Supplementary Table S1: Overview of the sequences used as references for phylogenetic analyses.
|
|
|
- Barry Harris
- 5 years ago
- Views:
Transcription
1 Supplementary Table S1: Overview of the sequences used as references for phylogenetic analyses. Sample ID Location GenBank accession No. Reference EF CHN China EF Cheng et al. (2006) (unpublished) GU KOR South Korea GU Cha et a. (2010) (unpublished) JN CHN China JN J. Chen et al. (2011) JQ KOR South Korea JQ Park et al. (2012) JQ KOR South Korea JQ Park et al. (2012) JQ CHN China JQ J. Chen et al. (2012) JX CHN China JX Luo et al. (2012) JX CHN China JX Fan et al. (2012) JX CHN China JX Bi et al. (2012) JX CHN China JX X. Tian et al. (2012) (direct submission) JX CHN China JX F. Chen et al. (2012) JX CHN China JX Zhou et al. (2012) JX CHN China JX Zhao et al. (2012) JX CHN China JX Wei et al. (2012) KC CHN China KC Li et al. (2013) KC CHN China KC F. Chen et al. (2012 (unpublished) KC CHN China KC X. Wang et al. (2012) (unpublished) KC CHN China KC X. M. Wang (2013) KC CHN China KC Liu et al. (2012) (direct submission) KC CHN China KC Liu et al. (2012) (direct submission) KF USA USA KF Marthaler et al. (2013) KF CHN China KF Y. Tian et al. (2013) KF USA USA KF Stevenson et al. (2013) KF CHN China KF Wan et al. (2013) (unpublished) KF USA USA KF H. Huang et al. (2013) KJ CHN China KJ Jia et al. (2014) KJ CHN China KJ Ku et al. (2014) (unpublished) KJ USA USA KJ L. Wang et al. (2014) KJ KOR South Korea KJ Choi et al. (2014) KJ USA USA KJ Vlasova et al. (2014) KJ USA USA KJ Vlasova et al. (2014) KJ USA USA KJ Vlasova et al. (2014) KJ USA USA KJ Vlasova et al. (2014) KJ USA USA KJ Vlasova et al. (2014) KJ USA USA KJ Vlasova et al. (2014) KJ USA USA KJ Vlasova et al. (2014) KJ USA USA KJ Vlasova et al. (2014) KJ MEX MEX KJ Vlasova et al. (2014) KJ USA USA KJ Vlasova et al. (2014) KJ USA USA KJ Vlasova et al. (2014) KJ USA USA KJ Vlasova et al. (2014) KJ CHN China KJ H. Zhou et al. (2014) (unpublished) KJ USA USA KJ Lawrence et al. (2014)
2 KJ VNM Vietnam KJ Vui et al. (2014) KJ VNM Vietnam KJ Vui et al. (2014) KJ VNM Vietnam KJ Vui et al. (2014) KM CAN Canada KM Pasick et al. (2014) KM CHN China KM Song et al. (2014) KM USA USA KM Oka et al. (2014) KM KOR South Korea KM Lee et al. (2014) KP UKR Ukraine KP Dastjerdi et al. (2015) (unpublished) KR BEL Belgium KR Theuns et al. (2015) KR I Italy KR Boniotti et al. (2016) L00719 Europe LM Hanke et al. (2015) L00721 Europe LM Hanke et al. (2015) NC EU Europe NC Kocherhans et al. (2001)
3 Supplementary Table S2: Nucleotide minor variants of sequenced PEDV samples. First and last base positions refer to the complete coding sequence of the respective strain. Sequence Name Nucleotide (original) Nucleotide (variant) Frequency (%) First base position Last base position First base position (with gaps) Last base position (with gaps) L00798 K11/14-02 T G L00798 K11/14-02 T G L00798 K11/14-02 G A L00798 K11/14-02 G A L00798 K11/14-02 C T L00798 K11/14-02 A T L00798 K11/14-02 C T L00798 K11/14-02 C A L00798 K11/14-02 C T L00798 K11/14-02 G A L00798 K11/14-02 T C L00798 K11/14-02 C T L00798 K11/14-02 T C L00798 K11/14-02 C T L00798 K11/14-02 T C L00798 K11/14-02 T C L00798 K11/14-02 T C L00798 K11/14-02 T G L00798 K11/14-02 C T L00798 K11/14-02 G A L00798 K11/14-02 C T L00798 K11/14-02 C A L00798 K11/14-02 C T L00798 K11/14-02 AA GT
4 L00798 K11/14-02 A T L00798 K11/14-02 A C L00798 K11/14-02 T C L00799 K11/14-01 A G L00799 K11/14-01 G A L00799 K11/14-01 T C L00799 K11/14-01 T C L00799 K11/14-01 G T L00799 K11/14-01 G T L00799 K11/14-01 C T L00799 K11/14-01 C T L00799 K11/14-01 T C L00799 K11/14-01 T C L00799 K11/14-01 G T L00799 K11/14-01 G T L00799 K11/14-01 A G L00799 K11/14-01 A G L00799 K11/14-01 T C L00799 K11/14-01 C T L00799 K11/14-01 T A L00799 K11/14-01 T C L00799 K11/14-01 A C L00799 K11/14-01 T C L00799 K11/14-01 A G L00799 K11/14-01 C T L00799 K11/14-01 T T L00799 K11/14-01 C T L00799 K11/14-01 T C L00799 K11/14-01 C T
5 L00799 K11/14-01 C T L00799 K11/14-01 C T L00799 K11/14-01 G T L00799 K11/14-01 T C L00799 K11/14-01 A G L00799 K11/14-01 T C L00799 K11/14-01 A C L00799 K11/14-01 T C L00799 K11/14-01 GT AA L00799 K11/14-01 T A L00799 K11/14-01 C A L00799 K11/14-01 C T L00857 K14/14-04 T C L00857 K14/14-04 T G L00857 K14/14-04 T C L00857 K14/14-04 C T L00857 K14/14-04 T C L00901 V215/78 - TTTTGAAAAGGTCCACGTGCAGTGATGTTTCTT GGACTTTTTCAATACACGA L00918 K17/14-01 G A L00918 K17/14-01 A G L00928 K20/14-03 T C L00928 K20/14-03 ATGCTA L00928 K20/14-03 C T L00928 K20/14-03 C T L00932 K22/14-04 T C L00932 K22/14-04 A G L00932 K22/14-04 T C L00933 K22/14-05 A G
6 L00933 K22/14-05 C T L00933 K22/14-05 G A L00933 K22/14-05 A G L01015 K01/15-05 T C L01015 K01/15-05 G A L01015 K01/15-05 C A L01015 K01/15-05 T C L01015 K01/15-05 T C L01015 K01/15-05 G T L01015 K01/15-05 G A L01015 K01/15-05 T C L01017 K01/15-07 T C L01017 K01/15-07 G A L01017 K01/15-07 C A L01017 K01/15-07 C T L01017 K01/15-07 G T L01019 K01/15-09 C T L01019 K01/15-09 T C L01019 K01/15-09 C A L01020 K01/15-10 T C L01059 K07/15-01 G T L01061 K07/15-03 C T L01061 K07/15-03 G T L01063 M10/15-02 G T L01063 M10/15-02 C A L01064 M10/15-03 T C L01065 M10/15-04 G T L01065 M10/15-04 T C L01065 M10/15-04 T G
7 L01065 M10/15-04 T C L01329 K25/15-01 T C L01329 K25/15-01 C T L01329 K25/15-01 C T L01329 K25/15-01 T C L01329 K25/15-01 G T L01420 K06/15-04 T C L01420 K06/15-04 C T L01420 K06/15-04 C T L01420 K06/15-04 T C
8 Supplementary Table S3: Overview of metagenome analysis of selected PEDV samples. Farm 1 Farm 2 Farm 3 Farm 4 Farm 5 Farm 6 Organism name (family) L00998 K06/15-03 L01060 K07/15-02 L01420 K06/15-04 L00855 K14/14-02 L00929 K22/14-01 L00918 K17/14-01 L00919 K17/14-02 L00719 L00721 L00798 K11/14-02 L00799 K11/14-01 L00906 K16/14-01 L00907 K16/14-02 L00908 K16/14-03 Acidaminococcaceae Alicyclobacillaceae Amphileptidae Astroviridae Bacillaceae Bacteroidaceae Brachyspiraceae Campylobacteraceae Carnobacteriaceae Chlamydiaceae Clostridiaceae Comamonadaceae Cordycipitaceae Coriobacteriaceae Coronaviridae Corynebacteriaceae Cryptosporidiidae Cyclobacteriaceae Dipodascaceae Enterobacteriaceae Enterococcaceae Erysipelotrichaceae Eubacteriaceae Flavobacteriaceae Fusobacteriaceae Geobacteraceae Helicobacteraceae Heliobacteriaceae Lachnospiraceae Lactobacillaceae Listeriaceae Malvaceae
9 Methanobacteriaceae Methanomassiliicoccaceae Micrococcaceae Moraxellaceae Neocallimastigaceae Oscillospiraceae Paenibacillaceae Peptococcaceae Peptoniphilaceae Peptostreptococcaceae Picobirnaviridae Picornaviridae Planococcaceae Polystomatidae Porphyromonadaceae Prevotellaceae Propionibacteriaceae Pseudomonadaceae Rhizobiaceae Rhodobacteraceae Rikenellaceae Ruminococcaceae Saccharomycetaceae Siphoviridae Spathidiidae Sphingobacteriaceae Spirochaetaceae Spiroplasmataceae Staphylococcaceae Streptococcaceae Succinivibrionaceae Suidae Thermoanaerobacteraceae Thermoanaerobacterales Family III. Incertae Sedis Veillonellaceae Vibrionaceae Xanthomonadaceae
Structural basis for amino acid recognition and transmembrane signaling by tandem-per-arnt-sim (tandem-pas) chemoreceptor sensory domains
Supporting information Volume 71 (2015) Supporting information for article: Structural basis for amino acid recognition and transmembrane signaling by tandem-per-arnt-sim (tandem-pas) chemoreceptor sensory
DETAILED RESULTS ON FUNGAL AND BACTERIAL COMMUNITIES COLONIZING THE COMPOST-INCUBATED POLYMER CARD SURFACE
DETAILED RESULTS ON FUNGAL AND BACTERIAL COMMUNITIES COLONIZING THE COMPOST-INCUBATED POLYMER CARD SURFACE PART 1: FUNGAL COMMUNITIES COLONIZING THE COMPOST-INCUBATED POLYMER CARD SURFACE Fungal OTUs richness,
4 Using other annotation sources for word clouds... 7
Raivo Kolde raivo.kolde@eesti.ee October 30, 207 Contents Introduction.............................. 2 Elements of a GOsummaries plot................. 3 Usage of GOsummaries....................... 2 3.
Bacterial profiling of White Plague Disease in a comparative coral species framework
OPEN (2014) 8, 31 39 & 2014 International Society for Microbial Ecology All rights reserved 1751-7362/14 www.nature.com/ismej ORIGINAL ARTICLE Bacterial profiling of White Plague Disease in a comparative
16S Metagenomics Report
Sample: BL-09 Report Date: 05/11/2017 18:40:20 Sample Information Sample ID: Sample Name: Run Folder: Taxonomy File: BL_09 BL_09 D:\Illumina\MiSeqAnalysis\170509_M01675_0059_000000000-AW8GB gg_13_5_species_32bp.dat
Laboratory Training and Procedures Bacteriological Techniques Sputum smear Antoine Pierson (BiolTrop)
Laboratory Training and Procedures Bacteriological Techniques Sputum smear Antoine Pierson (BiolTrop) Cocci gram positif Bacterial species Macroscopique Culture media Microscopic appearance Reference characteristics
SUPPLEMENTARY INFORMATION. Observation of tunable electrical bandgap in large-area twisted bilayer graphene synthesized by chemical vapor deposition
SUPPLEMENTARY INFORMATION Observation of tunable electrical bandgap in large-area twisted bilayer graphene synthesized by chemical vapor deposition Jing-Bo Liu 1 *, Ping-Jian Li 1 *, Yuan-Fu Chen 1, Ze-Gao
Compositional differences among female-associated and embryo-associated microbiota of the viviparous Pacific Beetle cockroach, Diploptera punctata
FEMS Microbiology Ecology, 93, 2017, fix052 doi: 10.1093/femsec/fix052 Advance Access Publication Date: 18 April 2017 Research Article RESEARCH ARTICLE Compositional differences among female-associated
Kinetically-Enhanced Polysulfide Redox Reactions by Nb2O5. Nanocrystal for High-Rate Lithium Sulfur Battery
Electronic Supplementary Material (ESI) for Energy & Environmental Science. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information (ESI) Kinetically-Enhanced Polysulfide
Supporting Information
1 Supporting Information 2 3 4 5 Automated High-Throughput Identification and Characterisation of Clinically Important Bacteria and Fungi using Rapid Evaporative Ionisation Mass Spectrometry (REIMS) 6
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information Mesoporous C-coated SnO x nanosheets
Analysis of the mouse gut microbiome using full-length. 16S rrna amplicon sequencing
Analysis of the mouse gut microbiome using full-length 16S rrna amplicon sequencing Jongoh Shin 1,, Sooin Lee 1,, Min-Jeong Go 2, Sang Yup Lee 3, Sun Chang Kim 1,4, Chul-Ho Lee 2, and Byung-Kwan Cho 1,4,*
= (, ) V λ (1) λ λ ( + + ) P = [ ( ), (1)] ( ) ( ) = ( ) ( ) ( 0 ) ( 0 ) = ( 0 ) ( 0 ) 0 ( 0 ) ( ( 0 )) ( ( 0 )) = ( ( 0 )) ( ( 0 )) ( + ( 0 )) ( + ( 0 )) = ( + ( 0 )) ( ( 0 )) P V V V V V P V P V V V
Graphene Chemical Vapor Deposition (CVD) Growth
ECE440 Nanoelectronics Graphene Chemical Vapor Deposition (CVD) Growth Zheng Yang Timeline of graphene CVD growth Exfoliation
Highly Stretchable and Transparent Thermistor Based on Self-Healing Double. Network Hydrogel
Supporting Information Highly Stretchable and Transparent Thermistor Based on Self-Healing Double Network Hydrogel Jin Wu a, Songjia Han a, Tengzhou Yang a, Zhong Li c, Zixuan Wu a, Xuchun Gui a, Kai Tao
Lotus root-like porous carbon nanofiber anchored with CoP nanoparticles as all-ph hydrogen evolution electrocatalysts
Electronic Supplementary Material Lotus root-like porous carbon nanofiber anchored with CoP nanoparticles as all-ph hydrogen evolution electrocatalysts Hengyi Lu 1, Wei Fan 2 ( ), Yunpeng Huang 1, and
Bacterial Fish Pathogens. Diseases of Farmed and Wild Fish
Bacterial Fish Pathogens Diseases of Farmed and Wild Fish B. Austin and D. A. Austin Bacterial Fish Pathogens Diseases of Farmed and Wild Fish Fourth Edition J'V'v Published in association with ^ Springer
Supplementary Information
Supplementary Information Precipitation shapes communities of arbuscular mycorrhizal fungi in Tibetan alpine steppe Jing Zhang 1, Fang Wang 1, Rongxiao Che 1, Ping Wang 2, Hanke Liu 1, Baoming Ji 2* Xiaoyong
Supporting Information
Supporting Information D Nanoporous Ag@BSA Composite Microspheres As Hydrogen Peroxide Sensor Quanwen Liu a, *, Ting Zhang b, Lili Yu c, Nengqin Jia c, Da-Peng Yang d * a School of Chemistry and Materials
Self-assembled pancake-like hexagonal tungsten oxide with ordered mesopores for supercapacitors
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2018 Electronic Supporting Information Self-assembled pancake-like hexagonal
bifunctional electrocatalyst for overall water splitting
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Hierarchical Ni/NiTiO 3 derived from NiTi LDHs: a bifunctional electrocatalyst
Electronic Supplementary Information (ESI)
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information (ESI) LiTi 2 (PO 4 ) 3 /reduced graphene oxide nanocomposite
Nanosheet-Constructed Porous BiOCl with Dominant {001} Facets for Superior Photosensitized Degradation
Electronic Supplementary Information Nanosheet-Constructed Porous BiOCl with Dominant {001} Facets for Superior Photosensitized Degradation Dong-Hong Wang, ab Gui-Qi Gao, b Yue-Wei Zhang, a Li-Sha Zhou,
Supporting Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supporting Information Ultrathin Petal-like NiAl Layered Double oxide/sulfide
Supporting Information
Supporting Information MoSe2 embedded CNT-Reduced Graphene Oxide (rgo) Composite Microsphere with Superior Sodium Ion Storage and Electrocatalytic Hydrogen Evolution Performances Gi Dae Park, Jung Hyun
Oxygen Vacancy Induced Bismuth Oxyiodide with Remarkably. Increased Visible-light Absorption and Superior Photocatalytic.
Oxygen Vacancy Induced Bismuth Oxyiodide with Remarkably Increased Visible-light Absorption and Superior Photocatalytic Performance Yongchao Huang, Haibo Li, Muhammad-Sadeeq Balogun, Wenyue Liu, Yexiang
Supporting Information. Bi-functional Catalyst with Enhanced Activity and Cycle Stability for. Rechargeable Lithium Oxygen Batteries
Supporting Information Hierarchical Mesoporous/Macroporous Perovskite La 0.5 Sr 0.5 CoO 3-x Nanotubes: a Bi-functional Catalyst with Enhanced Activity and Cycle Stability for Rechargeable Lithium Oxygen
Self-floating nanostructural Ni-NiO x /Ni foam for solar thermal water evaporation
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2019 The supporting information for Self-floating nanostructural Ni-NiO x /Ni
Phylogeographic analysis of severe fever with thrombocytopenia syndrome virus from
Phylogeographic analysis of severe fever with thrombocytopenia syndrome virus from Islands, China: implication for transmission across the ocean Yongfeng Fu 1, Shibo Li 1, Zhao Zhang 1, Suqin Man, Xueping
High Voltage Magnesium-ion Battery Enabled by Nanocluster Mg3Bi2
Supporting Information High Voltage Magnesium-ion Battery Enabled by Nanocluster Mg3Bi2 Alloy Anode in Noncorrosive Electrolyte Yi-Hong Tan,, Wei-Tang Yao,*, Tianwen Zhang, Tao Ma, Lei-Lei Lu, Fei Zhou,
A History of Chinese Science and Technology
Yongxiang Lu Editor A History of Chinese Science and Technology Volume 1 SHANGHAI UNIVERSITY PRESS fc./! A. A history of Chinese science and technology 2015 digitalisiert durch: IDS Luzern Contents Vertical
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Cation exchange MOF-derived nitrogen-doped
Deakin Research Online
Deakin Research Online This is the published version: Dewar, Meagan L., Arnould, John P. Y., Dann, Peter, Trathan, Phil, Groscolas, Rene and Smith, Stuart 2013, Interspecific variations in the gastrointestinal
Bond relaxation, electronic and magnetic behavior of 2D metals. structures Y on Li(110) surface
Bond relaxation, electronic and magnetic behavior of 2D metals structures Y on Li(11) surface Maolin Bo, a Li Lei, a Chuang Yao, a Zhongkai Huang, a Cheng Peng, a * Chang Q. Sun a,b*, a Key Laboratory
Joseph N. Paulson Mihai Pop Héctor Corrada Bravo
Metastats 2.0 An improved method and so4ware for analyzing metagenomic data Joseph N. Paulson jpaulson@umiacs.umd.edu Mihai Pop mpop@umiacs.umd.edu Héctor Corrada Bravo hcorrada@umiacs.umd.edu Abstract:
Comment on slope of nonlinear FN plot and field enhancement factor
Comment on slope of nonlinear FN plot and field enhancement factor Weiliang Wang and Zhibing Li * State Key Laboratory of Optoelectronic Materials and Technologies School of Physics and Engineering, Sun
Supporting Infromation
Supporting Infromation Transparent and Flexible Self-Charging Power Film and Its Application in Sliding-Unlock System in Touchpad Technology Jianjun Luo 1,#, Wei Tang 1,#, Feng Ru Fan 1, Chaofeng Liu 1,
Engineering of Hollow Core-Shell Interlinked Carbon Spheres for Highly Stable Lithium-Sulfur Batteries
SUPPLEMENTARY INFORMATION Engineering of Hollow Core-Shell Interlinked Carbon Spheres for Highly Stable Lithium-Sulfur Batteries Qiang Sun, Bin He, Xiang-Qian Zhang, and An-Hui Lu* State Key Laboratory
Graphene Size-dependent Modulation of Graphene Framework Contributing to Superior. Thermal Conductivity of Epoxy Composite
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2018 Graphene Size-dependent Modulation of Graphene Framework Contributing to
Multi-wind Field Output Power Prediction Method based on Energy Internet and DBPSO-LSSVM
, pp.128-133 http://dx.doi.org/1.14257/astl.16.138.27 Multi-wind Field Output Power Prediction Method based on Energy Internet and DBPSO-LSSVM *Jianlou Lou 1, Hui Cao 1, Bin Song 2, Jizhe Xiao 1 1 School
Designing a quality gain-loss function for smaller-the-better characteristic under not neglecting the linear term loss 1
Acta Technica 62 No. 2B/2017, 641650 c 2017 Institute of Thermomechanics CAS, v.v.i. Designing a quality gain-loss function for smaller-the-better characteristic under not neglecting the linear term loss
How DNA barcoding can be more effective in microalgae. identification: a case of cryptic diversity revelation in Scenedesmus
How DNA barcoding can be more effective in microalgae identification: a case of cryptic diversity revelation in Scenedesmus (Chlorophyceae) Shanmei Zou, Cong Fei, Chun Wang, Zhan Gao, Yachao Bao, Meilin
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2014 For submission to Analyst Identification and Discrimination of Binding Sites of an Organoruthenium
Large-Scale Multifunctional Electrochromic-Energy Storage Device Based on Tungsten Trioxide Monohydrate Nanosheets and Prussian White
Supporting Information Large-Scale Multifunctional Electrochromic-Energy Storage Device Based on Tungsten Trioxide Monohydrate Nanosheets and Prussian White Zhijie Bi, a,b Xiaomin Li,* a Yongbo Chen, a,b
Supporting Information
Supporting Information Flexible, Cuttable and Self-Waterproof Bending Strain Sensors Using Microcracked Gold Nanofilms@Paper Substrate Xinqin Liao, 1, Zheng Zhang, 1, Qijie Liang, 1 Qingliang Liao, 1,
Case Doc 1059 Filed 11/26/18 Entered 11/26/18 11:05:25 Desc Main Document Page 1 of 9
Document Page 1 of 9 UNITED STATES BANKRUPTCY COURT DISTRICT OF MASSACHUSETTS ) In Re: ) ) Chapter 11 ) TELEXFREE, LLC, ) Case No. 14-40987-MSH TELEXFREE, INC., ) Case No. 14-40988-MSH TELEXFREE FINANCIAL,
Cilantro microbiome before and after nonselective pre-enrichment for Salmonella using 16S rrna and metagenomic sequencing
Jarvis et al. BMC Microbiology (2015) 15:160 DOI 1186/s12866-015-0497-2 RESEARCH ARTICLE Cilantro microbiome before and after nonselective pre-enrichment for Salmonella using 16S rrna and metagenomic sequencing
Development of a GenomeTrakr Pipeline for Foodborne Viruses
Development of a GenomeTrakr Pipeline for Foodborne Viruses Zhihui Yang, David Lacher, Mark Mammel Division of Molecular Biology Office of Applied Research and Safety Assessment, CFSAN, FDA 09/27/2018
Efficient Inorganic Perovskite Light-Emitting Diodes with Polyethylene Glycol Passivated Ultrathin CsPbBr 3 Films
Supporting information Efficient Inorganic Perovskite Light-Emitting Diodes with Polyethylene Glycol Passivated Ultrathin CsPbBr 3 Films Li Song,, Xiaoyang Guo, *, Yongsheng Hu, Ying Lv, Jie Lin, Zheqin
Thickness-tunable Core-shell Nanoparticles Encapsulated in Sandwich-like Carbon
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2018 Supporting Information: Thickness-tunable Core-shell Co@Pt Nanoparticles
Electronic Supplementary Information. Composite Gel Polymer Electrolyte for Lithium-sulfur
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information Nano-SiO 2 Embedded Poly (propylene
Rh(III)-catalyzed C-H Activation and Annulation via Oxidizing Directing Group. Lei Zhang 03/23/2016 Dong Group
Rh(III)-catalyzed C-H Activation and Annulation via Oxidizing Directing Group Lei Zhang 03/23/2016 Dong Group Content 1 Alkyne involved Annulation in Hua group 2 3 4 Brief Introduction of Internal Oxidants
Flexible solid-state supercapacitors based on freestanding nitrogendoped. porous carbon nanofibers derived from electrospun
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2016 Electronic supporting information Flexible solid-state supercapacitors
Supplementary figures and tables MetaVelvet : An extension of Velvet assembler to de novo metagenome assembly from short sequence reads
Supplementary figures and tables MetaVelvet : An extension of Velvet assembler to de novo metagenome assembly from short sequence reads Toshiaki Namiki 1,2, Tsuyoshi Hachiya 1, Hideaki Tanaka 1, and Yasubumi
Hierarchical Nanocomposite by Integrating Reduced Graphene Oxide and Amorphous Carbon with Ultrafine MgO Nanocrystallites for Enhanced CO 2 Capture
Supporting Information Hierarchical Nanocomposite by Integrating Reduced Graphene Oxide and Amorphous Carbon with Ultrafine MgO Nanocrystallites for Enhanced CO 2 Capture Ping Li, and Hua Chun Zeng* Department
Structural and electronic properties of Al 7 I n (n = 1,2,3)
Chemical Physics Letters 420 (2006) 125 129 www.elsevier.com/locate/cplett Structural and electronic properties of Al 7 I n (n = 1,2,3) Shi-Hao Wei, Li Huang, M. Ji, X.G. Gong * Surface Physics Laboratory,
Supporting Information
Supporting Information Nitrogen-doped coal tar pitch based microporous carbons with superior CO 2 capture performance Dai Yu, Jun Hu, Lihui Zhou *, Jinxia Li, Jing Tang, Changjun Peng, and Honglai Liu
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Energy & Environmental Science. This journal is The Royal Society of Chemistry 2018 1 Electronic Supplementary Information High-rate solar-light photoconversion
Bimetallic Thin Film NiCo-NiCoO as Superior Bifunctional Electro- catalyst for Overall Water Splitting in Alkaline Media
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Supportting Information for Bimetallic Thin Film NiCo-NiCoO 2 @NC as Superior
Co-vacancy-rich Co 1 x S nanosheets anchored on rgo for high-efficiency oxygen evolution
Electronic Supplementary Material Co-vacancy-rich Co 1 x S nanosheets anchored on rgo for high-efficiency oxygen evolution Jiaqing Zhu 1, Zhiyu Ren 1 ( ), Shichao Du 1, Ying Xie 1, Jun Wu 1,2, Huiyuan
Leber s Hereditary Optic Neuropathy
Leber s Hereditary Optic Neuropathy Dear Editor: It is well known that the majority of Leber s hereditary optic neuropathy (LHON) cases was caused by 3 mtdna primary mutations (m.3460g A, m.11778g A, and
General Synthesis of Graphene-Supported. Bicomponent Metal Monoxides as Alternative High- Performance Li-Ion Anodes to Binary Spinel Oxides
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information (ESI) General Synthesis of Graphene-Supported
Electronic Supplementary Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Three-dimensional amorphous tungsten-doped
Supporting Information
Supporting Information Heterostructured Bi 2 S 3 -Bi 2 O 3 Nanosheets with a Built-In Electric Field for Improved Sodium Storage Wen Luo, a,b Feng Li, a Qidong Li, a Xuanpeng Wang, a Wei Yang, a Liang
Supporting Information
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2015 Supporting Information Synthesis and electrochemical properties of spherical and hollow-structured
Inexpensive Colloidal SnSb Nanoalloys as Efficient Anode Materials for Lithium- and Sodium-Ion Batteries
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2016 Supplementary Information for Inexpensive Colloidal SnSb Nanoalloys as
for highly efficient and stable corrosive-water evaporation
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information Synthesis of mesoporous Fe 3 Si aerogel
Supplementary Information
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry
Morphology-Selective Synthesis of Cu(NO3)2 2.5H2O. Micro/Nanostructures Achieved by Rational Manipulation
Electronic Supplementary Material (ESI) for CrystEngComm. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information Morphology-Selective Synthesis of Cu(NO3)2 2.5H2O Micro/Nanostructures
Quantum secret sharing based on quantum error-correcting codes
Quantum secret sharing based on quantum error-correcting codes Zhang Zu-Rong( ), Liu Wei-Tao( ), and Li Cheng-Zu( ) Department of Physics, School of Science, National University of Defense Technology,
Electronic supplementary information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2017 Electronic supplementary information Highly permeable zeolite imidazolate
Supplementary Information
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2017 Supplementary Information Supramolecular interactions via hydrogen bonding contributing to
Supporting Information
Electronic Supplementary Material (ESI) for Green Chemistry. This journal is The Royal Society of Chemistry 2019 Supporting Information Atomically dispersed Ni as the active site towards selective hydrogenation
In-Situ Fabrication of CoS and NiS Nanomaterials Anchored on. Reduced Graphene Oxide for Reversible Lithium Storage
Supporting Information In-Situ Fabrication of CoS and NiS Nanomaterials Anchored on Reduced Graphene Oxide for Reversible Lithium Storage Yingbin Tan, [a] Ming Liang, [b, c] Peili Lou, [a] Zhonghui Cui,
THE UNIVERSITY OF BRITISH COLUMBIA DEPARTMENT OF STATISTICS TECHNICAL REPORT #253 RIZVI-SOBEL SUBSET SELECTION WITH UNEQUAL SAMPLE SIZES
THE UNIVERSITY OF BRITISH COLUMBIA DEPARTMENT OF STATISTICS TECHNICAL REPORT #253 RIZVI-SOBEL SUBSET SELECTION WITH UNEQUAL SAMPLE SIZES BY CONSTANCE VAN EEDEN November 29 SECTION 3 OF THIS TECHNICAL REPORT
Superconductivity and Magnetism in (Tl,K,Rb)Fe x Se 2. Minghu Fang ( 方明虎 ) Zhejiang University, Hangzhou , China
Superconductivity and Magnetism in (Tl,K,Rb)Fe x Se 2 Minghu Fang ( 方明虎 ) Zhejiang University, Hangzhou 310027, China Email: mhfang@zju.edu.cn Thanks to my Collaborators Zhejiang University, China Hangdong
Halide-Rich Synthesized Cesium Lead Bromide Perovskite Nanocrystals for Light-Emitting Diodes with Improved Performance
Supporting Information Halide-Rich Synthesized Cesium Lead Bromide Perovskite Nanocrystals for Light-Emitting Diodes with Improved Performance Peizhao Liu,, #, Wei Chen,, #, Weigao Wang, Bing Xu, Dan Wu,
Efficient removal of typical dye and Cr(VI) reduction using N-doped
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Efficient removal of typical dye and Cr(VI) reduction using N-doped magnetic porous carbon
Supplementary Information
Supplementary Information Cytotoxicity, Hemolytic Toxicity and Mechanism of Action of Pulsatilla Saponin D and Its Synthetic Derivatives Zhong Chen a,b, Huaqing Duan a, Xiaohang Tong a, Peiling Hsu b,
A Scalable Synthesis of Few-layer MoS2. Incorporated into Hierarchical Porous Carbon. Nanosheets for High-performance Li and Na Ion
Supporting Information A Scalable Synthesis of Few-layer MoS2 Incorporated into Hierarchical Porous Carbon Nanosheets for High-performance Li and Na Ion Battery Anodes Seung-Keun Park, a,b Jeongyeon Lee,
Applications of Differential Transform Method for ENSO Model with compared ADM and VIM M. Gübeş
Applications of Differential Transform Method for ENSO Model with compared ADM and VIM M. Gübeş Department of Mathematics, Karamanoğlu Mehmetbey University, Karaman/TÜRKİYE Abstract: We consider some of
Molecular Beam Epitaxy Growth of Tetragonal FeS Film on
Molecular Beam Epitaxy Growth of Tetragonal FeS Film on SrTiO3(001) Substrate Kun Zhao( 赵琨 ) 1, Haicheng Lin( 林海城 ) 1, Wantong Huang( 黄万通 ) 1, Xiaopeng Hu( 胡小鹏 ) 1,2, Xi Chen( 陈曦 ) 1,2, Qi-Kun Xue( 薛其坤
Metal-Organic Framework Derived Iron Sulfide-Carbon Core-Shell Nanorods as a Conversion-Type Battery Material
Supporting Information Metal-Organic Framework Derived Iron Sulfide-Carbon Core-Shell Nanorods as a Conversion-Type Battery Material Wei Huang,, Shuo Li, Xianyi Cao, Chengyi Hou, Zhen Zhang, Jinkui Feng,
N, S-Containing MOF Derived Dual-Doped Mesoporous Carbon as Highly. Effective Oxygen Reduction Reaction Electrocatalyst
Electronic Supplementary Material (ESI) for Catalysis Science & Technology. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information N, S-Containing MOF Derived Dual-Doped
Supporting Information. Carbon nanofibers by pyrolysis of self-assembled perylene diimide derivative gels as supercapacitor electrode materials
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2015 Supporting Information Carbon nanofibers by pyrolysis of self-assembled
Hierarchical MoO 2 /Mo 2 C/C Hybrid Nanowires for High-Rate and. Long-Life Anodes for Lithium-Ion Batteries. Supporting Information
Supporting Information Hierarchical MoO 2 /Mo 2 C/C Hybrid Nanowires for High-Rate and Long-Life Anodes for Lithium-Ion Batteries Lichun Yang, a Xiang Li, a Yunpeng Ouyang, a Qingsheng Gao, b Liuzhang
Supporting Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2019 Supporting Information Mesoporous cobalt-iron-organic frameworks: plasma-enhanced
Supplementary Material. A Novel Near-infrared Fluorescent Probe for Detecting. Intracellular Alkaline Phosphatase and Imaging of Living.
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2019 Supplementary Material A Novel Near-infrared Fluorescent Probe for Detecting
Comparative mitogenomic analyses reveal cryptic diversity of the bryozoan Bugula neritina Linnaeus, 1758, in the Yellow Sea
Marine and Freshwater Research, 2016, 67, 1241 1252 CSIRO 2016 Supplementary material Comparative mitogenomic analyses reveal cryptic diversity of the bryozoan Bugula neritina Linnaeus, 1758, in the Yellow
2017 Source of Foreign Income Earned By Fund
2017 Source of Foreign Income Earned By Fund Putnam Emerging Markets Equity Fund EIN: 26-2670607 FYE: 08/31/2017 Statement Pursuant to 1.853-4: The fund is hereby electing to apply code section 853 for
Supporting Information. High-Performance Strain Sensors with Fish Scale-Like Graphene. Sensing Layers for Full-Range Detection of Human Motions
Supporting Information High-Performance Strain Sensors with Fish Scale-Like Graphene Sensing Layers for Full-Range Detection of Human Motions Qiang Liu, Ji Chen, Yingru Li, and Gaoquan Shi* Department
A new, high performance CuO/LiNi 0.5 Mn 1.5 O 4 lithium-ion battery
A new, high performance /LiNi 0.5 Mn 1.5 O 4 lithium-ion battery Roberta Verrelli and Jusef Hassoun Department of Chemistry, University Sapienza of Rome, Italy Attila Farkas, Timo Jacob and Bruno Scrosati
Single Plasmon Switching with n Quantum Dots System Coupled to One-Dimentional Waveguide
Single Plasmon Switching with n Quantum Dots System Coupled to One-Dimentional Waveguide Nam-Chol Kim,,* Myong-Chol Ko, Song-Jin Im, Qu-Quan Wang Department of Physics, Kim Il Sung University, Pyongyang,
Reliability-Based Microstructural Topology Design with Respect to Vibro-Acoustic Criteria
11 th World Congress on Structural and Multidisciplinary Optimisation 07 th -12 th, June 2015, Sydney Australia Reliability-Based Microstructural Topology Design with Respect to Vibro-Acoustic Criteria
Facile synthesis of accordion-like Ni-MOF superstructure for highperformance
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2016 Supplementary Information Facile synthesis of accordion-like Ni-MOF superstructure
Supporting information
Supporting information Biodegradation of phenanthrene in polycyclic aromatic hydrocarbon-contaminated wastewater revealed by coupling cultivation-dependent and -independent approaches Jibing Li,, Chunling
Department of Forensic Psychiatry, School of Medicine & Forensics, Xi'an Jiaotong University, Xi'an, China;
Title: Evaluation of genetic susceptibility of common variants in CACNA1D with schizophrenia in Han Chinese Author names and affiliations: Fanglin Guan a,e, Lu Li b, Chuchu Qiao b, Gang Chen b, Tinglin
Decreasing the Viscosity in CO 2 Capture by Amino-functionalized Ionic Liquids through the Formation of Intramolecular Hydrogen Bond
Electronic Supplementary Information Decreasing the Viscosity in CO 2 Capture by Amino-functionalized Ionic Liquids through the Formation of Intramolecular Hydrogen Bond Xiao Y. Luo, Xi Fan, Gui L. Shi,
Superconductivity at 41.0 K in the F-doped LaFeAsO 1-x F x
Superconductivity at 41.0 K in the F-doped LaFeAsO 1-x F x Wei Lu, Xiao-Li Shen, Jie Yang, Zheng-Cai Li, Wei Yi, Zhi-An Ren*, Xiao-Li Dong, Guang-Can Che, Li-Ling Sun, Fang Zhou, Zhong-Xian Zhao* National
An Explicit SOS Decomposition of A Fourth Order Four Dimensional Hankel Tensor with A Symmetric Generating Vector
arxiv:1503.03383v1 [math.oc] 8 Mar 2015 An Explicit SOS Decomposition of A Fourth Order Four Dimensional Hankel Tensor with A Symmetric Generating Vector Yannan Chen Liqun Qi Qun Wang September 25, 2018