confocal microscopy. Nat Protoc, (9): p Chen, A.Y. et al. Bocavirus Infection Induces Mitochondrion-Mediated Apoptosis and Cell Cycle Arrest at G2/M Phase. J Virol (11): de Beer T.A.P. et al. PDBsum additions. Nucleic Acids Res., 42, D292- D Kawano, F., Aono, Y., Suzuki, H. and Sato, M. Fluorescence Imaging- Based High-Throughput Screening of Fast- and Slow-Cycling LOV Proteins. PLoS ONE, , e Christie, J. M. et al. Steric interactions stabilize the signaling state of the LOV2 domain of phototropin 1. Biochemistry (Mosc.) , Zoltowski, B. D., Vaccaro, B. & Crane, B. R. Mechanism-based tuning of a LOV domain photoreceptor. Nat. Chem. Biol ,