Nanoparticle Ligand Exchange and Its Effects at the Nanoparticle-Cell

Transcription

1 Supporting Information Nanoparticle Ligand Exchange and Its Effects at the Nanoparticle-Cell Membrane Interface Xinyi Wang,,, Xiaofeng Wang, Xuan Bai, Liang Yan, Tao Liu, Mingzhe Wang, Youtao Song, Guoqing Hu, Zhanjun Gu, Qing Miao, Chunying Chen *, CAS Key Laboratory for Biomedical Effects of Nanomaterials and Nanosafety, &CAS Center for Excellence in Nanoscience, National Center for Nanoscienceand Technology of China, and University of Chinese Academy of Sciences, Beijing , China; College of Sciences, Shenyang Agricultural University, Shenyang , China; College of Environment, Liaoning University, Shenyang , China; CAS Key Laboratory for Biomedical Effects of Nanomaterials and Nanosafety, Institute of High Energy Physics, Chinese Academy of Sciences (CAS), and University of Chinese Academy of Sciences, Beijing , China; The State Key Laboratory of Nonlinear Mechanics (LNM), Institute of Mechanics, Chinese Academy of Sciences, and University of Chinese Academy of Sciences, Beijing , China *Correspondence author: Prof. Chunying Chen National Center for Nanoscience and Technology, Chinese Academy of Science No.11 Beiyitiao, Zhongguancun, Beijing , China Phone: , Fax: S1

2 Methods Materials. Chloroauric acid (HAuCl 4), trisodium citrate, 11-mercaptoundecanoic acid, and ethylenediamine were purchased from Alfa Chemical (UK). N-hydroxysuccinimide, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and bovine serum albumin (BSA) were obtained from Sigma-Aldrich (Shanghai, China). Thiol PEG methoxyl (MW 2000), thiol PEG carboxylic acid (MW 2000), thiol PEG amine (MW 2000) were from Jenkem, Ltd. (Beijing, China).1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-dioleoyl-sn-glycero -3-phosphocholine (DOPC), 1,2-dioleoyl-sn-glycero-3-[phospho-l-serine] (DOPS) and 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC) lipids were from Avanti Polar Lipids, Inc. (USA). Methyl-β-cyclodextrin (MβCD), sucrose and phenylarsine oxide (PAO) were from Beijing Chemical Plant (Beijing, China). Nystatin and EIPA were from Sigma-Aldrich (Shanghai, China). All nucleotides were synthesized by Sangon Biotechnology Co., Ltd. (Shanghai, China). Detailed information about the sequences used in this study can be found in the supporting information (Table S2). A549 cells (a human lung carcinoma cell line) were obtained from the American Type Culture Collection (ATCC, USA). RPMI-1640 culture media, penicillin-streptomycin and fetal bovine serum (FBS) were from GIBCO, Invitrogen Corp. (Carlsbad, CA, USA). Cell culture plates and transwells (12 wells and 24 wells) were supplied from Corning Costar (Cambridge, MA). The CytoTox-ONE Homogeneous Membrane Integrity Assay kit (LDH) was from Promega Corp. (Madison, WI, USA). All chemicals were of reagent grade. Milli-Q grade (>18 MΩ) water with ultraviolet sterilization was used throughout the experiment. Preparation and modification of AuNPs. Gold nanoparticles (AuNPs) were synthesized by the citrate reduction of HAuCl 41. Briefly, 100 ml 1mM HAuCl 4 aqueous solution was heated to reflux with stirring. 10mL 38.8 mm trisodium citrate solution was then added. The color of the system changed from pale yellow to dark red within 1 min. The system was allowed to reflux for another 15 min, cooled to room temperature, and subsequently filtered through a 0.22 mm membrane. The characteristic plasmon absorbance band is located at about 519 nm (Fig. S2). The primary particle size, as determined by TEM, was ~13 nm (Fig. S1). The molar concentration of AuNPs was about 15 nm (180 µg/ml) 2. For the preparation of AuNPs modified with 11-mercaptoundecanoic acid (AuNP-S-C 11OOH), citrate-protected AuNPs (Cit-AuNPs) were mixed with an excess of 11-mercaptoundecanoic acid which was dissolved in ethanol; the volume of the ethanol was less than 30% of the final volume. The mixture was allowed to react overnight at room temperature. The free 11-mercaptoundecanoic acid in solution were removed by centrifugation at 13,000 xg for 30 min, then the pellet was resuspended in water to obtain a AuNP-S-C 11OOH. For the modification of AuNP with amine groups, the COOH groups on the AuNP-S-C 11OOH surface, prepared as above, were activated using EDC/NHS over 15 min at room temperature. Next, the AuNP-S-C 11OOH with activated COOH groups was reacted with excess ethanediamine for 30 min at room temperature to yield NH 2 group-terminal AuNPs (AuNP-S-C 11ONHC 2NH 2). The AuNP-S-C 11ONHC 2NH 2 was harvested by centrifugation to separate it from the excess ethanediamine as described above. PEG-coated AuNPs with terminal -COOH, -NH 2 and -OCH 3 were prepared through the bonding action of Au-S. Excess SH-PEG-COOH, SH-PEG-NH 2, or SH-PEG-OCH 3 in aqueous solution was mixed with a Cit-AuNP solution and incubated overnight at room temperature. The S2

3 mixtures were then centrifuged at 13,000 g for 30 min to remove the free PEG chemicals to obtain AuNP-S-PEG-COOH, AuNP-S-PEG-NH 2 and AuNPs-S-PEG-OCH 3. The non-covalent modification of AuNPs with oligonucleotides was performed as described previously. 3,4 Briefly, excess ssdna was mixed with a Cit-AuNP solution and incubated overnight at room temperature. The mixtures were then centrifuged at 13,000 xg for 30 min before use. The ssdna spontaneously bound to the AuNPs, and no aggregation occurred in the presence of 150 mm NaCl. The solution retained its original red color. Thiol-DNA-functionalized AuNPs were prepared according to the literature with slight modifications 1. It was necessary to add TCEP to activate the thiol-modified DNA. Thiol-modified ssdna was incubated in a TCEP solution (100-fold molar excess) at room temperature for 1 h. Next, the TCEP-treated thiol-modified ssd- NA was mixed with Cit-AuNP solution, at a 500-fold molar excess, and left in the dark at room temperature for at least 16 h. A concentrated NaCl solution was added dropwise to the above mixture to a final concentration of 100 mm, and the mixture was stored in the dark for another 24 h. The mixtures were then centrifuged at 13,000 xg for 30 min before use. For the preparation of the AuNP@BSA complexes, Cit-AuNPs (180 µg/ml, 10 ml) were incubated with 1 mg/ml of BSA for 1 h at 37 C to allow corona formation, and then centrifuged at 13,000 xg for 30 min. The supernatant was discarded and the pellet was re-suspended in PBS and washed a second time in PBS. The characteristic plasmon absorbance bands of AuNPs with various ligands were obtained with a Hitachi U-3010 spectrophotometer (Hitachi, Japan). Determination of the NP hydrodynamic diameter distributions was carried out in water with DLS measurements, employing a Zetasizer Nano ZS apparatus (Worcestershire, UK) at a nanoparticle concentration of 100 μg/ml. The zeta potential was also measured with the Zetasizer Nano ZS using water as the solvent. DLS and zeta potential measurements were the average of at least 3 replicates. QCM-D monitoring of SLB formation on a silicon oxide substrate 5. First, liposomes were prepared by dissolving neutral POPC, negatively charged DOPC/DOPS, or positively charged DOPC/DOEPC lipids in chloroform, removing the solvent to produce a lipid film. The resulting lipid film was dried fully and re-dispersed in water to prepare the vesicles suspension. The next key step was to form small unilamellar vesicles (SUVs), which can be achieved by extrusion of the vesicles using a Mini-Extruder (Avanti Polar Lipids), according to the manufacturer's instructions. The size of the resulting liposomes was ~100 nm, as measured by DLS. The final step in preparing the SLBs was surface-mediated vesicle fusion on a silicon oxide substrate. After the baseline buffer measurement stabilized, the vesicles (0.1 mg/ml) were injected at a flow rate of 150 µl/min, leading to a rapid adsorption and formation of SLBs on the substrate, which corresponded to a frequency decrease and dissipation increase at all overtones (n = 3, 5 and 7). Finally, the bilayer was washed with Tris/NaCl buffer (10 mm Tris, 150 mm NaCl, ph 7.0) at a flow rate of 150 μl/min for 10 min and the frequency and dissipation values monitored to be sure they stabilized. For the formation of negatively charged SLBs (DOPC/DOPS), the bilayer was washed with Tris/NaCl (10 mm Tris, 250 mm NaCl, ph 7.0). QCM-D monitoring of the interaction between different SLBs and AuNPs with various ligands. Once the signals had stabilized, the AuNP solution was injected at a flow rate of 20 μl/min until the signals smoothed out. The values of ΔF were used to scale the mass of NPs adsorbed on- S3

4 to the SLBs. It was important for the reacting buffer system (diluting the NPs) to be the same as the one used in the last stabilized signals AFM observation of the interaction of AuNPs with SLBs. The zwitterionic SLBs were prepared on a mica surface for POPC and DOPC/DOEPC SLBs, and on a silicon oxide substrate surface of for DOPC/DOPS SLBs. To promote individual vesicle rupture and formation of complete SLBs with minimal defects, a Tris buffer with 250 mm NaCl, instead of 150 mm NaCl, was used to increase the osmotic pressure and rupture the vesicles. Images of the samples were obtained by use of a commercial AFM microscope (MultiMode 8-HR; Bruker, Germany) in contact mode, using SNL-10 probes. The scan size chosen was 10 μm for overview images to identify the adsorption of AuNPs on the SLBs. High-resolution images with a scan size between 0.2 and 2 μm were then recorded to identify the details. The images were processed using NanoScope Analysis software (Bruker Corporation). ATR-FTIR spectroscopy. ATR-FTIR spectra were recorded on a Perkin Elmer Spectrum OneB FTIR spectrometer equipped with a zinc selenide (ZnSe) attenuated total reflection (ATR) accessory. A ~20 μl of aliquot of centrifuged AuNP solution was deposited onto the surface of the germanium crystal and dried under nitrogen gas. After a dried sample film formed on the surface of the crystal, the sample spectra were collected at cm -1 for 128 scans with a resolution of 1 cm 1. The purified Cit-AuNPs were prepared by centrifugation at ph 9. Under the basic condition, the hydrogen bonding between adsorbed citrates and excess citrate species were interrupted due to the deprotonation of the carboxylic acid groups. Thus, the resulting IR spectra originated homogeneously from citrate species coordinated directly with the surface of AuNP. X-ray photoelectron spectroscopy (XPS). XPS measurements were performed using a Thermo Instrument ESCALAB250Xi surface analysis system under ultrahigh vacuum conditions with an Al Kα X-ray source ( ev). Briefly, A drop-cast film of the Cit-AuNPs or the mixture of Cit-AuNPs and POPC liposomes were prepared on a piranha-cleaned silicon wafer, and the dense coverage of the sample film was assured based on the absence of Si peaks. Survey spectra were recorded with a pass energy of 150 ev and 1 ev steps, and high-resolution spectra were recorded with a pass energy of 30 ev and 0.05 ev steps for the distinct elements (Au 4f and 4d, O 1s, C 1s). Dissipative particle dynamics (DPD) simulation. The lipid used in the simulations was adopted by the H 3(T 5) 2 lipid model developed by Groot and Rabone, which consists of three hydrophilic head beads (H) and two hydrophobic tails with five hydrophobic beads (T) each. 6 Within a lipid molecule, all the neighboring beads were connected with a harmonic spring potential and three adjacent three were constrained by a harmonic potential, as adopted from previous works 7, lipids were placed on a hydrophilic substrate (S) to form a flat supported bilayer in the water. (Note that the water beads (B) are not shown in the images for clarity.) The AuNP was formed by particle beads (P) arranged on an fcc lattice with a diameter d =12r c at a bead density ρ=3. The adsorbed citrates on the AuNP were coarse-grained, as previously shown, to four beads for each three adsorbed citrates. The bead types were divided into two categories: adsorbed beads (C adsorbed) and unabsorbed beads (C unadsorbed) 9. The PEG polymer used in our simulations was coarse-grained into a straight chain with 8 PEG beads (P). The repulsive parameters a ij between the beads in our S4

5 simulations are summarized in Table S3. The simulations were performed in the NVT ensembles with the time step taken as 0.01 and carried out using the LAMMPS package 10. Molecular Dynamics (MD) Simulations. For each corresponding experiment, a spherical Au cluster with a radius of 65 Å was held together by the VDW interactions between each Au atom in the MD simulation. In fact, only the lower part of the spherical surface of an AuNP, with a height of 33 Å, was used to perform the MD simulation. The ssdna strands comprising T8 (22 strands), T12 (15 strands), T15 (12 strands) or T18 (10 strands), were coated uniformly on the surface of AuNPs. The AuNP coated with ssdna strands was put into the a simulation box of Å, and then solvated with the TIP3P water model 11. Requisite numbers of sodium ions were then added to neutralize the system. All simulations were performed using the Gromacs 5 program. The interaction of ssdna was described by the Charmm36 force field 12. The particle-mesh Ewald (PME) method was employed to account for long-range electrostatic interactions 13, where a typical 12 Å cutoff distance was applied to the calculations of short-range electrostatic and VDW energies. Standard periodic boundary conditions were applied throughout all simulations, which evolved with a time step of 2 fs. After 2,000 steps of steep energy minimization, the ions and solvent were relaxed in a 2 ns simulation wherein the positions of the heavy atoms of the ssdna were restrained. The subsequent production runs were at least 150 ns. All MD simulations were performed in the NPT ensemble at 1 bar and 300 K; the pressure and temperature of the system were maintained using the Parrinello Rahman barostat 14 and the velocity rescaling thermostat. All simulation snapshots were rendered in the VMD program. Cell culture. A549 cells (under passage 50) were cultured in RPMI 1640 medium supplied with 10% FBS and 1% penicillin-streptomycin, and maintained in a humidified atmosphere containing 5% CO 2 at 37 C in 25 cm 2 plastic flasks. Cells were passaged at 70%-90% confluence using 0.25% (w/v) trypsin containing 0.02% (w/v) ethylene diamine tetraacetic acid (EDTA) solution. Before each experiment, cells were counted and re-suspended in an appropriate volume of medium to obtain the required cell density. Observation of cell morphology using an environmental scanning electron microscope (ESEM). A549 cells were seeded onto glass slides and grown to about 70% confluence. The cells were then exposed to either cell culture medium without FBS, as a control, or AuNPs with different ligands for another 6 h incubation. After fixation with 2.5% glutaraldehyde (v/v) and post-fixation with 1% osmic acid, the cells were dehydrated with graded ethanol solutions (15 min incubation each in 30%, 50%, 60%, 70%, 80%, 90%, 95%, and 100%), and dried with a critical point drier. Finally, the specimens were observed using an ESEM (Quanta 200 FEG, FEI Co.) with magnification of 5,000 and 20,000 times using low-vacuum mode. Cell imaging using a transmission electron microscope (TEM). The A549 cells were seeded onto transwell filters (aperture, 3 μm; diameter, 6.5 mm) at a density of cells per well and were allowed to grow for 24 hours. After incubation with various ligand-modified AuNPs, the cells were washed twice with PBS and then fixed in 2.5% glutaraldehyde overnight. Cells were washed again and post-fixed in 1% osmium tetroxide. The cell sample was then dehydrated through a series of alcohol concentrations and embedded in Epon together with the transwell fil- S5

6 ters. The cells and filter were cut into 80 nm-thick slices and observed by TEM (Hitachi) at 80 kv at the desired magnification. ICP-MS detection of cellular uptake. Cellular uptake of AuPNs with various ligands was quantitatively detected by ICP-MS (NexlON 300X, Perkin Elmer, USA). A549 cells were grown in 6-well microplates to reach 90% confluence and incubated with 6-24 µg/ml AuNPs, with various ligands, dispersed in RPMI 1640 medium without FBS at 37 C for 6 hours. The cells were then washed (with cold PBS, three times), trypsinized, and centrifuged to obtain the precipitates. The cell pellets were then digested in nitric acid (Optima TM grade [Fisher Chemical], 70%) overnight, evaporated, and treated with aqua regia to dissolve the AuNPs. Once the solutions became transparent, their volumes were measured and the solutions analyzed by ICP-MS to measure the content of gold atoms per cell. The data are presented as the mean ± S.D. of three independent measurements. Investigation of the endocytosis pathways. The endocytosis pathway of each NP was investigated using specific pharmacological inhibitors for each specific cellular uptake pathway at the concentrations given in Table S4. A549 cells grown on a 6-well miroplates were pre-incubated with various inhibitors for 30 min at 37 C before the addition of NPs. Next, various NPs, at the desired concentrations, were added and incubated another 6 hours. Finally, the cells were collected by trypsinization, rinsed by PBS at least 3 times, and uptake analysis was performed using ICP-MS as described above. All experiments were performed in triplicate, and cells without added inhibitors were used as controls. S6

7 Figure S1. TEM images of AuNPs with various ligands. The images show that the average diameter of Cit-AuNPs was 12.9±1.2 nm (n=100), and the modification of ligand molecules did not change the dispersion of the NPs. S7

8 Absorbance Wavelength (nm) Cit-AuNPs AuNP-S-C11OOH AuNP-S-C11NH2 AuNP-S-PEG-COOH AuNP-S-PEG-NH2 AuNP-S-PEG-CHO AuNP-S-T8 AuNP-S-T18 AuNP-S-P36 Figure S2. The plasmon absorption spectra of AuNPs with various ligands. S8

9 Figure S3. Structural formula of phospholipids used in QCM-D sensing. (a) 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC); (b)1,2-dioleoyl-sn-glycero -3-phosphocholine (DOPC); (c) 1,2-dioleoyl-sn-glycero-3-[phospho-l-serine] (DOPS); (d) 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC) S9

10 Figure S4. QCM-D monitoring of various SLB formations on a silicon oxide substrate through surface-mediated vesicle fusion. (a) Schematic presentation of QCM-D monitoring principles. After the buffer measurement stabilized, the following vesicle solutions (0.1 mg/ml) were injected: POPC (b), 8:2 DOPC:DOPS (c) and 8:2 DOPC:DOEPC (d), followed by the adsorption of vesicles onto the substrate, rupture and formation of SLBs. All data were measured at the third overtone. S10

11 Figure S5. QCM-D monitoring interactions of different ligand-modified AuNPs with differently-charged SLBs on a silica coated quartz crystal sensor. From a to l, the graphs show the results for AuNP-S-C 11OOH( ), AuNP-S-C 11ONHC 2NH 2(+), AuNP-S-PEG-CH 3O, AuNP-S-PEG-COOH( ), AuNP-S-PEG-NH 2(+), AuNP-S-P36( ), AuNP@BSA( ), Cit-AuNPs( ), AuNP@T8( ), AuNP@T18( ), AuNP-S-T8( ), and AuNP-S-T18( ), respectively. All nanoparticle concentrations were 100 µg/ml. Black, red and blue lines denoted interactions of AuNPs with DOPC/DOPS( ), POPC and DOPC/DOEPC(+) SLBs, respectively. S11

12 Frequency (Hz) a Frequency (Hz) Figure S6. The adsorption isotherm of Cit-AuNPs( ) onto POPC bilayers monitored by QCM-D (ΔF signal). (a) The adsorption of Cit-AuNPs ( ) with various concentrations onto POPC bilayers as monitored by QCM-D. (b) The plot of the ΔF signal vs. the bulk concentration of Cit-AuNPs( ), and the red solid curve through the data is the fit to an isotherm. Each data point represents the average of three measurements and the error bars are the standard deviations from those measurements Cit-AuNPs ( g/ml) Time (h) b Concentration (nm) a Frequency (Hz) AuNP-SH-PEG-COOH ( g/ml) Time (h) b Frequency (Hz) Concentration (nm) Figure S7. The adsorption isotherm of AuNP-S-PEG-COOH( ) onto POPC bilayers as monitored by QCM-D (ΔF signal). (a) The adsorption of AuNP-S-PEG-COOH ( ) at various concentrations onto POPC bilayers as monitored by QCM-D. (b) The plot of the ΔF signal vs. the bulk concentration of AuNP-S-PEG-COOH ( ), and the red solid curve through the data is the fit to an isotherm. Each data point represents the average of three measurements and the error bars are the standard deviations from those measurements. S12

13 Figure S8. ATR-IR spectra of Cit-AuNPs and pure trisodium citrate. Figure S9. ATR-IR spectra of dried POPC liposomes. S13

14 Figure S10. XPS spectra of the C 1s binding energy of pure trisodium citrate (a) and the POPC species (b). Figure S11. XPS spectra of the O 1s binding energy of pure trisodium citrate (a) and the POPC species (b). S14

15 Figure S12. A configuration unit of the citrate bilayer consisting of two adsorbed and one dangling species. The adsorbed anions were hydrogen-bonded with adjacent adsorbed anions through formation of acyclic COOH dimers. Figure S13. Coarse-grained molecular dynamics simulations using the DPD technique for time evolution of the interaction between the POPC SLBs and Cit-AuNPs with a 46% coverage of citrates. S15

16 Relative cellular uptake (%) Figure S14. TEM images of the cellular ultrastructures treated with 18 µg/ml AuNP-S-PEG-COOH for 6 h. (a) An entire A549 cell. (b) and (c) Higher magnification of the regions in panel a denoted by the red circles and corresponding red Roman numerals of microvilli (I) and a lysosome (II) Control M CD Nystatin HS PAO EIPA 20 Au@T18 AuNP-S-T18 AuNP@BSA AuNP-S-PEG-COOH Figure S15. Endocytosis pathways of AuNPs with different ligands at the concentration of 18 μg/ml in A549 cells, measured by ICP-MS. The incubation of cells with only AuNPs without inhibitors served as the control, set to 100%. S16

17 Figure S16. Schematic description of interaction potentials between ligand-adsorbed AuNPs and SLBs. (a) Representation of the interface between a ligand-coated nanoparticle and alipid bilayer. (b) Forces at the nano membrane interface. The involved long-range and short-range forces often intertwine and interact simultaneously or following on one another in some systematic order in space and/or time. S17

18 30ns 40ns 50n 60ns 70ns Figure S17. Representative snapshots from state trajectories at different time points as Cit-AuNPs approach the neutral POPC bilayers, based on MD simulation. Herein, a steered molecular simulation method with a constant velocity was used. Specifically, a spherical Au cluster with a radius of 65 Å was assembled, maintained by VDW interactions between the Au atoms. The lower part of the spherical surface of the AuNP with a height of 33 Å, coated by 89 citric acid molecules was used to perform the MD simulation. The phospholipid bilayer membrane was constructed of 578 POPC molecules and located initially at 40 Å below the AuNP surface. During the approach process, the Cit-AuNP was given a constant speed of Å/ps. S18

19 0ns 10ns 20ns 30ns 40ns 50ns 60ns 70ns Figure S18. Representative snapshots of state trajectories at the indicated time points as approaches the neutral POPC bilayers, based on MD simulations. Herein, a steered molecular simulation method with a constant velocity was performed. Specifically, a spherical Au cluster with a radius of 65 Å was assembled, maintained by VDW interactions between the Au atoms. The lower part of the spherical surface of the AuNP, with a height of 33 Å and coated with 22 T8 strands, was selected to perform the MD simulation. The phospholipid bilayer membrane was constructed of 578 POPC molecules and located initially at 40 Å below the AuNP surface. During the approach, AuNP@T8 was given a constant speed of Å/ps. All simulations were performed using the Gromacs 5 program (at least 150 ns) and all simulation images were rendered using the VMD program. S19

20 Table S1. The hydrodynamic sizes and zeta potentials of AuNPs with various ligands. Ligand-NPs DLS(size) Zeta potential PDI Cit-AuNPs 19.2 ± ± ± 0.01 AuNP-S-C 11OOH 21.9 ± ± ± 0.05 AuNP-S-C 11ONHC 2NH ± ± ± 0.02 AuNP-S-PEG-COOH 27.8 ± ± ± 0.01 AuNP-S-PEG-NH ± ± ± 0.01 AuNP-S-PEG-OCH ± ± ± 0.03 AuNP@T ± ± ± 0.06 AuNP-S-T ± ± ± 0.04 AuNP@T ± ± ± 0.03 AuNP-S-T ± ± ± 0.04 AuNP-S-P ± ± ± 0.05 AuNP@BSA 30.3 ± ± ± 0.01 T8, T18, SH-T8, SH-T18 and SH-P36 are the ssdna strands listed in Table S2. Table S2. The interaction parameter ( a ij ) between beads i and j. a ij W H T C adsorbed C unadsorbed Au S P W H T C adsorbed / C unadsorbed / Au S P / / W, H, T, C adsorbed, C unadsorbed, Au, S and P represent the water, lipid head, lipid tail, adsorbed citrate, unadsorbed citrate, AuNP, substrate and PEG beads, respectively. S20

21 Table S3. Sequences of oligonucleotides used. Name Sequences (5 'to 3') Modification T8 TTTTTTTT T12 TTTTTTTTTTTT T15 TTTTTTTTTTTTTTT T18 TTTTTTTTTTTTTTTTTT SH-T8 TTTTTTTT 5'-SH SH-T12 TTTTTTTTTTTT 5'-SH SH-T15 TTTTTTTTTTTTTTT 5'-SH SH-T18 TTTTTTTTTTTTTTTTTT 5'-SH SH-P36 TCTTGCAGCTACATGCCTACTTACCACCTACTCTCC 5'-SH FAM-T8 TTTTTTTT 5'-FAM FAM -T12 TTTTTTTTTTTT 5'-FAM FAM -T15 TTTTTTTTTTTTTTT 5'-FAM FAM -T18 TTTTTTTTTTTTTTTTTT 5'-FAM Table S4. Inhibitors and their concentrations used in uptake pathway experiments. Inhibitors Final concentration Function MβCD 8 mm Inhibitor of lipid raft/caveolae-dependent endocytosis by depleting cholesterol 15 Nystatin 30 µm Inhibitor of lipid raft/caveolae-dependent endocytosis as a cholesterol sequestering agent 15 Hypertonic Sucrose 0.4 M Inhibitor of clathrin-mediated endocytosis (CME) by K + depletion 16 PAO 20 µm Inhibitor of clathrin-mediated endocytosis (CME) by interacting with vicinal dithiol-containing molecules EIPA 20 µm Macropinocytosis inhibitor by blocking Nat/H + ion channel 17 S21

22 References (1) Liu, J.; Lu, Y. Nat. Protoc. 2006, 1, (2) Xu, X. H. N.; Huang, S.; Brownlow, W.; Salaita, K.; Jeffers, R. B. J. Phys. Chem. B 2004, 108, (3) Li, H. X.; Rothberg, L. Proc. Natl. Acad. Sci. USA 2004, 101, (4) Xia, F.; Zuo, X. L.; Yang, R. Q.; Xiao, Y.; Kang, D.; Vallee-Belisle, A.; Gong, X.; Yuen, J. D.; Hsu, B. B. Y.; Heeger, A. J.; Plaxco, K. W. Proc. Natl. Acad. Sci. USA 2010, 107, (5) Cho, N. J.; Frank, C. W.; Kasemo, B.; Hook, F. Nat. Protoc. 2010, 5, (6) Groot, R. D.; Rabone, K. L. Biophys. J. 2001, 81, (7) Li, Y.; Yuan, H.; von dem Bussche, A.; Creighton, M.; Hurt, R. H.; Kane, A. B.; Gao, H. Proc. Natl. Acad. Sci. USA 2013, 110, (8) Li, Y.; Kroger, M.; Liu, W. K. Biomaterials 2014, 35, (9) Park, J.-W.; Shumaker-Parry, J. S. J. Am. Chem. Soc. 2014, 136, (10) Plimpton, S. J. Comput. Phys. 1995, 117, (11) Jorgensen, W. L.; Chandrasekhar, J.; Madura, J. D.; Impey, R. W.; Klein, M. L. J. Chem. Phys. 1983, 79, (12) Best, R. B.; Zhu, X.; Shim, J.; Lopes, P. E. M.; Mittal, J.; Feig, M.; MacKerell, A. D., Jr. J. Chem. Theory Comput. 2012, 8, (13) Darden, T.; York, D.; Pedersen, L. J. Chem. Phys. 1993, 98, (14) Parrinello, M.; Rahman, A. J. App. Phys. 1981, 52, (15) Zhao, S. S.; Dai, W. B.; He, B.; Wang, J. C.; He, Z. G.; Zhang, X.; Zhang, Q. S22

23 Journal of Controlled Release 2012, 158, (16) Ivanov, A. I.; Nusrat, A.; Parkos, C. A. Molecular Biology of the Cell 2004, 15, (17) Raghu, H.; Sharma-Walia, N.; Veettil, M. V.; Sadagopan, S.; Chandran, B. J. Virol. 2009, 83, S23