Biophysical Techniques (BPHS 4090/PHYS 5800)
|
|
- Clinton McCormick
- 5 years ago
- Views:
Transcription
1 Biophysical Techniques (BPHS 4090/PHYS 5800) Instructors: Prof. Christopher Bergevin Schedule: MWF 1:30-2:30 (CB 122) Website: York University Winter 2017 Lec.6
2 To build up a foundation to understand how this (MRI) image was acquired, we need to first clarify some key ideas (chiefly within the vein of signal processing ) Key idea: Periodicity Wikipedia
3 Fourier analysis Ø Backbone of modern signal processing and linear systems theory Ø Basic idea: Represent signal as a sum of sinusoids Note: Images in the basic sense can be considered 2-D, but we can first gain the necessary insight by initially focusing on 1-D examples Joseph Fourier ( )
4 Connec3ons to the EM spectrum... à Fairly natural to think about a spectral decomposition of light... Wikipedia
5 Focus on one (extremely useful/very basic) idea: Ø Just as visible light is composed of photons of many different wavelengths, an image is comprised different spatial wavelengths (or conversely, frequencies) à Put another way, we can make use of the notion of periodicity to describe an image in spectral terms
6 Aside: Periodicity/oscilla3ons commonly manifests throughout biology Ø Hearing Ø Circadian rhythms (and associated hormonal regula3on) Ø Min oscilla3ons in E. coli Ø Nega3ve feedback in gene3c expression: ( resul3ng from a transcrip3on factor repressing the promotor of its own gene. The feedback involves the produc3on of mrna as an intermediate. Because of the 3me lag between repression and mrna produc3on, the protein level can change periodically. ) Kruse & Julicher (2005)
7 ex. Spectrogram à Consider sound pressure varia3ons (as a 3me waveform) picked up by a microphone Blackbird (Turdus merula) Spectrogram frequency 3me amplitude Time Waveform hvp://
8
9 Fourier analysis Intui3ve connec3on back to Taylor series: [see H&R Appendix D] Ø Taylor series à Expand as a (infinite) sum of polynomials Ø Different Idea: Fourier series à Expand as a (infinite) sum of sinusoids
10 Fourier analysis Note: Independent variable (t here) can represent any physical quan3ty, but for 1-D we typically use 3me Complex #s are much more compact and easier to deal with
11 Trigonometry review 2 A sinusoid has 3 basic proper3es: i - Amplitude height of wave ii - Frequency how oden does it repeat? 1/T [Hz] iii - Phase (f) where is the peak? needs a reference!
12 Trigonometry review à What does phase tell us? - Phase tells time information - Analogous to angle around circle - Arbitrary outside range [0,2π] ( phase unwrapping ambiguity ) - 1 cycle = 360 o = 2π radians Reference here is t = 0 Connection to complex numbers??
13 EXbeats.m % ### EXbeats.m ### CB (updated )!! % Plots sum of two sinusoids with different amplitudes/frequencies/phase! % offsets to demonstrate variety of "beating" patterns!! clear! % =================================! % Parameters for each of the two sinusoids! A1= 1.0; % amplitude 1! A2= 1.0; % amplitude 2! w1= 1.0; % angular frequency 1! w2= 1.2; % angular frequency 2! phi1= pi/2; % phase offset 1 (>=0 and <= 2*pi)! phi2= pi/2; % phase offset 2!! tmax= 120; % max. time value {6}! N= 1000; % # of points to compute {200}! % =================================!! % ---! t=linspace(0,tmax,n); % time variable! s1= A1*cos(w1*t- phi1);! s2= A2*cos(w2*t- phi2); % calculate both sinusoids and sum! A= s1+ s2;! % ---! % other (analytically-derived) expressions for the sum!! B= cos((w1+w2)/2*t).*(a1*cos((w1-w2)/2*t) + A2*cos((w1-w2)/2*t)); % from Serdyuk (which is incorrect)! % 2. CB calculated version! C= cos((w1+w2)/2*t).*(a1*cos((w1-w2)/2*t) + A2*cos((w1-w2)/2*t) ) +...! sin((w1+w2)/2*t).*(-a1*sin((w1-w2)/2*t) + A2*sin((w1-w2)/2*t) );! % 3. CB calculated version (factored)! D= (A1+A2)*cos((w1+w2)/2*t).*cos((w1-w2)/2*t) +...! (A2-A1)*sin((w1+w2)/2*t).*sin((w1-w2)/2*t);! % ---! figure(1); clf;! h1= plot(t,s1,'r'); hold on; grid on;! h2= plot(t,s2,'b--');! h3= plot(t,a,'k','linewidth',3);! xlabel('amplitude [arb]'); ylabel('time [arb]');! legend([h1 h2 h3],'sinusoid 1','sinusoid 2','sum');! % ---! if 1==1! figure(2); clf;! plot(t,a,'k','linewidth',2); hold on; grid on;! %plot(t,b,'r--'); plot(t,c,'go');! plot(t,d,'r.');! end!
14 Beats: Sum of (two) sinusoids f 1 =1, f 2 =1.1 A 1 =1, A 2 =1 φ 1 =0, φ 2 =0 f 1 =1, f 2 =1.2 A 1 =1, A 2 =1 φ 1 =0, φ 2 =0 à Different frequency combinations yield different patterns f 1 =1, f 2 =1.3 A 1 =1, A 2 =1 φ 1 =0, φ 2 =0
15 Beats: Sum of (two) sinusoids f 1 =1, f 2 =1.1 A 1 =1, A 2 =1 φ 1 =0, φ 2 =0 à Changing (relative) phase affects summation f 1 =1, f 2 =1.1 A 1 =1, A 2 =1 φ 1 =π/2, φ 2 =0 à Changing (relative) amplitudes affects summation f 1 =1, f 2 =1.1 A 1 =2, A 2 =1 φ 1 =0, φ 2 =0
16 Nota3on re Fourier analysis Hobbie & Roth version à Analy3c nota3on u3lized can vary widely across texts... Fourier coefficients Note the error above... Complex #s
17 Nota3on re Fourier analysis Fourier coefficients Cosine/Sine Transforms Fourier Transform Note: It s a two-way street (w/ no loss of info) Forward transform (3me à frequency) Inverse transform (frequency à 3me)
Biophysical Techniques (BPHS 4090/PHYS 5800)
Biophysical Techniques (BPHS 4090/PHYS 5800) Instructors: Prof. Christopher Bergevin (cberge@yorku.ca) Schedule: MWF 1:30-2:30 (CB 122) Website: http://www.yorku.ca/cberge/4090w2017.html York University
More informationBiophysical Techniques (BPHS 4090/PHYS 5800)
Biophysical Techniques (BPHS 4090/PHYS 5800) Instructors: Prof. Christopher Bergevin (cberge@yorku.ca) Schedule: MWF 1:30-2:30 (CB 122) Website: http://www.yorku.ca/cberge/4090w2017.html York University
More informationWhich of the six boxes below cannot be made from this unfolded box? (There may be more than ffi. ffi
Which of the six boxes below cannot be made from this unfolded box? (There may be more than one.) @ ffi w @ @ ffi c Biophysics @ YORK Peripheral sensory transduction Christopher Bergevin (York University,
More informationChapter 4: Graphing Sinusoidal Functions
Haberman MTH 2 Section I: The Trigonometric Functions Chapter : Graphing Sinusoidal Functions DEFINITION: A sinusoidal function is function of the form sinw or y A t h k where A, w, h, k. y Acosw t h k,
More informationBiophysics I (BPHS 3090)
Biophysics I (BPHS 3090) Instructors: Prof. Christopher Bergevin (cberge@yorku.ca) Website: http://www.yorku.ca/cberge/3090w2015.html York University Winter 2015 Lecture 16 Reference/Acknowledgement: -
More informationLecture 27 Frequency Response 2
Lecture 27 Frequency Response 2 Fundamentals of Digital Signal Processing Spring, 2012 Wei-Ta Chu 2012/6/12 1 Application of Ideal Filters Suppose we can generate a square wave with a fundamental period
More informationDefinition: A "system" of equations is a set or collection of equations that you deal with all together at once.
System of Equations Definition: A "system" of equations is a set or collection of equations that you deal with all together at once. There is both an x and y value that needs to be solved for Systems
More informationPhysical Acoustics. Hearing is the result of a complex interaction of physics, physiology, perception and cognition.
Physical Acoustics Hearing, auditory perception, or audition is the ability to perceive sound by detecting vibrations, changes in the pressure of the surrounding medium through time, through an organ such
More informationInvestigating the use of the Lomb-Scargle Periodogram for Heart Rate Variability Quantification
Page 1 of 16 Investigating the use of the Lomb-Scargle Periodogram for Heart Rate Variability Quantification The use of the Lomb-Scargle Periodogram (LSP) for the analysis of biological signal rhythms
More informationω 0 = 2π/T 0 is called the fundamental angular frequency and ω 2 = 2ω 0 is called the
he ime-frequency Concept []. Review of Fourier Series Consider the following set of time functions {3A sin t, A sin t}. We can represent these functions in different ways by plotting the amplitude versus
More informationInvestigating the use of the Lomb-Scargle Periodogram for Heart Rate Variability Quantification
Page 1 of 13 Investigating the use of the Lomb-Scargle Periodogram for Heart Rate Variability Quantification The use of the Lomb-Scargle Periodogram (LSP) for the analysis of biological signal rhythms
More informationTravelling and Standing Waves
Travelling and Standing Waves Many biological phenomena are cyclic. Heartbeats Circadian rhythms, Estrus cycles Many more e.g. s Such events are best described as waves. Therefore the study of waves is
More informationSuperposition and Standing Waves
Physics 1051 Lecture 9 Superposition and Standing Waves Lecture 09 - Contents 14.5 Standing Waves in Air Columns 14.6 Beats: Interference in Time 14.7 Non-sinusoidal Waves Trivia Questions 1 How many wavelengths
More informationFRACTIONS Book 1 An Introduction to Fractions for the Adult Learner
ACADEMIC STUDIES MATH Support Materials and Exercises for FRACTIONS Book An Introduction to Fractions for the Adult Learner SPRING FRACTIONS Fractions are used in our everyday life. We talk about fractions
More informationPhysics 212. Lecture 23. Physics 212 Lecture 23, Slide 1
Physics 212 Lecture 23 Physics 212 Lecture 23, Slide 1 Music Who is the Artist? A) Soul Rebels Brass Band B) John Boutte C) New Orleans Nightcrawlers D) Paul Sanchez & Shammar Allen E) Alex McMurray and
More informationThe Z-Transform. For a phasor: X(k) = e jωk. We have previously derived: Y = H(z)X
The Z-Transform For a phasor: X(k) = e jωk We have previously derived: Y = H(z)X That is, the output of the filter (Y(k)) is derived by multiplying the input signal (X(k)) by the transfer function (H(z)).
More informationAcoustic holography. LMS Test.Lab. Rev 12A
Acoustic holography LMS Test.Lab Rev 12A Copyright LMS International 2012 Table of Contents Chapter 1 Introduction... 5 Chapter 2... 7 Section 2.1 Temporal and spatial frequency... 7 Section 2.2 Time
More informationClassical Mechanics Lecture 21
Classical Mechanics Lecture 21 Today s Concept: Simple Harmonic Mo7on: Mass on a Spring Mechanics Lecture 21, Slide 1 The Mechanical Universe, Episode 20: Harmonic Motion http://www.learner.org/vod/login.html?pid=565
More informationDOING PHYSICS WITH MATLAB FOURIER ANALYSIS FOURIER TRANSFORMS
DOING PHYSICS WITH MATLAB FOURIER ANALYSIS FOURIER TRANSFORMS Ian Cooper School of Physics, University of Sydney ian.cooper@sydney.edu.au DOWNLOAD DIRECTORY FOR MATLAB SCRIPTS maths_ft_01.m mscript used
More informationTime and Spatial Series and Transforms
Time and Spatial Series and Transforms Z- and Fourier transforms Gibbs' phenomenon Transforms and linear algebra Wavelet transforms Reading: Sheriff and Geldart, Chapter 15 Z-Transform Consider a digitized
More informationElectricity & Magnetism Lecture 23. Electricity & Magne/sm Lecture 23, Slide 1
Electricity & Magnetism Lecture 23 Electricity & Magne/sm Lecture 23, Slide 1 Your Comments the whole E-M wave graph, I s/ll don't understand what it is trying to tell us and where the sin(kz-ωt) even
More informationThe Hydrogen Spectrum
1 The Hydrogen Spectrum PHYS 1301 F98 Prof. T.E. Coan Last edit: 6 Aug 98 Introduction In last week's laboratory experiment on diffraction, you should have noticed that the light from the mercury discharge
More informationChapter 14: Wave Motion Tuesday April 7 th
Chapter 14: Wave Motion Tuesday April 7 th Wave superposition Spatial interference Temporal interference (beating) Standing waves and resonance Sources of musical sound Doppler effect Sonic boom Examples,
More informationAdvanced Optical Communications Prof. R. K. Shevgaonkar Department of Electrical Engineering Indian Institute of Technology, Bombay
Advanced Optical Communications Prof. R. K. Shevgaonkar Department of Electrical Engineering Indian Institute of Technology, Bombay Lecture No. # 15 Laser - I In the last lecture, we discussed various
More informationElectromagnetic radiation simply a stream of photons (a bundle of energy) What are photons???
Electromagnetic radiation simply a stream of photons (a bundle of energy) What are photons??? no mass travel in a wave like pattern move at the speed of light contain a certain amount (or bundle) of energy
More informationChapter 4 Discrete Fourier Transform (DFT) And Signal Spectrum
Chapter 4 Discrete Fourier Transform (DFT) And Signal Spectrum CEN352, DR. Nassim Ammour, King Saud University 1 Fourier Transform History Born 21 March 1768 ( Auxerre ). Died 16 May 1830 ( Paris ) French
More informationESE 250: Digital Audio Basics. Week 4 February 5, The Frequency Domain. ESE Spring'13 DeHon, Kod, Kadric, Wilson-Shah
ESE 250: Digital Audio Basics Week 4 February 5, 2013 The Frequency Domain 1 Course Map 2 Musical Representation With this compact notation Could communicate a sound to pianist Much more compact than 44KHz
More informationRadiation and the Atom
Radiation and the Atom PHYS Lecture Departamento de Física Instituto Superior de Engenharia do Porto cav@isep.ipp.pt Overview SI Units and Prefixes Radiation Electromagnetic Radiation Electromagnetic Spectrum
More informationContents. CHAPTER P Prerequisites 1. CHAPTER 1 Functions and Graphs 69. P.1 Real Numbers 1. P.2 Cartesian Coordinate System 14
CHAPTER P Prerequisites 1 P.1 Real Numbers 1 Representing Real Numbers ~ Order and Interval Notation ~ Basic Properties of Algebra ~ Integer Exponents ~ Scientific Notation P.2 Cartesian Coordinate System
More informationCourse Outline and Objectives. MA 1453 Precalculus with Graphing Calculators
Effective Fall 2011 Course Outline and Objectives MA 1453 Precalculus with Graphing Calculators TEXT: Precalculus, 5 th Edition, by Faires and DeFranza ISBN 978-0-8400-6862-0 NOTE: A graphing calculator
More informationQuantum Mechanics-I Prof. Dr. S. Lakshmi Bala Department of Physics Indian Institute of Technology, Madras. Lecture - 21 Square-Integrable Functions
Quantum Mechanics-I Prof. Dr. S. Lakshmi Bala Department of Physics Indian Institute of Technology, Madras Lecture - 21 Square-Integrable Functions (Refer Slide Time: 00:06) (Refer Slide Time: 00:14) We
More informationGene Regula*on, ChIP- X and DNA Mo*fs. Statistics in Genomics Hongkai Ji
Gene Regula*on, ChIP- X and DNA Mo*fs Statistics in Genomics Hongkai Ji (hji@jhsph.edu) Genetic information is stored in DNA TCAGTTGGAGCTGCTCCCCCACGGCCTCTCCTCACATTCCACGTCCTGTAGCTCTATGACCTCCACCTTTGAGTCCCTCCTC
More informationWhat needs to be known about the Collapse of Quantum-Mechanical Wave-Function
1 What needs to be known about the Collapse of Quantum-Mechanical Wave-Function Hasmukh K. Tank Indian Space Research Organization, 22/693 Krishna Dham-2, Vejalpur, Ahmedabad-380015 India Abstract Quantum
More informationExploring Nonlinear Oscillator Models for the Auditory Periphery
Exploring Nonlinear Oscillator Models for the Auditory Periphery Andrew Binder Dr. Christopher Bergevin, Supervisor October 31, 2008 1 Introduction Sound-induced vibrations are converted into electrical
More information6.003 Signal Processing
6.003 Signal Processing Week 6, Lecture A: The Discrete Fourier Transform (DFT) Adam Hartz hz@mit.edu What is 6.003? What is a signal? Abstractly, a signal is a function that conveys information Signal
More informationQuantitative Understanding in Biology Fourier Analysis and Signal Processing
Quantitative Understanding in Biology Fourier Analysis and Signal Processing Representing Mathematical Functions as Linear Combinations of Basis Functions Throughout this course we have seen examples of
More informationLaplace Transform Analysis of Signals and Systems
Laplace Transform Analysis of Signals and Systems Transfer Functions Transfer functions of CT systems can be found from analysis of Differential Equations Block Diagrams Circuit Diagrams 5/10/04 M. J.
More information6.003 Signal Processing
6.003 Signal Processing Week 6, Lecture A: The Discrete Fourier Transform (DFT) Adam Hartz hz@mit.edu What is 6.003? What is a signal? Abstractly, a signal is a function that conveys information Signal
More informationECE 3084 OCTOBER 17, 2017
Objective ECE 3084 LAB NO. 1: MEASURING FREQUENCY RESPONSE OCTOBER 17, 2017 The objective of this lab is to measure the magnitude response of a set of headphones or earbuds. We will explore three alternative
More information1.9 Practice Problems
1.9 Practice Problems 1. Solution: B It s not only chlorophyll a but a combination of pigments. 2. Solution: D See at what wavelength rate of photosynthesis is the highest. 3. Solution: D It s a fact.
More informationThe de Broglie hypothesis for the wave nature of matter was to simply re-write the equations describing light's dual nature: Elight = hf
Modern Physics (PHY 3305) Lecture Notes Modern Physics (PHY 3305) Lecture Notes Describing Nature as Waves (Ch. 4.3-4.4) SteveSekula, 10 February 010 (created 13 December 009) Review tags: lecture We concluded
More informationSignal Modeling, Statistical Inference and Data Mining in Astrophysics
ASTRONOMY 6523 Spring 2013 Signal Modeling, Statistical Inference and Data Mining in Astrophysics Course Approach The philosophy of the course reflects that of the instructor, who takes a dualistic view
More information!"#$%&!"&'(&%")(*(+& '4567,846/-&*,/69450.:&*,.;42/9450&<ᶫ.=097,.4.& #259,40& &95&523/0,--,.
1 2 Contact Information Dr. Sonish Azam Office: SP 375.23 Tel: 514-848-2424 ex 3488 Email: sonish.azam@concordia.ca (Please mention BIOL 266 in subject) Office hours: after the class or by appointment
More informationMore on waves + uncertainty principle
More on waves + uncertainty principle ** No class Fri. Oct. 18! The 2 nd midterm will be Nov. 2 in same place as last midterm, namely Humanities at 7:30pm. Welcome on Columbus day Christopher Columbus
More information16 SUPERPOSITION & STANDING WAVES
Chapter 6 SUPERPOSITION & STANDING WAVES 6. Superposition of waves Principle of superposition: When two or more waves overlap, the resultant wave is the algebraic sum of the individual waves. Illustration:
More informationNetworks and Systems Prof V.G K. Murti Department of Electrical Engineering Indian Institute of Technology, Madras Lecture - 10 Fourier Series (10)
Networks and Systems Prof V.G K. Murti Department of Electrical Engineering Indian Institute of Technology, Madras Lecture - 10 Fourier Series (10) What we have seen in the previous lectures, is first
More informationxvi xxiii xxvi Construction of the Real Line 2 Is Every Real Number Rational? 3 Problems Algebra of the Real Numbers 7
About the Author v Preface to the Instructor xvi WileyPLUS xxii Acknowledgments xxiii Preface to the Student xxvi 1 The Real Numbers 1 1.1 The Real Line 2 Construction of the Real Line 2 Is Every Real
More informationUIUC Physics 406POM Acoustical Physics of Music/Musical Instruments. N-Slit Interference in 1-Dimension Simplest Theory
N-Slit Interference in 1-Dimension Simplest Theory In this example, we show plots of the sound intensity vs. angle and observer/listener position y on a for the simplest theory of N-slit interference where
More informationUnit 8: Part 2: PD, PID, and Feedback Compensation
Ideal Derivative Compensation (PD) Lead Compensation PID Controller Design Feedback Compensation Physical Realization of Compensation Unit 8: Part 2: PD, PID, and Feedback Compensation Engineering 5821:
More informationLECTURE NOTES IN AUDIO ANALYSIS: PITCH ESTIMATION FOR DUMMIES
LECTURE NOTES IN AUDIO ANALYSIS: PITCH ESTIMATION FOR DUMMIES Abstract March, 3 Mads Græsbøll Christensen Audio Analysis Lab, AD:MT Aalborg University This document contains a brief introduction to pitch
More informationCharacteristics of Animals
Animal Adaptations Notes Characteristics of Animals Animals are in Kingdom a. b. eukaryotic c. cells lack. do not have a backbone. Ex. do have a backbone. Ex. Animals survive by doing the following essential
More informationModern Physics notes Paul Fendley Lecture 6
Modern Physics notes Paul Fendley fendley@virginia.edu Lecture 6 Size of the atom A digression on hand-waving arguments Spectral lines Feynman, 2.4-5 Fowler, Spectra, The Bohr atom The size of the atom
More informationZ-Transform. The Z-transform is the Discrete-Time counterpart of the Laplace Transform. Laplace : G(s) = g(t)e st dt. Z : G(z) =
Z-Transform The Z-transform is the Discrete-Time counterpart of the Laplace Transform. Laplace : G(s) = Z : G(z) = It is Used in Digital Signal Processing n= g(t)e st dt g[n]z n Used to Define Frequency
More informationClass XII Chapter 8 Electromagnetic Waves Physics
Question 8.1: Figure 8.6 shows a capacitor made of two circular plates each of radius 12 cm, and separated by 5.0 cm. The capacitor is being charged by an external source (not shown in the figure). The
More informationHonors Advanced Mathematics November 4, /2.6 summary and extra problems page 1 Recap: complex numbers
November 4, 013.5/.6 summary and extra problems page 1 Recap: complex numbers Number system The complex number system consists of a + bi where a and b are real numbers, with various arithmetic operations.
More informationFrequency Dependent Aspects of Op-amps
Frequency Dependent Aspects of Op-amps Frequency dependent feedback circuits The arguments that lead to expressions describing the circuit gain of inverting and non-inverting amplifier circuits with resistive
More informationLecture 4 Spherical Trigonometry and related topics. GISC January 2007
Lecture 4 Spherical Trigonometry and related topics GISC-3325 24 January 2007 Another book recommendation By Bill Carter and Merri Sue Carter, Naval Institute Press, Annapolis, Maryland 2002 Review Latitude
More informationElectricity & Magnetism Lecture 23. Electricity & Magne/sm Lecture 23, Slide 1
Electricity & Magnetism Lecture 23 Electricity & Magne/sm Lecture 23, Slide 1 Today you will play around with the polariza2on filters. Con2nue on Friday. Friday s lecture will be on circular polariza2on
More information1D Wave PDE. Introduction to Partial Differential Equations part of EM, Scalar and Vector Fields module (PHY2064) Richard Sear.
Introduction to Partial Differential Equations part of EM, Scalar and Vector Fields module (PHY2064) November 12, 2018 Wave equation in one dimension This lecture Wave PDE in 1D Method of Separation of
More informationFoundations, 1. Quantum mechanics is money
Foundations, 1 Quantum mechanics is money Text message and take a picture with your smart phone; watch a movie on your Blu-ray player; get the bar code on your bag of chips scanned; obtain an MRI image
More informationChem 30A. Ch 9. Electrons in Atoms and the Periodic Table
Chem 30A Ch 9. Electrons in Atoms and the Periodic Table Electronic Structure of Atoms Rutherford s Nuclear Model of the Atom e + Ques%on: How are the electrons arranged? Atomic Spectra White light emits
More information1.1 Lines & Function Notation AP Calculus
. Lines & Function Notation AP Calculus. Lines Notecard: Rules for Rounding & Average Rate of Change Round or Truncate all final answers to 3 decimal places. Do NOT round before you reach your final answer.
More informationRegulation of Gene Expression
Chapter 18 Regulation of Gene Expression PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationReference Text: The evolution of Applied harmonics analysis by Elena Prestini
Notes for July 14. Filtering in Frequency domain. Reference Text: The evolution of Applied harmonics analysis by Elena Prestini It all started with: Jean Baptist Joseph Fourier (1768-1830) Mathematician,
More informationResonance on Air Column
Resonance on Air Column Objectives a. To measure the speed of sound with the help of sound wave resonance in air column inside the tube with one end closed. b. To do error analysis of speed of sound measurement.
More informationCHAPTER 2 RANDOM PROCESSES IN DISCRETE TIME
CHAPTER 2 RANDOM PROCESSES IN DISCRETE TIME Shri Mata Vaishno Devi University, (SMVDU), 2013 Page 13 CHAPTER 2 RANDOM PROCESSES IN DISCRETE TIME When characterizing or modeling a random variable, estimates
More informationRevision of Basic A.C. Theory
Revision of Basic A.C. Theory 1 Revision of Basic AC Theory (Much of this material has come from Electrical & Electronic Principles & Technology by John Bird) Electricity is generated in power stations
More informationProblem 1. Part a. Part b. Wayne Witzke ProblemSet #4 PHY ! iθ7 7! Complex numbers, circular, and hyperbolic functions. = r (cos θ + i sin θ)
Problem Part a Complex numbers, circular, and hyperbolic functions. Use the power series of e x, sin (θ), cos (θ) to prove Euler s identity e iθ cos θ + i sin θ. The power series of e x, sin (θ), cos (θ)
More informationCentral to this is two linear transformations: the Fourier Transform and the Laplace Transform. Both will be considered in later lectures.
In this second lecture, I will be considering signals from the frequency perspective. This is a complementary view of signals, that in the frequency domain, and is fundamental to the subject of signal
More informationEnergy Wave Equations: Correction Factors
Energy Wave Equations: Correction Factors Jeff Yee jeffsyee@gmail.com March 16, 2018 Summary The equations in Energy Wave Theory accurately model particle energy, photon energy, forces, atomic orbitals
More informationIntroduction Basic Audio Feature Extraction
Introduction Basic Audio Feature Extraction Vincent Koops (with slides by Meinhard Müller) Sound and Music Technology, December 6th, 2016 1 28 November 2017 Today g Main modules A. Sound and music for
More informationTransform Representation of Signals
C H A P T E R 3 Transform Representation of Signals and LTI Systems As you have seen in your prior studies of signals and systems, and as emphasized in the review in Chapter 2, transforms play a central
More informationNo Lecture on Wed. But, there is a lecture on Thursday, at your normal recitation time, so please be sure to come!
Announcements Quiz 6 tomorrow Driscoll Auditorium Covers: Chapter 15 (lecture and homework, look at Questions, Checkpoint, and Summary) Chapter 16 (Lecture material covered, associated Checkpoints and
More informationRecitation 11: Time delays
Recitation : Time delays Emilio Frazzoli Laboratory for Information and Decision Systems Massachusetts Institute of Technology November, 00. Introduction and motivation. Delays are incurred when the controller
More informationLecture 4: Diffraction & Spectroscopy
Lecture 4: Diffraction & Spectroscopy d θ y L Spectra of atoms reveal the quantum nature of matter Take a plastic grating from the bin as you enter class. Lecture 4, p 1 Today s Topics Single-Slit Diffraction*
More informationGEORGIA INSTITUTE OF TECHNOLOGY SCHOOL OF ELECTRICAL AND COMPUTER ENGINEERING
GEORGIA INSTITUTE OF TECHNOLOGY SCHOOL OF ELECTRICAL AND COMUTER ENGINEERING ECE 2026 Summer 208 roblem Set #3 Assigned: May 27, 208 Due: June 5, 208 Reading: Chapter 3 on Spectrum Representation, and
More informationLECTURE 3 CMOS PHASE LOCKED LOOPS
Lecture 03 (8/9/18) Page 3-1 LECTURE 3 CMOS PHASE LOCKED LOOPS Topics The acquisition process unlocked state Noise in linear PLLs Organization: Systems Perspective Types of PLLs and PLL Measurements PLL
More informationChapter 4 Sequences and Series
Chapter 4 Sequences and Series 4.1 Sequence Review Sequence: a set of elements (numbers or letters or a combination of both). The elements of the set all follow the same rule (logical progression). The
More informationFOURIER ANALYSIS. (a) Fourier Series
(a) Fourier Series FOURIER ANAYSIS (b) Fourier Transforms Useful books: 1. Advanced Mathematics for Engineers and Scientists, Schaum s Outline Series, M. R. Spiegel - The course text. We follow their notation
More informationDCSP-2: Fourier Transform
DCSP-2: Fourier Transform Jianfeng Feng Department of Computer Science Warwick Univ., UK Jianfeng.feng@warwick.ac.uk http://www.dcs.warwick.ac.uk/~feng/dcsp.html Data transmission Channel characteristics,
More informationBME 50500: Image and Signal Processing in Biomedicine. Lecture 5: Correlation and Power-Spectrum CCNY
1 BME 50500: Image and Signal Processing in Biomedicine Lecture 5: Correlation and Power-Spectrum Lucas C. Parra Biomedical Engineering Department CCNY http://bme.ccny.cuny.edu/faculty/parra/teaching/signal-and-image/
More informationQuantum algorithms (CO 781, Winter 2008) Prof. Andrew Childs, University of Waterloo LECTURE 1: Quantum circuits and the abelian QFT
Quantum algorithms (CO 78, Winter 008) Prof. Andrew Childs, University of Waterloo LECTURE : Quantum circuits and the abelian QFT This is a course on quantum algorithms. It is intended for graduate students
More informationPre-Calculus LAWRENCE HIGH SCHOOL PRE-CALCULUS CURRICULUM MAP Updated 8/10/15 + denotes a Honors level concept
Pre-Calculus LAWRENCE HIGH SCHOOL PRE-CALCULUS CURRICULUM MAP 2015-2016 Quarter 1 8/24-10/30 Chapter 1 - Analyzing Trigonometric Functions 1A - The Cosine and Sine Functions 1B - Other Trigonometric Functions
More informationCircuits and Systems I
Circuits and Systems I LECTURE #2 Phasor Addition lions@epfl Prof. Dr. Volkan Cevher LIONS/Laboratory for Information and Inference Systems License Info for SPFirst Slides This work released under a Creative
More informationCorrelations to the Common Core State Standards: Kindergarten
Correlations to the Common Core State s: Kindergarten L-1, Building the Hundreds Counting and Cardinality Know number names and the count sequence. K.CC.1. Count to 100 by ones and by tens. K.CC.2. Count
More informationApplet Exercise 1: Introduction to the Virtual Lab and Wave Fundamentals
Applet Exercise 1: Introduction to the Virtual Lab and Wave Fundamentals Objectives: 1. Become familiar with the Virtual Lab display and controls.. Find out how sound loudness or intensity depends on distance
More informationPhysics General Physics. Lecture 25 Waves. Fall 2016 Semester Prof. Matthew Jones
Physics 22000 General Physics Lecture 25 Waves Fall 2016 Semester Prof. Matthew Jones 1 Final Exam 2 3 Mechanical Waves Waves and wave fronts: 4 Wave Motion 5 Two Kinds of Waves 6 Reflection of Waves When
More informationMechanical Waves. 3: Mechanical Waves (Chapter 16) Waves: Space and Time
3: Mechanical Waves (Chapter 6) Phys3, A Dr. Robert MacDonald Mechanical Waves A mechanical wave is a travelling disturbance in a medium (like water, string, earth, Slinky, etc). Move some part of the
More informationFourier transforms and convolution
Fourier transforms and convolution (without the agonizing pain) CS/CME/BioE/Biophys/BMI 279 Oct. 26, 2017 Ron Dror 1 Outline Why do we care? Fourier transforms Writing functions as sums of sinusoids The
More informationMath Methods for Polymer Physics Lecture 1: Series Representations of Functions
Math Methods for Polymer Physics ecture 1: Series Representations of Functions Series analysis is an essential tool in polymer physics and physical sciences, in general. Though other broadly speaking,
More informationPhasor mathematics. Resources and methods for learning about these subjects (list a few here, in preparation for your research):
Phasor mathematics This worksheet and all related files are licensed under the Creative Commons Attribution License, version 1.0. To view a copy of this license, visit http://creativecommons.org/licenses/by/1.0/,
More informationMATH 1040 Objectives List
MATH 1040 Objectives List Textbook: Calculus, Early Transcendentals, 7th edition, James Stewart Students should expect test questions that require synthesis of these objectives. Unit 1 WebAssign problems
More information7 PDES, FOURIER SERIES AND TRANSFORMS Last Updated: July 16, 2012
Problem List 7.1 Fourier series expansion of absolute value function 7.2 Fourier series expansion of step function 7.3 Orthogonality of functions 7.4 Fourier transform of sinusoidal pulse 7.5 Introducing
More informationTheory and Problems of Signals and Systems
SCHAUM'S OUTLINES OF Theory and Problems of Signals and Systems HWEI P. HSU is Professor of Electrical Engineering at Fairleigh Dickinson University. He received his B.S. from National Taiwan University
More information10. Operators and the Exponential Response Formula
52 10. Operators and the Exponential Response Formula 10.1. Operators. Operators are to functions as functions are to numbers. An operator takes a function, does something to it, and returns this modified
More informationf = 1 T 6 a.c. (Alternating Current) Circuits Most signals of interest in electronics are periodic : they repeat regularly as a function of time.
Analogue Electronics (Aero).66 66 Analogue Electronics (Aero) 6.66 6 a.c. (Alternating Current) Circuits Most signals of interest in electronics are periodic : they repeat regularly as a function of time.
More informationimin...
Pulsar Timing For a detailed look at pulsar timing and other pulsar observing techniques, see the Handbook of Pulsar Astronomy by Duncan Lorimer and Michael Kramer. Pulsars are intrinsically interesting
More informationSYLLABUS. COURSE DESCRIPTION (Course information, basic description, general information, teaching overview, required equipment and preparation, etc.
Faculty of Medicine Course title: Medical Physics and Biophysics Course coordinator: Collaborators: Slaven Jurković, PhD, Assistant Professor Diana Mance, PhD, Senior Assistant Study program: Integrated
More information27. The pole diagram and the Laplace transform
124 27. The pole diagram and the Laplace transform When working with the Laplace transform, it is best to think of the variable s in F (s) as ranging over the complex numbers. In the first section below
More information