Supplemental Data. Gao et al. (2012). Plant Cell /tpc

Transcription

1 Supplemental Figure 1. Plant EMP Proteins. (A) The Accession numbers of the 12 EMP members from Arabidopsis. (B) Phylogenetic analysis of EMP proteins from Arabidopsis, human and yeast using the Mac Vector by UPGMA method. The bootstrap values are shown above each branch. (C) Alignment of the C-terminal region of Arabidopsis EMPs. The red boxes highlighted the ER export signals, while the blue boxes highlighted the Golgi retention signals. (D) Alignment of the C-terminal tail of EMP proteins from Arabidopsis, rice and maize. The red box highlighted the conserved lysine in the 3 position, while the blue box highlighted the conserved acidic residue (aspartic acid or glutamic acid) in the 1 position. 1

2 Supplemental Figure 2. The C-terminus of EMP12 was Essential for ER Export. (A) Constructs of GFP-EMP12 lacking lumenal N-terminus or cytoplasmic C-terminus. (B-C) Subcellular localization of GFP-EMP12( N) (B) and GFP-EMP12( C) (C) upon co-expression with either the Golgi marker Man1-mRFP or the ER marker Calnexin-mRFP in an Arabidopsis protoplast. Scale bar = 10 μm. 2

3 Supplemental Figure 3. Subcellular Localization of GFP-EMP12 with Triple Mutations at Its C-terminus. These constructs were co-expressed with the Golgi marker Man1-mRFP in Arabidopsis protoplasts. Scale bar = 10 μm. 3

4 Supplemental Figure 4. Subcellular Localization of EMP12-GFP with the Golgi Retention Motif Fused to the C-terminal End. The EMP12-GFP-CT (panels A-C), the EMP12-GFP-RNIKCD (panels D-E) and the EMP12-GFP-KCD (panels F-H) fusions were coexpressed with indicated organelle markers in Arabidopsis protoplasts, followed by confocal imaging at 12 h-14 h after transfection. Scale bar = 10 μm. 4

5 Supplemental Figure 5. Subcellular Localization of EMP12-GFP with C-terminal Fusion of Mutated Golgi Retention Motif. The EMP12-GFP-RNIACA (panels A-C), the EMP12-GFP-RNIACD (panels D-E), the EMP12-GFP-RNIKCA (panels F-G) and the EMP12-GFP-RNIKCDAAA (panels H-I) fusions were co-expressed with indicated organelle markers in Arabidopsis protoplasts, followed by confocal imaging at 12 h-14 h after transfection. Scale bar = 10 μm. 5

6 Supplemental Figure 6. EMP12-GFP Reached the Vacuole via the PVC for Degradation. (A). Overexpression of mrfp-ara7(q69l) did not affect the Golgi localization of GFP-EMP12 fusion. (B). EMP12-GFP reached the lumen of the enlarged PVC. When co-expressed with mrfp-ara7(q69l), EMP12-GFP fusion showed ball-like structures that were trapped in the lumen of mrfp-ara7(q69l) bounded ring-like structures, indicating that the EMP12-GFP fusion was degraded. (C). Overexpression of mrfp-ara7(q69l) did not affect the Golgi localization of EMP12-GFP-RNIKCD fusion. (D). EMP12-GFP-RNIKCDAAA reached the lumen of the enlarged PVC. When co-expressed with mrfp-ara7(q69l), EMP12-GFP-RNIKCDAAA fusion showed ball-like structures that were trapped in the lumen of mrfp-ara7(q69l) bounded ring-like structures, indicating that the EMP12-GFP-RNIKCDAAA fusion was degraded. Scale bar = 10 μm. 6

7 Supplemental Figure 7. EMP12 C-terminus Interacted with COPI Subunits. The wild-type Arabidopsis cells were used for protein isolation and peptide binding using Sepharose conjugated with EMP12 C-terminus synthetic peptides. Eluted proteins were separated by SDS-PAGE, followed by silver staining and MS-MS analysis of protein bands for protein identification. Arrowheads indicated COPI coat proteins, and the search results were included in the Table. MW, molecular weight in Da; PI, isoelectric point; C.I., confidence interval. 7

8 Supplemental Figure 8. Subcellular Localization of N-terminal or C-terminal GFP Fusions with EMP2, EMP3 and EMP8 in Arabidopsis Protoplasts. The GFP tag was either fused to the N-terminus (A, C and E) or the C-terminus (B, D and F) of EMP2, EMP3 and EMP8, followed by their co-expression with the Golgi marker Man1-mRFP in Arabidopsis protoplasts for confocal imaging. Scale bar = 10 μm. 8

9 Supplemental Figure 9. Localization Patterns of Singly-expressed Various EMP12 Fusions and Their Mutants in Arabidopsis Protoplasts. The indicated GFP fusions were transiently expressed alone in Arabidopsis protoplasts, followed by confocal imaging at 12 h-14 h after transfection. Scale bar = 10 μm. 9

10 Supplemental Table 1: Primers used in this study GFP-EMP12-Forward 5'-gggTCTAGATCAGATCACAAGTATCAAGCCGAG G-3' GFP-EMP12-Reverse 5'-gggGAGCTCCTAGTCGCACTTGATGTTTCTGTAG -3' GFP-EMP12( N)-Forward 5'-gggTCTAGAGAACACCAGATCCACTGGTTCT-3' GFP-EMP12( C)-Reverse 5 -ggggagctcctatcccaggtagccaacagctc-3 GFP-EMP12(F578A/V579A/Y583A 5 -ggggagctcctactagtcgcacttgatgtttctg )-Reverse GCGATCCTCCTTGCAGCCAGATTTGATC-3 GFP-EMP12(F578A/V579A)-Revers 5 -ggggagctcctagtcgcacttgatgtttctgtag e ATCCTCCTTGCAGCCAGATTTGATC-3 GFP-EMP12(V579A/Y583A)-Rever 5 -gggctcgagctagtcgcacttgatgtttctggcg se ATCCTC CTTGCAAACAGATTTG-3 GFP-EMP12(F578A/Y583A)-Revers 5 -gggctcgagctagtcgcacttgatgtttctggcg e ATCCTC CTTACAGCCA GATTTGATC-3 GFP-EMP12(F578A)-Reverse 5 -ggggagctcctagtcgcacttgatgtttctgtag ATCCTCCTTACAGCCAGATTTGATC-3 GFP-EMP12(V579A)-Reverse 5 -ggggagctcctagtcgcacttgatgtttctgtag ATCCTCCTTGCAAACAGATTTG-3 GFP-EMP12(Y583A)-Reverse 5 -ggggagctcctagtcgcacttgatgtttctggcg ATCCTCCTTAC-3 EMP12-GFP-Forward 5'-gggTCTAGAATGCCGTCTTCCTCCTCC-3' EMP12-GFP-Reverse 5'-gggCTCGAGGTCGCACTTGATGTTTCTGTAG-3' EMP12-GFP-Cter-Forward 5 -gggctcgagatggtgagcaagggcgaggag-3 EMP12-GFP-Cter-Reverse 5 -ggggagctcctagtcgcacttgatgtttctgtag ATCCTCCTTACAAACAGATTTGATCCCTTGTACAG CTCGTCCATGCCGTGAGT-3 EMP12-GFP-RIYRNIKCD-Reverse 5 -ggggagctcctagtcgcacttgatgtttctgtag ATCCTC TTGTACAGCTCGTCCATGCC-3 EMP12-GFP-RNIKCD-Reverse 5 -ggggagctcctagtcgcacttgatgtttctcttg TACAGC TCGTCCATGCC-3 EMP12-GFP-KCD-Reverse 5 -ggggagctcctagtcgcacttcttgtacagctc GTCCATG-3 EMP12-GFP-RNIACA-Reverse 5 -ggggagctcctaggcgcacgcgatgtttctctt GTACAGCTCG TCCATG-3 EMP12-GFP-RNIACD-Reverse 5 -ggggagctctagactagtcgcacgcgatgtttc TCTTGTA CAG-3 EMP12-GFP-RNIKCA-Reverse 5 -ggggagctctagactaggcgcacttgatgtttct CTTG-3 EMP12-GFP-RNIKCDAAA-Revers 5 -ggggagctctagactatgctgctgcgtcgcact e TGATGTTTCT-3 SCAMP1-GFP-RNIKCD-Reverse 5 -ggggagctcctagtcgcacttgatgtttctcttg TACAGC TCGTCCATGCC-3 TPK1-GFP-RNIKCD-Reverse 5 -ggggagctcctagtcgcacttgatgtttctcttg TACAGC TCGTCCATGCC-3 10

11 EMP2-GFP-Forward EMP2-GFP-Reverse GFP-EMP2-Forward GFP-EMP2-Reverse EMP3-GFP-Forward EMP3-GFP-Reverse GFP-EMP3-Forward GFP-EMP3-Reverse EMP8-GFP-Forward EMP8-GFP-Reverse GFP-EMP8-Forward GFP-EMP8-Reverse 5 -gggctcgagatggagttttatagaagttctag-3 5 -gggggtaccatcgatctttaccgaggaat-3 5 -gggctcgagttttaccttcctggtgttgctc-3 5 -gggggtacctcaatcgatctttaccgaggaat-3 5 -gggtgtaga ATGGCGAAAGTTCGGATTTTG-3 5 -gggctcgagatcgattttaaccgaagag-3 5 -gggtgtagagctccacaagatttccaaatg-3 5 -gggctcgagtcaatcgattttaaccgaagag-3 5 -cgctctagaatgaggacaccgacgacgattctc ccgctcgagctcgcatttgatcgaccggta-3 5 -cgcgacgcctccg ACCACCGTTA CAAG-3 5 -ccgctcgagttactcgcatttgatcgaccggta-3 11