Practice Problem - Skewness of Bernoulli Random Variable. Lecture 7: Joint Distributions and the Law of Large Numbers. Joint Distributions - Example
|
|
- Ariel Warner
- 5 years ago
- Views:
Transcription
1 A little more E(X Practice Problem - Skewness of Bernoulli Random Variable Lecture 7: and the Law of Large Numbers Sta30/Mth30 Colin Rundel February 7, 014 Let X Bern(p We have shown that E(X = p Var(X = p(1 p Find the Skewness of X where skewness is defined as ( (X E(X 3 E = E ( (X µ 3 SD(X σ 3 Sta30/Mth30 (Colin Rundel Lecture 7 February 7, / - Example Draw two socks at random, without replacement, from a drawer full of twelve colored socks: black, 4 white, purple Let B be the number of Black socks, W the number of White socks drawn, then the distributions of B and W are given by: P(B=k P(W=k 8 Note - B HyperGeo(1,, = = 1 11 = = = 3 ( ( k k = = ( 1 and W HyperGeo(1, 4, = ( ( 4 8 k k ( 1 - Example, cont. Let B be the number of Black socks, W the number of White socks drawn, then the distributions of B and W are given by: 0 1 B 1 1 W P(B = b, W = w = 3 ( ( 4 b w( ( 1 b w Sta30/Mth30 (Colin Rundel Lecture 7 February 7, 014 / Sta30/Mth30 (Colin Rundel Lecture 7 February 7, /
2 Marginal Distribution Conditional Distribution Note that the column and row sums are the distributions of B and W respectively. P(B = b = P(B = b, W = 0 + P(B = b, W = 1 + P(B = b, W = P(W = w = P(B = 0, W = w + P(B = 1, W = w + P(B =, W = w Conditional distributions are defined as we have seen previously with P(X = x Y = y = P(X = x, Y = y P(Y = y = joint marginal Therefore the pmf for white socks given no black socks were drawn is These are the marginal distributions of B and W. In general, P(X = x = P(X = x, Y = y = P(X = x Y = yp(y = y P(W = w B = 0 = P(W = w, B = 0 P(B = 0 = / 1 = 1 / 8 = 8 if W = 0 if W = 1 / = if W = = P(X = x, Y = y dy = P(X = x Y = yp(y = y dy Sta30/Mth30 (Colin Rundel Lecture 7 February 7, / Sta30/Mth30 (Colin Rundel Lecture 7 February 7, / Expectation of Discrete E ( g(x, Y = x g(x, yp(x = x, Y = y For example we can define g(x, y = x y then y E(BW =(0 0 1/ + (0 1 8/ + (0 / + (1 0 1/ + (1 1 4/ + (1 0/ + ( 0 / + ( 1 0/ + (1 0/ =4/ = 4/11 Expectation of Discrete Conditional Distribution Works like any other discrete distribution E(X Y = y = x P(X = x Y = y x Therefore we can calculating things like conditional means and variances, E(W B = 0 = 0 1/ + 1 8/ + / = 0/ = Note that E(BW E(BE(W since E(BE(W = (0 / + 1 3/ + / (0 8/ + 1 3/ + / = / 44/ = /3 This implies that B and W are not independent and Cov(X, Y 0. Sta30/Mth30 (Colin Rundel Lecture 7 February 7, 014 / E(W B = 0 = 0 1/ + 1 8/ + / = 3/ =.1333 Var(W B = 0 = E(W B = 0 E(W B = 0 = 3/ (4/3 = 1/45 = Sta30/Mth30 (Colin Rundel Lecture 7 February 7, /
3 Joint Distribution - Example Joint Distribution - Example Suppose that X and Y have a discrete joint distribution for which the joint pmf is defined as follows: { c x + y for x, y {, 1, 0, 1, } f (x, y = 0 otherwise Suppose that X and Y have a discrete joint distribution for which the joint pmf is defined as follows { 1 f (x, y = 30 (x + y for x = 0, 1, and y = 0, 1,, 3 0 otherwise a What is the value of the constant c b P(X = 0 and Y = c P(X = 1 a Determine the marginal pmf s of X and Y. b Are X and Y independent? d P(X = 1 Y = 0 e P( X Y 1 From De Groot and Schervish (011 From De Groot and Schervish (011 Sta30/Mth30 (Colin Rundel Lecture 7 February 7, / Sta30/Mth30 (Colin Rundel Lecture 7 February 7, / Multinomial Distribution Multinomial Example Let X 1, X,, X k be the k random variables that reflect the number of outcomes belonging to category k in n trials with the probability of success for category k being p k, X 1,, X k Multinom(n, p 1,, p k P(X 1 = x 1,, X k = x k = f (x 1,, x k n, p 1,, p k where n! = x 1! x k! px 1 1 px k k k k x i = n and p i = 1 Some regions of DNA have an elevated amount of GC relative to AT base pairs. If in a normal region of DNA we expect equal amounts of ACGT vs a GC rich region which has twice as much GC as AT. If we observe the following sequence ACTGACTTGGACCCGACGGA what is the probability that it is from a normal region or a GC rich region. E(X i = np i Var(X i = np i (1 p i Cov(X i, X j = np i p j Sta30/Mth30 (Colin Rundel Lecture 7 February 7, / Sta30/Mth30 (Colin Rundel Lecture 7 February 7, /
4 Markov s Inequality For any random variable X 0 and constant a > 0, then Derivation of Markov s Inequality Let X be a random variable such that X 0 then P(X a E(X a Corollary - Chebyshev s Inequality: P( X E(X a Var(X a The inequality says that the probability that X is far away from its mean is bounded by a quantity that increases as Var(X increases. Sta30/Mth30 (Colin Rundel Lecture 7 February 7, / Sta30/Mth30 (Colin Rundel Lecture 7 February 7, / Derivation of Chebyshev s Inequality Proposition - if f (x is a non-decreasing function then ( P(X a = P f (X f (a E( f (X f (a If we define the positive valued random variable to be X E(X and f (x = x then Chebyshev s Inequality - Example Use Chebyshev s inequality to make a statement about the bounds for the probability of being with in 1,, or 3 standard deviations of the mean for all random variables. If we define a = kσ where σ = Var(X then P( X E(X kσ Var(X k σ = 1 k Sta30/Mth30 (Colin Rundel Lecture 7 February 7, / Sta30/Mth30 (Colin Rundel Lecture 7 February 7, 014 /
5 Independent and Identically Distributed (iid A collection of random variables that share the same probability distribution and all are mutually independent. Example If X Binom(n, p then X = n Y i where Y 1,, Y n iid Bern(p Sums of iid Random Variables Let X 1, X,, X n iid D where D is some probability distribution with E(X i = µ and Var(X i = σ. We defined S n = X 1 + X + + X n E(S n = E(X 1 + X + + X n = E(X 1 + E(X + + E(X n = µ + µ + + µ = nµ Var(S n = E[((X 1 + X + + X n (µ + µ + + µ ] = E[((X 1 mu + (X µ + + (X n µ ] n n n = E[(X i µ ] + E[(X i µ(x j µ] j=1 i j n n n = Var(X i + Cov(X i, X j = nσ j=1 i j Sta30/Mth30 (Colin Rundel Lecture 7 February 7, / Sta30/Mth30 (Colin Rundel Lecture 7 February 7, / Average of iid Random Variables Let X 1, X,, X n iid D where D is some probability distribution with E(X i = µ and Var(X i = σ. Weak Based on these results and Markov s Inequality we can show the following: We defined X n = (X 1 + X + + X n /n then E( X n = E(S n /n = E(S n /n = µ Var( X n = Var(S n /n = 1 n Var(S n Therefore, as long as σ < = nσ n = σ n lim P( X n µ ɛ = 0 lim P( X n µ < ɛ = 1 n n Sta30/Mth30 (Colin Rundel Lecture 7 February 7, / Sta30/Mth30 (Colin Rundel Lecture 7 February 7, /
6 Weak ( X n converges in probability to µ: lim P( X n µ > ɛ = 0 n Strong ( X n converges almost surely to µ: ( P X n = µ = 1 lim n LLN - Example How large a random sample must be taken from a given distribution in order for the probability to be at least 0.99 that the sample mean will be within standard deviations of the mean of the distribution? What about 0.95 probability to be within 1 standard deviations of the mean? Strong LLN is a more powerful result (Strong LLN implies Weak LLN, but its proof is more complicated. Sta30/Mth30 (Colin Rundel Lecture 7 February 7, / Sta30/Mth30 (Colin Rundel Lecture 7 February 7, / LLN and CLT Law of large numbers shows us that S n nµ lim = lim n n ( X n µ 0 n which shows that for large n, n S n nµ. What happens if we divide by something that grows slower than n like n? S n nµ lim = lim n( Xn µ d N(0, σ n n n This is the Central Limit Theorem, of which the DeMoivre-Laplace theorem for the normal approximation to the binomial is a special case. Hopefully by the end of this class we will have the tools to prove this. Sta30/Mth30 (Colin Rundel Lecture 7 February 7, 014 /
Midterm #1. Lecture 10: Joint Distributions and the Law of Large Numbers. Joint Distributions - Example, cont. Joint Distributions - Example
Midterm #1 Midterm 1 Lecture 10: and the Law of Large Numbers Statistics 104 Colin Rundel February 0, 01 Exam will be passed back at the end of class Exam was hard, on the whole the class did well: Mean:
More informationRandom Variables. Lecture 6: E(X ), Var(X ), & Cov(X, Y ) Random Variables - Vocabulary. Random Variables, cont.
Lecture 6: E(X ), Var(X ), & Cov(X, Y ) Sta230/Mth230 Colin Rundel February 5, 2014 We have been using them for a while now in a variety of forms but it is good to explicitly define what we mean Random
More informationCovariance. Lecture 20: Covariance / Correlation & General Bivariate Normal. Covariance, cont. Properties of Covariance
Covariance Lecture 0: Covariance / Correlation & General Bivariate Normal Sta30 / Mth 30 We have previously discussed Covariance in relation to the variance of the sum of two random variables Review Lecture
More informationMAS113 Introduction to Probability and Statistics
MAS113 Introduction to Probability and Statistics School of Mathematics and Statistics, University of Sheffield 2018 19 Identically distributed Suppose we have n random variables X 1, X 2,..., X n. Identically
More informationCOMPSCI 240: Reasoning Under Uncertainty
COMPSCI 240: Reasoning Under Uncertainty Andrew Lan and Nic Herndon University of Massachusetts at Amherst Spring 2019 Lecture 20: Central limit theorem & The strong law of large numbers Markov and Chebyshev
More informationLecture 1: August 28
36-705: Intermediate Statistics Fall 2017 Lecturer: Siva Balakrishnan Lecture 1: August 28 Our broad goal for the first few lectures is to try to understand the behaviour of sums of independent random
More informationLecture 11. Probability Theory: an Overveiw
Math 408 - Mathematical Statistics Lecture 11. Probability Theory: an Overveiw February 11, 2013 Konstantin Zuev (USC) Math 408, Lecture 11 February 11, 2013 1 / 24 The starting point in developing the
More informationSampling Distributions
Sampling Distributions Mathematics 47: Lecture 9 Dan Sloughter Furman University March 16, 2006 Dan Sloughter (Furman University) Sampling Distributions March 16, 2006 1 / 10 Definition We call the probability
More informationMATH Notebook 5 Fall 2018/2019
MATH442601 2 Notebook 5 Fall 2018/2019 prepared by Professor Jenny Baglivo c Copyright 2004-2019 by Jenny A. Baglivo. All Rights Reserved. 5 MATH442601 2 Notebook 5 3 5.1 Sequences of IID Random Variables.............................
More informationTom Salisbury
MATH 2030 3.00MW Elementary Probability Course Notes Part V: Independence of Random Variables, Law of Large Numbers, Central Limit Theorem, Poisson distribution Geometric & Exponential distributions Tom
More informationLecture Notes 5 Convergence and Limit Theorems. Convergence with Probability 1. Convergence in Mean Square. Convergence in Probability, WLLN
Lecture Notes 5 Convergence and Limit Theorems Motivation Convergence with Probability Convergence in Mean Square Convergence in Probability, WLLN Convergence in Distribution, CLT EE 278: Convergence and
More informationFundamental Tools - Probability Theory IV
Fundamental Tools - Probability Theory IV MSc Financial Mathematics The University of Warwick October 1, 2015 MSc Financial Mathematics Fundamental Tools - Probability Theory IV 1 / 14 Model-independent
More informationQuick Tour of Basic Probability Theory and Linear Algebra
Quick Tour of and Linear Algebra Quick Tour of and Linear Algebra CS224w: Social and Information Network Analysis Fall 2011 Quick Tour of and Linear Algebra Quick Tour of and Linear Algebra Outline Definitions
More informationExample continued. Math 425 Intro to Probability Lecture 37. Example continued. Example
continued : Coin tossing Math 425 Intro to Probability Lecture 37 Kenneth Harris kaharri@umich.edu Department of Mathematics University of Michigan April 8, 2009 Consider a Bernoulli trials process with
More informationLecture 13. Poisson Distribution. Text: A Course in Probability by Weiss 5.5. STAT 225 Introduction to Probability Models February 16, 2014
Lecture 13 Text: A Course in Probability by Weiss 5.5 STAT 225 Introduction to Probability Models February 16, 2014 Whitney Huang Purdue University 13.1 Agenda 1 2 3 13.2 Review So far, we have seen discrete
More informationExpectation of Random Variables
1 / 19 Expectation of Random Variables Saravanan Vijayakumaran sarva@ee.iitb.ac.in Department of Electrical Engineering Indian Institute of Technology Bombay February 13, 2015 2 / 19 Expectation of Discrete
More informationLimiting Distributions
Limiting Distributions We introduce the mode of convergence for a sequence of random variables, and discuss the convergence in probability and in distribution. The concept of convergence leads us to the
More informationLecture 7: Chapter 7. Sums of Random Variables and Long-Term Averages
Lecture 7: Chapter 7. Sums of Random Variables and Long-Term Averages ELEC206 Probability and Random Processes, Fall 2014 Gil-Jin Jang gjang@knu.ac.kr School of EE, KNU page 1 / 15 Chapter 7. Sums of Random
More informationCOMP2610/COMP Information Theory
COMP2610/COMP6261 - Information Theory Lecture 9: Probabilistic Inequalities Mark Reid and Aditya Menon Research School of Computer Science The Australian National University August 19th, 2014 Mark Reid
More informationCS145: Probability & Computing
CS45: Probability & Computing Lecture 5: Concentration Inequalities, Law of Large Numbers, Central Limit Theorem Instructor: Eli Upfal Brown University Computer Science Figure credits: Bertsekas & Tsitsiklis,
More informationIntroduction to Probability
LECTURE NOTES Course 6.041-6.431 M.I.T. FALL 2000 Introduction to Probability Dimitri P. Bertsekas and John N. Tsitsiklis Professors of Electrical Engineering and Computer Science Massachusetts Institute
More informationLecture 3 - Expectation, inequalities and laws of large numbers
Lecture 3 - Expectation, inequalities and laws of large numbers Jan Bouda FI MU April 19, 2009 Jan Bouda (FI MU) Lecture 3 - Expectation, inequalities and laws of large numbersapril 19, 2009 1 / 67 Part
More informationMoments. Raw moment: February 25, 2014 Normalized / Standardized moment:
Moments Lecture 10: Central Limit Theorem and CDFs Sta230 / Mth 230 Colin Rundel Raw moment: Central moment: µ n = EX n ) µ n = E[X µ) 2 ] February 25, 2014 Normalized / Standardized moment: µ n σ n Sta230
More informationJoint Probability Distributions and Random Samples (Devore Chapter Five)
Joint Probability Distributions and Random Samples (Devore Chapter Five) 1016-345-01: Probability and Statistics for Engineers Spring 2013 Contents 1 Joint Probability Distributions 2 1.1 Two Discrete
More informationRandom Variables. Cumulative Distribution Function (CDF) Amappingthattransformstheeventstotherealline.
Random Variables Amappingthattransformstheeventstotherealline. Example 1. Toss a fair coin. Define a random variable X where X is 1 if head appears and X is if tail appears. P (X =)=1/2 P (X =1)=1/2 Example
More informationDistributions of Functions of Random Variables. 5.1 Functions of One Random Variable
Distributions of Functions of Random Variables 5.1 Functions of One Random Variable 5.2 Transformations of Two Random Variables 5.3 Several Random Variables 5.4 The Moment-Generating Function Technique
More information3 Multiple Discrete Random Variables
3 Multiple Discrete Random Variables 3.1 Joint densities Suppose we have a probability space (Ω, F,P) and now we have two discrete random variables X and Y on it. They have probability mass functions f
More informationLecture 2: Review of Probability
Lecture 2: Review of Probability Zheng Tian Contents 1 Random Variables and Probability Distributions 2 1.1 Defining probabilities and random variables..................... 2 1.2 Probability distributions................................
More informationProving the central limit theorem
SOR3012: Stochastic Processes Proving the central limit theorem Gareth Tribello March 3, 2019 1 Purpose In the lectures and exercises we have learnt about the law of large numbers and the central limit
More informationMTH135/STA104: Probability
MTH5/STA4: Probability Homework # Due: Tuesday, Dec 6, 5 Prof Robert Wolpert Three subjects in a medical trial are given drug A After one week, those that do not respond favorably are switched to drug
More informationSTAT Chapter 5 Continuous Distributions
STAT 270 - Chapter 5 Continuous Distributions June 27, 2012 Shirin Golchi () STAT270 June 27, 2012 1 / 59 Continuous rv s Definition: X is a continuous rv if it takes values in an interval, i.e., range
More informationSTAT 430/510: Lecture 16
STAT 430/510: Lecture 16 James Piette June 24, 2010 Updates HW4 is up on my website. It is due next Mon. (June 28th). Starting today back at section 6.7 and will begin Ch. 7. Joint Distribution of Functions
More informationChapter 6: Large Random Samples Sections
Chapter 6: Large Random Samples Sections 6.1: Introduction 6.2: The Law of Large Numbers Skip p. 356-358 Skip p. 366-368 Skip 6.4: The correction for continuity Remember: The Midterm is October 25th in
More informationLecture 1: Review on Probability and Statistics
STAT 516: Stochastic Modeling of Scientific Data Autumn 2018 Instructor: Yen-Chi Chen Lecture 1: Review on Probability and Statistics These notes are partially based on those of Mathias Drton. 1.1 Motivating
More informationFinal Examination Solutions (Total: 100 points)
Final Examination Solutions (Total: points) There are 4 problems, each problem with multiple parts, each worth 5 points. Make sure you answer all questions. Your answer should be as clear and readable
More informationTwelfth Problem Assignment
EECS 401 Not Graded PROBLEM 1 Let X 1, X 2,... be a sequence of independent random variables that are uniformly distributed between 0 and 1. Consider a sequence defined by (a) Y n = max(x 1, X 2,..., X
More informationThe Central Limit Theorem
The Central Limit Theorem Patrick Breheny September 27 Patrick Breheny University of Iowa Biostatistical Methods I (BIOS 5710) 1 / 31 Kerrich s experiment Introduction 10,000 coin flips Expectation and
More information1 Presessional Probability
1 Presessional Probability Probability theory is essential for the development of mathematical models in finance, because of the randomness nature of price fluctuations in the markets. This presessional
More informationDiscrete Probability Refresher
ECE 1502 Information Theory Discrete Probability Refresher F. R. Kschischang Dept. of Electrical and Computer Engineering University of Toronto January 13, 1999 revised January 11, 2006 Probability theory
More informationLimiting Distributions
We introduce the mode of convergence for a sequence of random variables, and discuss the convergence in probability and in distribution. The concept of convergence leads us to the two fundamental results
More informationPart IA Probability. Definitions. Based on lectures by R. Weber Notes taken by Dexter Chua. Lent 2015
Part IA Probability Definitions Based on lectures by R. Weber Notes taken by Dexter Chua Lent 2015 These notes are not endorsed by the lecturers, and I have modified them (often significantly) after lectures.
More informationChapter 4. Chapter 4 sections
Chapter 4 sections 4.1 Expectation 4.2 Properties of Expectations 4.3 Variance 4.4 Moments 4.5 The Mean and the Median 4.6 Covariance and Correlation 4.7 Conditional Expectation SKIP: 4.8 Utility Expectation
More informationCSE 312 Final Review: Section AA
CSE 312 TAs December 8, 2011 General Information General Information Comprehensive Midterm General Information Comprehensive Midterm Heavily weighted toward material after the midterm Pre-Midterm Material
More informationLecture 10: Probability distributions TUESDAY, FEBRUARY 19, 2019
Lecture 10: Probability distributions DANIEL WELLER TUESDAY, FEBRUARY 19, 2019 Agenda What is probability? (again) Describing probabilities (distributions) Understanding probabilities (expectation) Partial
More informationECE302 Spring 2015 HW10 Solutions May 3,
ECE32 Spring 25 HW Solutions May 3, 25 Solutions to HW Note: Most of these solutions were generated by R. D. Yates and D. J. Goodman, the authors of our textbook. I have added comments in italics where
More informationLecture 2: Repetition of probability theory and statistics
Algorithms for Uncertainty Quantification SS8, IN2345 Tobias Neckel Scientific Computing in Computer Science TUM Lecture 2: Repetition of probability theory and statistics Concept of Building Block: Prerequisites:
More informationCMPSCI 240: Reasoning Under Uncertainty
CMPSCI 240: Reasoning Under Uncertainty Lecture 8 Prof. Hanna Wallach wallach@cs.umass.edu February 16, 2012 Reminders Check the course website: http://www.cs.umass.edu/ ~wallach/courses/s12/cmpsci240/
More informationThings to remember when learning probability distributions:
SPECIAL DISTRIBUTIONS Some distributions are special because they are useful They include: Poisson, exponential, Normal (Gaussian), Gamma, geometric, negative binomial, Binomial and hypergeometric distributions
More informationLecture 4: Sampling, Tail Inequalities
Lecture 4: Sampling, Tail Inequalities Variance and Covariance Moment and Deviation Concentration and Tail Inequalities Sampling and Estimation c Hung Q. Ngo (SUNY at Buffalo) CSE 694 A Fun Course 1 /
More informationMA/ST 810 Mathematical-Statistical Modeling and Analysis of Complex Systems
MA/ST 810 Mathematical-Statistical Modeling and Analysis of Complex Systems Review of Basic Probability The fundamentals, random variables, probability distributions Probability mass/density functions
More informationChapter 5 continued. Chapter 5 sections
Chapter 5 sections Discrete univariate distributions: 5.2 Bernoulli and Binomial distributions Just skim 5.3 Hypergeometric distributions 5.4 Poisson distributions Just skim 5.5 Negative Binomial distributions
More informationStationary independent increments. 1. Random changes of the form X t+h X t fixed h > 0 are called increments of the process.
Stationary independent increments 1. Random changes of the form X t+h X t fixed h > 0 are called increments of the process. 2. If each set of increments, corresponding to non-overlapping collection of
More informationPart IA Probability. Theorems. Based on lectures by R. Weber Notes taken by Dexter Chua. Lent 2015
Part IA Probability Theorems Based on lectures by R. Weber Notes taken by Dexter Chua Lent 2015 These notes are not endorsed by the lecturers, and I have modified them (often significantly) after lectures.
More informationLimit Theorems. STATISTICS Lecture no Department of Econometrics FEM UO Brno office 69a, tel
STATISTICS Lecture no. 6 Department of Econometrics FEM UO Brno office 69a, tel. 973 442029 email:jiri.neubauer@unob.cz 3. 11. 2009 If we repeat some experiment independently we can create using given
More informationLectures on Elementary Probability. William G. Faris
Lectures on Elementary Probability William G. Faris February 22, 2002 2 Contents 1 Combinatorics 5 1.1 Factorials and binomial coefficients................. 5 1.2 Sampling with replacement.....................
More informationBivariate distributions
Bivariate distributions 3 th October 017 lecture based on Hogg Tanis Zimmerman: Probability and Statistical Inference (9th ed.) Bivariate Distributions of the Discrete Type The Correlation Coefficient
More informationCMPSCI 240: Reasoning Under Uncertainty
CMPSCI 240: Reasoning Under Uncertainty Lecture 7 Prof. Hanna Wallach wallach@cs.umass.edu February 14, 2012 Reminders Check the course website: http://www.cs.umass.edu/ ~wallach/courses/s12/cmpsci240/
More informationSDS 321: Introduction to Probability and Statistics
SDS 321: Introduction to Probability and Statistics Lecture 13: Expectation and Variance and joint distributions Purnamrita Sarkar Department of Statistics and Data Science The University of Texas at Austin
More informationMATH 151, FINAL EXAM Winter Quarter, 21 March, 2014
Time: 3 hours, 8:3-11:3 Instructions: MATH 151, FINAL EXAM Winter Quarter, 21 March, 214 (1) Write your name in blue-book provided and sign that you agree to abide by the honor code. (2) The exam consists
More informationSUMMARY OF PROBABILITY CONCEPTS SO FAR (SUPPLEMENT FOR MA416)
SUMMARY OF PROBABILITY CONCEPTS SO FAR (SUPPLEMENT FOR MA416) D. ARAPURA This is a summary of the essential material covered so far. The final will be cumulative. I ve also included some review problems
More informationProbability and Statistics Notes
Probability and Statistics Notes Chapter Five Jesse Crawford Department of Mathematics Tarleton State University Spring 2011 (Tarleton State University) Chapter Five Notes Spring 2011 1 / 37 Outline 1
More informationACM 116: Lectures 3 4
1 ACM 116: Lectures 3 4 Joint distributions The multivariate normal distribution Conditional distributions Independent random variables Conditional distributions and Monte Carlo: Rejection sampling Variance
More informationProbability Notes. Compiled by Paul J. Hurtado. Last Compiled: September 6, 2017
Probability Notes Compiled by Paul J. Hurtado Last Compiled: September 6, 2017 About These Notes These are course notes from a Probability course taught using An Introduction to Mathematical Statistics
More informationWeek 9 The Central Limit Theorem and Estimation Concepts
Week 9 and Estimation Concepts Week 9 and Estimation Concepts Week 9 Objectives 1 The Law of Large Numbers and the concept of consistency of averages are introduced. The condition of existence of the population
More informationStochastic Models (Lecture #4)
Stochastic Models (Lecture #4) Thomas Verdebout Université libre de Bruxelles (ULB) Today Today, our goal will be to discuss limits of sequences of rv, and to study famous limiting results. Convergence
More informationProbability Distributions Columns (a) through (d)
Discrete Probability Distributions Columns (a) through (d) Probability Mass Distribution Description Notes Notation or Density Function --------------------(PMF or PDF)-------------------- (a) (b) (c)
More informationCSE 103 Homework 8: Solutions November 30, var(x) = np(1 p) = P r( X ) 0.95 P r( X ) 0.
() () a. X is a binomial distribution with n = 000, p = /6 b. The expected value, variance, and standard deviation of X is: E(X) = np = 000 = 000 6 var(x) = np( p) = 000 5 6 666 stdev(x) = np( p) = 000
More information1 Exercises for lecture 1
1 Exercises for lecture 1 Exercise 1 a) Show that if F is symmetric with respect to µ, and E( X )
More informationLecture 1. ABC of Probability
Math 408 - Mathematical Statistics Lecture 1. ABC of Probability January 16, 2013 Konstantin Zuev (USC) Math 408, Lecture 1 January 16, 2013 1 / 9 Agenda Sample Spaces Realizations, Events Axioms of Probability
More informationRecitation 2: Probability
Recitation 2: Probability Colin White, Kenny Marino January 23, 2018 Outline Facts about sets Definitions and facts about probability Random Variables and Joint Distributions Characteristics of distributions
More informationi=1 k i=1 g i (Y )] = k f(t)dt and f(y) = F (y) except at possibly countably many points, E[g(Y )] = f(y)dy = 1, F(y) = y
Math 480 Exam 2 is Wed. Oct. 31. You are allowed 7 sheets of notes and a calculator. The exam emphasizes HW5-8, and Q5-8. From the 1st exam: The conditional probability of A given B is P(A B) = P(A B)
More informationExercises and Answers to Chapter 1
Exercises and Answers to Chapter The continuous type of random variable X has the following density function: a x, if < x < a, f (x), otherwise. Answer the following questions. () Find a. () Obtain mean
More informationStat 5101 Lecture Slides: Deck 7 Asymptotics, also called Large Sample Theory. Charles J. Geyer School of Statistics University of Minnesota
Stat 5101 Lecture Slides: Deck 7 Asymptotics, also called Large Sample Theory Charles J. Geyer School of Statistics University of Minnesota 1 Asymptotic Approximation The last big subject in probability
More informationProbability Models. 4. What is the definition of the expectation of a discrete random variable?
1 Probability Models The list of questions below is provided in order to help you to prepare for the test and exam. It reflects only the theoretical part of the course. You should expect the questions
More informationChapter 7. Basic Probability Theory
Chapter 7. Basic Probability Theory I-Liang Chern October 20, 2016 1 / 49 What s kind of matrices satisfying RIP Random matrices with iid Gaussian entries iid Bernoulli entries (+/ 1) iid subgaussian entries
More informationMath 3215 Intro. Probability & Statistics Summer 14. Homework 5: Due 7/3/14
Math 325 Intro. Probability & Statistics Summer Homework 5: Due 7/3/. Let X and Y be continuous random variables with joint/marginal p.d.f. s f(x, y) 2, x y, f (x) 2( x), x, f 2 (y) 2y, y. Find the conditional
More informationAlgorithms for Uncertainty Quantification
Algorithms for Uncertainty Quantification Tobias Neckel, Ionuț-Gabriel Farcaș Lehrstuhl Informatik V Summer Semester 2017 Lecture 2: Repetition of probability theory and statistics Example: coin flip Example
More information6 The normal distribution, the central limit theorem and random samples
6 The normal distribution, the central limit theorem and random samples 6.1 The normal distribution We mentioned the normal (or Gaussian) distribution in Chapter 4. It has density f X (x) = 1 σ 1 2π e
More informationProperties of Random Variables
Properties of Random Variables 1 Definitions A discrete random variable is defined by a probability distribution that lists each possible outcome and the probability of obtaining that outcome If the random
More informationSection 9.1. Expected Values of Sums
Section 9.1 Expected Values of Sums Theorem 9.1 For any set of random variables X 1,..., X n, the sum W n = X 1 + + X n has expected value E [W n ] = E [X 1 ] + E [X 2 ] + + E [X n ]. Proof: Theorem 9.1
More informationChapter 5. Chapter 5 sections
1 / 43 sections Discrete univariate distributions: 5.2 Bernoulli and Binomial distributions Just skim 5.3 Hypergeometric distributions 5.4 Poisson distributions Just skim 5.5 Negative Binomial distributions
More informationExpectation. DS GA 1002 Probability and Statistics for Data Science. Carlos Fernandez-Granda
Expectation DS GA 1002 Probability and Statistics for Data Science http://www.cims.nyu.edu/~cfgranda/pages/dsga1002_fall17 Carlos Fernandez-Granda Aim Describe random variables with a few numbers: mean,
More informationCh. 5 Joint Probability Distributions and Random Samples
Ch. 5 Joint Probability Distributions and Random Samples 5. 1 Jointly Distributed Random Variables In chapters 3 and 4, we learned about probability distributions for a single random variable. However,
More informationTopic 7: Convergence of Random Variables
Topic 7: Convergence of Ranom Variables Course 003, 2016 Page 0 The Inference Problem So far, our starting point has been a given probability space (S, F, P). We now look at how to generate information
More information(y 1, y 2 ) = 12 y3 1e y 1 y 2 /2, y 1 > 0, y 2 > 0 0, otherwise.
54 We are given the marginal pdfs of Y and Y You should note that Y gamma(4, Y exponential( E(Y = 4, V (Y = 4, E(Y =, and V (Y = 4 (a With U = Y Y, we have E(U = E(Y Y = E(Y E(Y = 4 = (b Because Y and
More information2. Suppose (X, Y ) is a pair of random variables uniformly distributed over the triangle with vertices (0, 0), (2, 0), (2, 1).
Name M362K Final Exam Instructions: Show all of your work. You do not have to simplify your answers. No calculators allowed. There is a table of formulae on the last page. 1. Suppose X 1,..., X 1 are independent
More informationExpectation. DS GA 1002 Statistical and Mathematical Models. Carlos Fernandez-Granda
Expectation DS GA 1002 Statistical and Mathematical Models http://www.cims.nyu.edu/~cfgranda/pages/dsga1002_fall16 Carlos Fernandez-Granda Aim Describe random variables with a few numbers: mean, variance,
More informationEconomics 620, Lecture 8: Asymptotics I
Economics 620, Lecture 8: Asymptotics I Nicholas M. Kiefer Cornell University Professor N. M. Kiefer (Cornell University) Lecture 8: Asymptotics I 1 / 17 We are interested in the properties of estimators
More informationMathematical Statistics 1 Math A 6330
Mathematical Statistics 1 Math A 6330 Chapter 3 Common Families of Distributions Mohamed I. Riffi Department of Mathematics Islamic University of Gaza September 28, 2015 Outline 1 Subjects of Lecture 04
More informationECE 302 Division 1 MWF 10:30-11:20 (Prof. Pollak) Final Exam Solutions, 5/3/2004. Please read the instructions carefully before proceeding.
NAME: ECE 302 Division MWF 0:30-:20 (Prof. Pollak) Final Exam Solutions, 5/3/2004. Please read the instructions carefully before proceeding. If you are not in Prof. Pollak s section, you may not take this
More informationCDA5530: Performance Models of Computers and Networks. Chapter 2: Review of Practical Random Variables
CDA5530: Performance Models of Computers and Networks Chapter 2: Review of Practical Random Variables Definition Random variable (R.V.) X: A function on sample space X: S R Cumulative distribution function
More information18.440: Lecture 28 Lectures Review
18.440: Lecture 28 Lectures 18-27 Review Scott Sheffield MIT Outline Outline It s the coins, stupid Much of what we have done in this course can be motivated by the i.i.d. sequence X i where each X i is
More informationSTAT 418: Probability and Stochastic Processes
STAT 418: Probability and Stochastic Processes Spring 2016; Homework Assignments Latest updated on April 29, 2016 HW1 (Due on Jan. 21) Chapter 1 Problems 1, 8, 9, 10, 11, 18, 19, 26, 28, 30 Theoretical
More information4. Distributions of Functions of Random Variables
4. Distributions of Functions of Random Variables Setup: Consider as given the joint distribution of X 1,..., X n (i.e. consider as given f X1,...,X n and F X1,...,X n ) Consider k functions g 1 : R n
More informationApplied Statistics I
Applied Statistics I Liang Zhang Department of Mathematics, University of Utah July 8, 2008 Liang Zhang (UofU) Applied Statistics I July 8, 2008 1 / 15 Distribution for Sample Mean Liang Zhang (UofU) Applied
More informationTwo hours. Statistical Tables to be provided THE UNIVERSITY OF MANCHESTER. 14 January :45 11:45
Two hours Statistical Tables to be provided THE UNIVERSITY OF MANCHESTER PROBABILITY 2 14 January 2015 09:45 11:45 Answer ALL four questions in Section A (40 marks in total) and TWO of the THREE questions
More informationTopic 3: The Expectation of a Random Variable
Topic 3: The Expectation of a Random Variable Course 003, 2017 Page 0 Expectation of a discrete random variable Definition (Expectation of a discrete r.v.): The expected value (also called the expectation
More informationA Probability Primer. A random walk down a probabilistic path leading to some stochastic thoughts on chance events and uncertain outcomes.
A Probability Primer A random walk down a probabilistic path leading to some stochastic thoughts on chance events and uncertain outcomes. Are you holding all the cards?? Random Events A random event, E,
More informationMore on Distribution Function
More on Distribution Function The distribution of a random variable X can be determined directly from its cumulative distribution function F X. Theorem: Let X be any random variable, with cumulative distribution
More informationContinuous Random Variables and Continuous Distributions
Continuous Random Variables and Continuous Distributions Continuous Random Variables and Continuous Distributions Expectation & Variance of Continuous Random Variables ( 5.2) The Uniform Random Variable
More information