Keeping the bees: identifying wild bees a prerequisite for conservation

Size: px
Start display at page:

Download "Keeping the bees: identifying wild bees a prerequisite for conservation"

Transcription

1 P C Y U Keeping the bees: identifying wild bees a prerequisite for conservation Agapostemon virescens

2 Outline The importance of bees Species identification and discovery through barcodes The campaign to barcode the bees of the world progress and prognosis

3

4 Bees and Our Food If the bee disappeared off the surface of the globe man would have only four years of life left attributed to Albert Einstein

5

6

7 Photos L. Mandel

8 Identification and discovery 1: Halictus ligatus in Canada & the USA

9 Is two species that are morphologically exactly the same but genetically they are very, very different

10 They are sympatric in the Piedmont region of the Appalachian mountains

11 . H. poeyi H. ligatus

12 H. townsendi H. poeyi H. ligatus

13 Identification and discovery 2: Lonchopria an example of barcoding helping us find morphological differences

14 Lonchopria (Biglossa) Lonchopria rufitorax Lonchopria rufitorax Lonchopria sp3 Lonchopria sp3 Lonchopria sp3 Lonchopria sp3 Lonchopria greyform Lonchopria sp2 5% There are at least 6 species Lonchopria sp2 Lonchopria sp2 Lonchopria zonalis Lonchopria sp1 Lonchopria sp1 Lonchopria sp1 Lonchopria sp1 Lonchopria sp1

15

16 Male mandibles and base of female metasoma modified

17

18

19

20 Identification and Discovery 3: Liphanthus 33 described species, 29 from Chile. Most barcode clusters have been examined by the expert who described 22 of the 29 Chilean species Luisa Ruz Strong sexual dimorphism Male Liphanthus sabulosus Female

21 Rhophitulus sp Liphanthus nsp1 We have > 32 barcode clusters, but only 11 of them are described species 1 Liphanthus nsp3 Liphanthus nsp3 Liphanthus nsp2 Liphanthus nsp2 Liphanthus alicahue? Liphanthus alicahue Liphanthus alicahue Liphanthus alicahue Liphanthus alicahue Liphanthus alicahue 3 2 2% Liphanthus quadrifasciatus Liphanthus nsp5 Liphanthus nsp6 6 5 Liphanthus nsp18 18 Liphanthus nsp4 4 Liphanthus nsp16 16 Liphanthus coquimbensis Liphanthus coquimbensis Liphanthus nsp15 Liphanthus nsp14 14 Liphanthus nsp14 Liphanthus nsp9 9 Liphanthus nsp17 Liphanthus nsp17 17 Liphanthus nsp19 Liphanthus nsp19 Liphanthus nsp19 Liphanthus nsp19 15 Liphanthus nsp19? Liphanthus nsp19 Liphanthus nsp19 Liphanthus nsp10 Liphanthus nsp10

22 Seemingly at least 21 undescribed species with incomplete sampling Liphanthus nsp10 10 Liphanthus nsp19 2% Liphanthus nsp10 Liphanthus chillanensis Liphanthus chillanensis Liphanthus nsp8 Liphanthus nsp8 8 Liphanthus nsp13 Liphanthus nsp13 Liphanthus nsp13 13 Liphanthus nsp13 Liphanthus nsp13 Liphanthus tarsalis Liphanthus tarsalis? Liphanthus nsp12 12 Liphanthus moldenkei Liphanthus atratus Liphanthus penai Liphanthus penai Liphanthus pilifrons Liphanthus nsp11 11 Liphanthus nsp11 Liphanthus nsp7 7 Liphanthus nsp18 19 Liphanthus nsp15 20 Liphanthus nsp15 21 Liphanthus brevicornis Liphanthus brevicornis Liphanthus sabulosus Liphanthus sabulosus Liphanthus sabulosus? Liphanthus sabulosus Liphanthus sabulosus

23 The campaign to barcode the bees of the world Inaugural Meeting Reunión Inagural Reunião Inaugural 創立総会 May 12 th 14 th Mayo, Maio, 年 5 月 日

24 Geographic Coverage of Bee Barcodes: Data as of August 30 th 2013

25

26

27 ( 90% of ~500 genera have at least one barcode ~30% of 20,077 species have at least one barcode

28 HELP? Amro Zayed We still need bees from throughout the world. Whenever there are flowers in bloom there will be bees flying: please catch us some! Just using plastic cups with soapy water inside will work.

29 PARTNERS IN FUNDING AND IN-KIND SUPPORT FUNDING The Gordon and Betty Moore Foundation, Natural Sciences and Engineering Research Council (Canada), Canada Research Chairs program, Ontario Foundation for Innovation and Genome Canada through the Ontario Genomics Institute to PDN Hebert Claudia Ratti, Sheila Dumesh, Amro Zayed, Gail Fraser for images CBOL funded the May workshop York University ASSISTANCE Sujeevan Ratnasingham (BOLD) Many workers at BIO for (diligent, careful and enthusiastic lab work) Julie Stahlhut for troubleshooting. COLLABORATORS By now, this represents almost all bee researchers worldwide.

30 Thanks for listening Photo courtesy Dr. S.F. Sakagami

Amy Driskell. Laboratories of Analytical Biology National Museum of Natural History Smithsonian Institution, Wash. DC

Amy Driskell. Laboratories of Analytical Biology National Museum of Natural History Smithsonian Institution, Wash. DC DNA Barcoding Amy Driskell Laboratories of Analytical Biology National Museum of Natural History Smithsonian Institution, Wash. DC 1 Outline 1. Barcoding in general 2. Uses & Examples 3. Barcoding Bocas

More information

Pollination of Pumpkin and Winter Squash - Thanks to Bumble Bees! Dr. Kimberly Stoner Connecticut Agricultural Experiment Station New Haven

Pollination of Pumpkin and Winter Squash - Thanks to Bumble Bees! Dr. Kimberly Stoner Connecticut Agricultural Experiment Station New Haven Pollination of Pumpkin and Winter Squash - Thanks to Bumble Bees! Dr. Kimberly Stoner Connecticut Agricultural Experiment Station New Haven Basics of Pumpkin and Squash Flowering and Pollination Separate

More information

The Pollinator Victory Garden the Bees. Dr. Kimberly Stoner Connecticut Agricultural Experiment Station New Haven

The Pollinator Victory Garden the Bees. Dr. Kimberly Stoner Connecticut Agricultural Experiment Station New Haven The Pollinator Victory Garden the Bees Dr. Kimberly Stoner Connecticut Agricultural Experiment Station New Haven CT Public Act 16-17 An Act Concerning Pollinator Health Pesticides: Certain neonicotinoid

More information

Mutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution

Mutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution Mutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution 15.2 Intro In biology, evolution refers specifically to changes in the genetic makeup of populations over time.

More information

The Origin of Species

The Origin of Species LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 24 The Origin of Species Lectures

More information

Chapter 1-Plants in Our World

Chapter 1-Plants in Our World Chapter 1-Plants in Our World Formation of earth-4.5-4.6 billion years ago Evidence of life from organic material-3.8 billion years ago Many cyanobacteria are photosynthetic, but these microscopic organisms

More information

Saturday, August 24, Speciation

Saturday, August 24, Speciation Speciation New Species Can Emerge Darwin called the first appearance of new beings on earth the mystery of mysteries. The origin of species or speciation is central to evolutionary theory because the appearance

More information

Name: Hour: Teacher: ROZEMA. Inheritance & Mutations Connected to Speciation

Name: Hour: Teacher: ROZEMA. Inheritance & Mutations Connected to Speciation Name: Hour: Teacher: ROZEMA Inheritance & Mutations Connected to Speciation Let s Review What We Already Know: What Have We Learned? Lesson 26: PI 1 (Projected Image) - Human Karyotype (image from https://en.wikipedia.org/wiki/karyotype#/media/file:nhgri_human_male_karyotype.png)

More information

A DNA Sequence 2017/12/6 1

A DNA Sequence 2017/12/6 1 A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta

More information

The Orchid s Secret By Josh Adler

The Orchid s Secret By Josh Adler The Orchid s Secret The Orchid s Secret By Josh Adler Deep in the jungles of Colombia there is a kind of flower that attracts bees with its unique perfume. The male bees store as much scent as possible

More information

Activity: Honey Bee Adaptation Grade Level: Major Emphasis: Major Curriculum Area: Related Curriculum Areas: Program Indicator: Student Outcomes:

Activity: Honey Bee Adaptation Grade Level: Major Emphasis: Major Curriculum Area: Related Curriculum Areas: Program Indicator: Student Outcomes: Activity: Honey Bee Adaptation Grade Level: Grade 5 Major Emphasis: Invertebrates and Their Environments Major Curriculum Area: Science Related Curriculum Areas: Refer to Outdoor Education Curriculum Matrix

More information

3/4/2015. Review. Phenotype

3/4/2015. Review. Phenotype Review Phenotype 1 Genes Crossing Over Frequency cn cinnabar eyes Cy curly wings L lobe eyes pr purple eyes sm smooth abdomen pr - L 9% Cy - L 33% sm - pr 19% cn - pr 2% Cy - sm 43% cn - sm 17% Polygenic

More information

Pollination, the Grand Interaction Among Flowers, Bees, Growers and Beekeepers

Pollination, the Grand Interaction Among Flowers, Bees, Growers and Beekeepers Pollination, the Grand Interaction Among Flowers, Bees, Growers and Beekeepers EASTERN KENTUCKY BEEKEEPING SCHOOL PROGRAM, January 20, 2018 Hazard Community and Technical College John A. Skinner University

More information

o Can you find any nectar? Brood? Honey? o Can you find any drones and drone cells? o Can you find the queen bee?

o Can you find any nectar? Brood? Honey? o Can you find any drones and drone cells? o Can you find the queen bee? o Can you find any nectar? Brood? Honey? o Can you find any drones and drone cells? o Can you find the queen bee? *NOTE: The queen in Observation Hive #1 has a yellow mark on her. Put the wooden panels

More information

FLOWERS AND POLLINATION. This activity introduces the relationship between flower structures and pollination.

FLOWERS AND POLLINATION. This activity introduces the relationship between flower structures and pollination. FLOWERS AND POLLINATION This activity introduces the relationship between flower structures and pollination. Objectives for Exam #1 1. Identify flower structures and match those structures to specific

More information

ADAPTATIONS LESSON PLAN

ADAPTATIONS LESSON PLAN ADAPTATIONS LESSON PLAN LESSON PLAN Adaptations Change: Life s Only Constant TEACHER INFORMATION Focus: Adaptations and evolution all organisms evolve to have different adaptations in order to survive

More information

Speciation and Patterns of Evolution

Speciation and Patterns of Evolution Speciation and Patterns of Evolution What is a species? Biologically, a species is defined as members of a population that can interbreed under natural conditions Different species are considered reproductively

More information

ADAPTATIONS LESSON PLAN

ADAPTATIONS LESSON PLAN ADAPTATIONS LESSON PLAN Change: Life s Only Constant Focus: Adaptations and evolution all organisms evolve to have different adaptations in order to survive plants included! Intended for middle and high

More information

Fostering Green Chemistry in the Auto Industry: A Michigan Perspective

Fostering Green Chemistry in the Auto Industry: A Michigan Perspective Fostering Green Chemistry in the Auto Industry: A Michigan Perspective Clinton S. Boyd (Sustainable Research Group) Carol Henry (George Washington University) 15 th Annual Green Chemistry & Engineering

More information

V Q \ = 7]Z 4IVL 126 Unit 5

V Q \ = 7]Z 4IVL 126 Unit 5 126 Unit 5 Is it cold and windy? Or is it a sunny day? Is it raining cats and dogs? Or can we go out to play? I will learn to talk about seasons and weather plant life environments caring for the earth

More information

These next few slides correspond with 23.4 in your book. Specifically follow along on page Use your book and it will help you!

These next few slides correspond with 23.4 in your book. Specifically follow along on page Use your book and it will help you! These next few slides correspond with 23.4 in your book. Specifically follow along on page 462-468. Use your book and it will help you! How does natural selection actually work? Natural selection acts

More information

Nothing in biology makes sense except in the light of evolution

Nothing in biology makes sense except in the light of evolution Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky (1900-1975) Fruit fly geneticist and founder of the modern evolutionary synthesis Organismal reproductive diversity

More information

Trade in a Long Country. Teacher and School not available. Content Area (Req.): Geography

Trade in a Long Country. Teacher and School not available. Content Area (Req.): Geography Instructional Sequence/Procedure (Req.): 1. Have students research and learn about the Four Regions of Chile. 2. Have students fill in the attached chart based on researching the four main regions of Chile

More information

Launch of the ESPON 2013 Programme. European observation network on territorial development and cohesion

Launch of the ESPON 2013 Programme. European observation network on territorial development and cohesion Launch of the ESPON 2013 Programme European observation network on territorial development and cohesion Framework conditions for the ESPON 2013 Programme Policy development in use of territorial evidence

More information

Analysis of TMT Primary Mirror Control-Structure Interaction (SPIE )

Analysis of TMT Primary Mirror Control-Structure Interaction (SPIE ) Analysis of TMT Primary Mirror Control-Structure Interaction (SPIE 7017-41) Douglas MacMynowski (Caltech) Peter Thompson (Systems Tech.) Mark Sirota (TMT Observatory) Control Problems TMT.SEN.PRE.08.046.REL01

More information

Northwestern Garter Snake (Thamnophis. ordinoides)

Northwestern Garter Snake (Thamnophis. ordinoides) Northwestern Garter Snake (Thamnophis ordinoides) Speciation I. What is a species? II. Isolating Mechanisms III. Models of Speciation Aristotle coined the term species. Genus -a group that shares generic

More information

Mutualism: Inter-specific relationship from which both species benefit

Mutualism: Inter-specific relationship from which both species benefit Mutualism Mutualism: Inter-specific relationship from which both species benefit Mutualism Symbiosis: Intimate (generally obligate) inter-specific relationships from which both partners benefit 1 Mutualism

More information

Mutualism. Mutualism. Mutualism. Early plants were probably wind pollinated and insects were predators feeding on spores, pollen or ovules

Mutualism. Mutualism. Mutualism. Early plants were probably wind pollinated and insects were predators feeding on spores, pollen or ovules Mutualism Mutualism: Inter-specific relationship from which both species benefit Mutualism Symbiosis: Intimate (generally obligate) inter-specific relationships from which both partners benefit Mutualism

More information

Evolution AP Biology

Evolution AP Biology Darwin s Theory of Evolution How do biologists use evolutionary theory to develop better flu vaccines? Theory: Evolutionary Theory: Why do we need to understand the Theory of Evolution? Charles Darwin:

More information

Glaciology Exchange (Glacio-Ex) Norwegian/Canadian/US Partnership Program

Glaciology Exchange (Glacio-Ex) Norwegian/Canadian/US Partnership Program Glaciology Exchange (Glacio-Ex) Norwegian/Canadian/US Partnership Program Luke Copland University of Ottawa, Canada Jon Ove Hagen University of Oslo, Norway Kronebreeen, Svalbard. Photo: Monica Sund The

More information

What is GIS? ESRI Canada. August 2011

What is GIS? ESRI Canada. August 2011 What is GIS? ESRI Canada August 2011 Geography Matters! Environmental Park Management Agriculture Public Utilities Health Care Emergency 911 Real Estate Marketing Environmental What are the effects of

More information

DNA Barcoding: A New Tool for Identifying Biological Specimens and Managing Species Diversity

DNA Barcoding: A New Tool for Identifying Biological Specimens and Managing Species Diversity DNA Barcoding: A New Tool for Identifying Biological Specimens and Managing Species Diversity DNA barcoding has inspired a global initiative dedicated to: Creating a library of new knowledge about species

More information

American Harris mud crab Rhithropanopeus harrisii

American Harris mud crab Rhithropanopeus harrisii American Harris mud crab Rhithropanopeus harrisii (Gould, 1841) in the Gulf of Gdańsk (southern Baltic Sea): distribution, population structure and basic physiological processes Joanna Hegele-Drywa Alien

More information

Changing Planet: Changing Mosquito Genes

Changing Planet: Changing Mosquito Genes Changing Planet: Changing Mosquito Genes Name Background As the climate changes around the globe, organisms will need to adapt in order to survive. But what does it mean to adapt? When you put on a sweater

More information

BIOL 305L Spring 2018 Laboratory Seven

BIOL 305L Spring 2018 Laboratory Seven Please print Full name clearly: BIOL 305L Spring 2018 Laboratory Seven Flowering and reproduction Introduction Flowers are not simple structures, and the diversity of flower shape, color, and fragrance

More information

Reproduction and Evolution Practice Exam

Reproduction and Evolution Practice Exam Reproduction and Evolution Practice Exam Topics: Genetic concepts from the lecture notes including; o Mitosis and Meiosis, Homologous Chromosomes, Haploid vs Diploid cells Reproductive Strategies Heaviest

More information

Pitahayas: introduction, agrotechniques and breeding

Pitahayas: introduction, agrotechniques and breeding Pitahayas: introduction, agrotechniques and breeding The French Associates Institute for Agriculture and Biotechnology of Drylands May 8 Noemi Tel-Zur The J. Blaustein Institutes for Desert Research Ben-Gurion

More information

Florida Friendly Landscapes?

Florida Friendly Landscapes? Florida Friendly Landscapes? Backyards as Habitats Ecology Concepts Ecosystem interacting network of living and non-living components Community association of different species living and interacting in

More information

Biosecurity in the new millennium: DNA barcoding provides a reliable, rapid, and cost effective method of forest pest identification

Biosecurity in the new millennium: DNA barcoding provides a reliable, rapid, and cost effective method of forest pest identification Biosecurity in the new millennium: DNA barcoding provides a reliable, rapid, and cost effective method of forest pest identification Shelley L. Ball & Karen F. Armstrong Centre for Advanced Bio-protection

More information

Bio 1M: The evolution of apes. 1 Example. 2 Patterns of evolution. Similarities and differences. History

Bio 1M: The evolution of apes. 1 Example. 2 Patterns of evolution. Similarities and differences. History Bio 1M: The evolution of apes 1 Example Humans are an example of a biological species that has evolved Possibly of interest, since many of your friends are probably humans Humans seem unique: How do they

More information

Climate Change Vulnerability Assessment for Species

Climate Change Vulnerability Assessment for Species Climate Change Vulnerability Assessment for Species SPECIES: Specify whether you are assessing the entire species or particular populations: This tool assesses the vulnerability or resilience of species

More information

PLANT BIOLOGY (PBIO) Plant Biology (PBIO) 1

PLANT BIOLOGY (PBIO) Plant Biology (PBIO) 1 Plant Biology (PBIO) 1 PLANT BIOLOGY (PBIO) PBIO 1052 How Plants Shaped Our World (LN) Description: This course is an eclectic dive into the world of plants and their influence on human society. Students

More information

Statistical Approaches to Regional Climate Models for Adaptation

Statistical Approaches to Regional Climate Models for Adaptation www.nr.no Statistical Approaches to Regional Climate Models for Adaptation SARMA Ola Haug Norsk Regnesentral and SARMA Executive Committee TRI Network kick-off, Oslo 27 28 October 2010 Outline Scientific

More information

Methodological issues in the development of accessibility measures to services: challenges and possible solutions in the Canadian context

Methodological issues in the development of accessibility measures to services: challenges and possible solutions in the Canadian context Methodological issues in the development of accessibility measures to services: challenges and possible solutions in the Canadian context Alessandro Alasia 1, Frédéric Bédard 2, and Julie Bélanger 1 (1)

More information

Faatasi Malologa (PGSC Chair) Director Department of Lands & Survey, Tuvalu

Faatasi Malologa (PGSC Chair) Director Department of Lands & Survey, Tuvalu Seventh Session of the United Nations Committee of Experts on Global Geospatial Information Management (UN-GGIM) - 31 July -4 August 2017 Faatasi Malologa (PGSC Chair) Director Department of Lands & Survey,

More information

Overview of Thirty Meter Telescope Project

Overview of Thirty Meter Telescope Project Overview of Thirty Meter Telescope Project L. Stepp November 16, 2010 TMT.TEL.PRE.10.016.REL02 1 Outline Introduction to TMT TMT site selection TMT partners Summary of TMT design TMT requirements for segments

More information

GOVERNMENT MAPPING WORKSHOP RECOVER Edmonton s Urban Wellness Plan Mapping Workshop December 4, 2017

GOVERNMENT MAPPING WORKSHOP RECOVER Edmonton s Urban Wellness Plan Mapping Workshop December 4, 2017 GOVERNMENT MAPPING WORKSHOP 12.4.17 RECOVER Edmonton s Urban Wellness Plan Mapping Workshop December 4, 2017 In July of 2017, City Council directed administration to develop RECOVER, Edmonton s Urban Wellness

More information

Evolution. Before You Read. Read to Learn

Evolution. Before You Read. Read to Learn Evolution 15 section 3 Shaping Evolutionary Theory Biology/Life Sciences 7.e Students know the conditions for Hardy-Weinberg equilibrium in a population and why these conditions are not likely to appear

More information

Peter Dutton. 28 August Halesworth& District

Peter Dutton. 28 August Halesworth& District Peter Dutton 28 August 2014 Halesworth& District Bees Hymenoptera - 150,000+ species Sawflies, Wasps, Bees, Ants, Bees - 20,000+ species Most solitary, a few social Honey Bee - The only one which produces

More information

EVOLUTION Unit 1 Part 9 (Chapter 24) Activity #13

EVOLUTION Unit 1 Part 9 (Chapter 24) Activity #13 AP BIOLOGY EVOLUTION Unit 1 Part 9 (Chapter 24) Activity #13 NAME DATE PERIOD SPECIATION SPECIATION Origin of new species SPECIES BIOLOGICAL CONCEPT Population or groups of populations whose members have

More information

Biology 8 Learning Outcomes

Biology 8 Learning Outcomes Biology 8 Learning Outcomes CELLS (Bio 8-1) I can connect the names, diagrams, and functions of organelles in a cell I know the major differences between plant and animal cells I can explain cell theory

More information

Climate Change and Plant Reproduction

Climate Change and Plant Reproduction Quantitative Trait Loci Mapping of Reproductive Traits Involved in Heat Stress Responses in Arabidopsis : Implications for Global Climate Change and Plant Reproduction Lazar Pavlovic, Greta Chiu, Jeffrey

More information

Daucus pusillus Michx. l Sarah Schumann Hort 5051 May 5, 2008

Daucus pusillus Michx.   l Sarah Schumann Hort 5051 May 5, 2008 Daucus pusillus Michx. http://www.fireflyforest.com/flowers/whites/white33.htm l Sarah Schumann Hort 5051 May 5, 2008 Taxonomy Scientific Name: Daucus pusillus Michx. Synonyms: D. montevidensis and D.

More information

Pheromones by Ellen Miller November 2015

Pheromones by Ellen Miller November 2015 Pheromones by Ellen Miller November 2015 Greek word pherein to carry Greek word hormone to stimulate A released chemical that triggers a social response in members of the same species The chemical is transmitted

More information

Special features / Articles spéciaux

Special features / Articles spéciaux DNA barcoding makes an impact on the other side of the globe Muhammad Ashfaq Special features / Articles spéciaux those found in individuals from other species (Pereira et al. 2008). A wide range of molecular

More information

Other matters: * Term paper: 11 (Monday) Nov 15 (Friday), 16, 17? Final * Wednesday, 11 December (8 11 AM)

Other matters: * Term paper: 11 (Monday) Nov 15 (Friday), 16, 17? Final * Wednesday, 11 December (8 11 AM) Nov 4-Nov 8 Nov 11-15 DNA barcoding Molecular systematics in plants (Les) Lab 8: likelihood (Garli and/or RAxML) and Bayesian analyses (Wagner in Austin) Molecular systematics in animals (Simon) (Wagner

More information

EDUCATION PROFESSIONAL APPOINTMENTS

EDUCATION PROFESSIONAL APPOINTMENTS MICHAEL DAVID MARTIN University of Arizona u Department of Entomology u PO Box 210036 u Tucson, AZ 85721 Tel: 919-357-6399 u Email: mdmartin7@gmail.com Web: http://michaelmartinevobio.wordpress.com/ EDUCATION

More information

Lesson 1 Sexual Reproduction and Meiosis

Lesson 1 Sexual Reproduction and Meiosis Lesson 1 Name Date Class A. What is sexual reproduction? 1. produces an offspring when genetic materials from two different sex cells combine. a. The female sex cell, a(n), forms in an ovary. b. The male

More information

The architecture of complexity: the structure and dynamics of complex networks.

The architecture of complexity: the structure and dynamics of complex networks. SMR.1656-36 School and Workshop on Structure and Function of Complex Networks 16-28 May 2005 ------------------------------------------------------------------------------------------------------------------------

More information

Unit 4.2a Natural Selection Study Guide

Unit 4.2a Natural Selection Study Guide Unit 4.2a Natural Selection Study Guide 7.11 Organisms and environments. The student knows that populations and species demonstrate variation and inherit many of their unique traits through gradual processes

More information

There are approximately 25,000 species of Bee in the World There are almost 4000 species of Bee in North America There are approximately 1000

There are approximately 25,000 species of Bee in the World There are almost 4000 species of Bee in North America There are approximately 1000 There are approximately 25,000 species of Bee in the World There are almost 4000 species of Bee in North America There are approximately 1000 different species of Bee in Texas There are only 7-9 species

More information

Unit 5.2. Ecogeographic Surveys - 1 -

Unit 5.2. Ecogeographic Surveys - 1 - Ecogeographic Surveys Unit 5.2 Ecogeographic Surveys - 1 - Objectives Ecogeographic Surveys - 2 - Outline Introduction Phase 1 - Project Design Phase 2 - Data Collection and Analysis Phase 3 - Product

More information

How Does Pollination Work?

How Does Pollination Work? How Does Pollination Work? What is pollination? What is pollination? Pollination the transfer of pollen from the anther of one flower to the stigma of another flower Fertilization occurs when the male

More information

The Common Ground Curriculum. Science: Biology

The Common Ground Curriculum. Science: Biology The Common Ground Curriculum Science: Biology CGC Science : Biology Defining Biology: Biology is the study of living things in their environment. This is not a static, snapshot of the living world but

More information

Chapter 5. Heredity. Table of Contents. Section 1 Mendel and His Peas. Section 2 Traits and Inheritance. Section 3 Meiosis

Chapter 5. Heredity. Table of Contents. Section 1 Mendel and His Peas. Section 2 Traits and Inheritance. Section 3 Meiosis Heredity Table of Contents Section 1 Mendel and His Peas Section 2 Traits and Inheritance Section 3 Meiosis Section 1 Mendel and His Peas Objectives Explain the relationship between traits and heredity.

More information

R E SEARCH HIGHLIGHTS

R E SEARCH HIGHLIGHTS Canada Research Chair in Urban Change and Adaptation R E SEARCH HIGHLIGHTS PANHANDLING IN WINNIPEG PROJECT: MAPPING METHODOLOGY Research Highlight No. 11 June 2007 Introduction The general methodology

More information

MOR FOSSILS TEACHERS. Making a Fossil Activity Overview BIG IDEA

MOR FOSSILS TEACHERS. Making a Fossil Activity Overview BIG IDEA Making a Fossil Activity Overview BIG IDEA OBJECTIVE BACKGROUND Not every organism that died, including dinosaurs, left behind a fossil. Explore fossilization with this activity. Students will follow a

More information

Leonid Meteor Observer in LEO: A Proposal for a University Microsatellite for the 2001 Leonids

Leonid Meteor Observer in LEO: A Proposal for a University Microsatellite for the 2001 Leonids Leonid Meteor Observer in LEO: A Proposal for a University Microsatellite for the 2001 Leonids Kazuya Yoshida* Hajime Yano** *Tohoku University **Institute of Space and Astronautical Science (ISAS) JAPAN

More information

Economic and Social Council

Economic and Social Council United Nations Economic and Social Council Distr.: General 18 July 2016 Original: English Committee of Experts on Global Geospatial Information Management Sixth session New York, 3-5 August 2016 Item 2

More information

Insect Investigations

Insect Investigations Investigative Questions What are some adaptations that insects have that help them to feed on different foods and from different parts of plants, especially flowers? Goal: Students explore the ways that

More information

DISCUSSION ITEM DEVELOPMENTS REGARDING THE THIRTY METER TELESCOPE AND THE PARTICIPATION OF THE UNIVERSITY OF CALIFORNIA EXECUTIVE SUMMARY

DISCUSSION ITEM DEVELOPMENTS REGARDING THE THIRTY METER TELESCOPE AND THE PARTICIPATION OF THE UNIVERSITY OF CALIFORNIA EXECUTIVE SUMMARY Office of the President E2 TO MEMBERS OF THE COMMITTEE ON EDUCATION POLICY: For Meeting of DISCUSSION ITEM DEVELOPMENTS REGARDING THE THIRTY METER TELESCOPE AND THE PARTICIPATION OF THE UNIVERSITY OF CALIFORNIA

More information

AP Biology Notes Outline Enduring Understanding 1.C. Big Idea 1: The process of evolution drives the diversity and unity of life.

AP Biology Notes Outline Enduring Understanding 1.C. Big Idea 1: The process of evolution drives the diversity and unity of life. AP Biology Notes Outline Enduring Understanding 1.C Big Idea 1: The process of evolution drives the diversity and unity of life. Enduring Understanding 1.C: Life continues to evolve within a changing environment.

More information

Creating an e-flora for South Africa

Creating an e-flora for South Africa SANBI POLICY DOCUMENT DIVISION: Biosystematics Research and Biodiversity Collections EFFECTIVE DATE: 1 April 2014 Compiler: Marianne le Roux & Janine Victor POLICY NUMBER: LAST AMENDED: Creating an e-flora

More information

EDUCATION AND DEGREES

EDUCATION AND DEGREES ANDREW G. MCADAM Department of Ecology and Evolutionary Biology Tel.: 831-459-4022 University of California Fax: 831-459-5353 Santa Cruz, CA 95064 USA mcadam@biology.ucsc.edu CITIZENSHIP: Canadian EDUCATION

More information

Item 17.4 of the Provisional Agenda SEVENTH SESSION OF THE GOVERNING BODY. Kigali, Rwanda, 30 October 3 November 2017

Item 17.4 of the Provisional Agenda SEVENTH SESSION OF THE GOVERNING BODY. Kigali, Rwanda, 30 October 3 November 2017 August 2017 IT/GB-7/17/25 Add.1 E Item 17.4 of the Provisional Agenda SEVENTH SESSION OF THE GOVERNING BODY Kigali, Rwanda, 30 October 3 November 2017 Report from Norway on the Management of the Svalbard

More information

Survey Protocols for Monitoring Status and Trends of Pollinators

Survey Protocols for Monitoring Status and Trends of Pollinators Survey Protocols for Monitoring Status and Trends of Pollinators This annex presents the bee monitoring protocols to be applied in the context of monitoring status and trends of pollinators in STEP sites.

More information

about GCC

about GCC about GCC Bldg 234, Flat 11, Al Barakat Street, Hail Al Janaubiyah P.O Box: 94, Postal Code: 123, Al Khaudh, Sultante of Oman Fax : +968 24543188 Mobile :+968 96666445 info@gcc-oman.com www.gcc-oman.com

More information

An Introduction to NatureServe Linking Conservation and Transportation Planning Phoenix, Arizona November 8 & 9, 2006

An Introduction to NatureServe Linking Conservation and Transportation Planning Phoenix, Arizona November 8 & 9, 2006 An Introduction to NatureServe Linking Conservation and Transportation Planning Phoenix, Arizona November 8 & 9, 2006 1 NatureServe in Brief An independent, non-profit conservation organization Provides

More information

Amy Ant. Formica Mica Grant. Dr. Sheila Grant (Mica s mom)

Amy Ant. Formica Mica Grant. Dr. Sheila Grant (Mica s mom) Dr. Sheila Grant (Mica s mom) Formica Mica Grant Amy Ant By Elisabeth Schlegel, Jessica Louton, Natasha Mehdiabadi, and Ted Schultz Illustrated by Katherine Arisumi At the Smithsonian Institution s National

More information

Microevolutionary changes show us how populations change over time. When do we know that distinctly new species have evolved?

Microevolutionary changes show us how populations change over time. When do we know that distinctly new species have evolved? Microevolutionary changes show us how populations change over time. When do we know that distinctly new species have evolved? Critical to determining the limits of a species is understanding if two populations

More information

Speciation factsheet. What is a species?

Speciation factsheet. What is a species? What is a species? A species is a group of interbreeding individuals that share a gene pool and are reproductively isolated from other species. It is impossible to determine whether two organisms are from

More information

DNA Barcoding reveals recent speciation, extreme genus-level polyphyly and cryptic species in Neotropical birds

DNA Barcoding reveals recent speciation, extreme genus-level polyphyly and cryptic species in Neotropical birds Image from Ridgely and Tudor, Field Guide to the Songbirds of South America DNA Barcoding reveals recent speciation, extreme genus-level polyphyly and cryptic species in Neotropical birds Leonardo Campagna

More information

Enabling Access to Arctic Location Based Information

Enabling Access to Arctic Location Based Information Enabling Access to Arctic Location Based Information Kevin Gallagher Arctic SDI Board Chair, United States Geological Survey Alaska Surveying and Mapping Conference, GeoJam 15 February 2017 What is Arctic

More information

RNAi Suppression of AGAMOUS-like Genes Causes Field Sterility in Populus

RNAi Suppression of AGAMOUS-like Genes Causes Field Sterility in Populus RNAi Suppression of AGAMOUS-like Genes Causes Field Sterility in Populus Haiwei Lu and Steven H. Strauss Oregon State University Forest Tree Workshop PAG XXVI, San Diego, CA, 2018 The containment issue

More information

Middle School. Teacher s Guide MICROPLANTS MAJOR SPONSOR:

Middle School. Teacher s Guide MICROPLANTS MAJOR SPONSOR: Middle School Teacher s Guide MICROPLANTS MAJOR SPONSOR: Introduction As technology continues to rapidly evolve, scientists are able to collect and store more data. Some scientists find themselves with

More information

International Dark Sky Community Annual Designation Update 2018

International Dark Sky Community Annual Designation Update 2018 International Dark Sky Community Annual Designation Update 2018 EXECUTIVE SUMMARY Bon Accord has completed and maintained the majority of schedule of projects within the original designation application

More information

Upskilling community leaders for Australian Pollinator Week

Upskilling community leaders for Australian Pollinator Week Upskilling community leaders for Australian Pollinator Week Classroom or other educational activities DISCLAIMER Hello and thank you for being part of this project. This presentation is designed to be

More information

progeny. Observe the phenotypes of the F1 progeny flies resulting from this reciprocal cross.

progeny. Observe the phenotypes of the F1 progeny flies resulting from this reciprocal cross. Name Fruit Fly Exercise 8 Goal In this exercise, you will use the StarGenetics, a software tool that simulates mating experiments, to perform your own simulated genetic crosses to analyze the mode of inheritance

More information

European Grapevine Moth Lobesia botrana

European Grapevine Moth Lobesia botrana European Grapevine Moth Lobesia botrana Monica L. Cooper UC Cooperative Extension Napa County Viticulture Farm Advisor Monica L. Cooper JK Clark Objectives: Locating the geographical origin of California

More information

Pollinator Landing Frequency after Floral Guide Modification Thea Barbelet

Pollinator Landing Frequency after Floral Guide Modification Thea Barbelet Pollinator Landing Frequency after Floral Guide Modification Thea Barbelet TESA 2017 Grade 11 Hendrick Hudson High School Pollinators - Bees European Honey Bee ⅓ of all food pollination $20 billion worth

More information

Pea Patch Pollination Game

Pea Patch Pollination Game Pea Patch Pollination Game Classroom Activity: 5-8 Time: One 45-60-minute class period Overview: In this activity, students play a simulation game modeling changes in a plant population (a Pea Patch) caused

More information

U.S. Fish & Wildlife Service. Attracting Pollinators to Your Garden

U.S. Fish & Wildlife Service. Attracting Pollinators to Your Garden U.S. Fish & Wildlife Service Attracting Pollinators to Your Garden Why are Pollinators Important? Pollinators are nearly as important as sunlight, soil and water to the reproductive success of over 75%

More information

A project report to the Shackleton Scholarship Fund

A project report to the Shackleton Scholarship Fund THE COST OF SEXUAL PARASITISM A project report to the Shackleton Scholarship Fund Dr. David Stein (PI, Oregon State University, Corvallis, Oregon USA) Dr. Christoph Held (Co-PI, Alfred Wegener Institute,

More information

Introduction. Description. Bumble bee:

Introduction. Description. Bumble bee: Introduction Bumble bee: There are roughly 800 bee species in Canada. Bees are considered the most important group of pollinators. The bumble bee (genus Bombus) is native to North America. Description

More information

Chapter 16: Reconstructing and Using Phylogenies

Chapter 16: Reconstructing and Using Phylogenies Chapter Review 1. Use the phylogenetic tree shown at the right to complete the following. a. Explain how many clades are indicated: Three: (1) chimpanzee/human, (2) chimpanzee/ human/gorilla, and (3)chimpanzee/human/

More information

Kansas State University Department of Entomology Newsletter

Kansas State University Department of Entomology Newsletter Kansas State University Department of Entomology Newsletter For Agribusinesses, Applicators, Consultants, Extension Personnel & Homeowners Department of Entomology 123 West Waters Hall K-State Research

More information

Habitat Enhancements to Support Bees: Agriculture to Urban Research. Neal Williams Department of Entomology

Habitat Enhancements to Support Bees: Agriculture to Urban Research. Neal Williams Department of Entomology Habitat Enhancements to Support Bees: Agriculture to Urban Research Neal Williams Department of Entomology nmwilliam@ucdavis.edu Overview Bees and pollination service for agriculture Threats to native

More information

Use of DNA metabarcoding to identify plants from environmental samples: comparisons with traditional approaches

Use of DNA metabarcoding to identify plants from environmental samples: comparisons with traditional approaches Use of DNA metabarcoding to identify plants from environmental samples: comparisons with traditional approaches Christine E. Edwards 1, Denise L. Lindsay 2, Thomas Minckley 3, and Richard F. Lance 2 1

More information

7TH GRADE SCIENCE EXAM REVIEW. 1. The actual gene pair for a trait would be the.

7TH GRADE SCIENCE EXAM REVIEW. 1. The actual gene pair for a trait would be the. 7TH GRADE SCIENCE EXAM REVIEW Genetics: 1. The actual gene pair for a trait would be the. 2. Strands of DNA that control information in the nucleus of a cell are called 3. Segments of DNA the code for

More information

FCOS President s message - November 2017

FCOS President s message - November 2017 Novembe r, 2 0 1 7 FCOS President s message - November 2017 I hope all your orchids (and you) successfully made it through the recent heat wave. Remember that when it is very warm to try to increase the

More information