Keeping the bees: identifying wild bees a prerequisite for conservation
|
|
- Eleanor Allison
- 5 years ago
- Views:
Transcription
1 P C Y U Keeping the bees: identifying wild bees a prerequisite for conservation Agapostemon virescens
2 Outline The importance of bees Species identification and discovery through barcodes The campaign to barcode the bees of the world progress and prognosis
3
4 Bees and Our Food If the bee disappeared off the surface of the globe man would have only four years of life left attributed to Albert Einstein
5
6
7 Photos L. Mandel
8 Identification and discovery 1: Halictus ligatus in Canada & the USA
9 Is two species that are morphologically exactly the same but genetically they are very, very different
10 They are sympatric in the Piedmont region of the Appalachian mountains
11 . H. poeyi H. ligatus
12 H. townsendi H. poeyi H. ligatus
13 Identification and discovery 2: Lonchopria an example of barcoding helping us find morphological differences
14 Lonchopria (Biglossa) Lonchopria rufitorax Lonchopria rufitorax Lonchopria sp3 Lonchopria sp3 Lonchopria sp3 Lonchopria sp3 Lonchopria greyform Lonchopria sp2 5% There are at least 6 species Lonchopria sp2 Lonchopria sp2 Lonchopria zonalis Lonchopria sp1 Lonchopria sp1 Lonchopria sp1 Lonchopria sp1 Lonchopria sp1
15
16 Male mandibles and base of female metasoma modified
17
18
19
20 Identification and Discovery 3: Liphanthus 33 described species, 29 from Chile. Most barcode clusters have been examined by the expert who described 22 of the 29 Chilean species Luisa Ruz Strong sexual dimorphism Male Liphanthus sabulosus Female
21 Rhophitulus sp Liphanthus nsp1 We have > 32 barcode clusters, but only 11 of them are described species 1 Liphanthus nsp3 Liphanthus nsp3 Liphanthus nsp2 Liphanthus nsp2 Liphanthus alicahue? Liphanthus alicahue Liphanthus alicahue Liphanthus alicahue Liphanthus alicahue Liphanthus alicahue 3 2 2% Liphanthus quadrifasciatus Liphanthus nsp5 Liphanthus nsp6 6 5 Liphanthus nsp18 18 Liphanthus nsp4 4 Liphanthus nsp16 16 Liphanthus coquimbensis Liphanthus coquimbensis Liphanthus nsp15 Liphanthus nsp14 14 Liphanthus nsp14 Liphanthus nsp9 9 Liphanthus nsp17 Liphanthus nsp17 17 Liphanthus nsp19 Liphanthus nsp19 Liphanthus nsp19 Liphanthus nsp19 15 Liphanthus nsp19? Liphanthus nsp19 Liphanthus nsp19 Liphanthus nsp10 Liphanthus nsp10
22 Seemingly at least 21 undescribed species with incomplete sampling Liphanthus nsp10 10 Liphanthus nsp19 2% Liphanthus nsp10 Liphanthus chillanensis Liphanthus chillanensis Liphanthus nsp8 Liphanthus nsp8 8 Liphanthus nsp13 Liphanthus nsp13 Liphanthus nsp13 13 Liphanthus nsp13 Liphanthus nsp13 Liphanthus tarsalis Liphanthus tarsalis? Liphanthus nsp12 12 Liphanthus moldenkei Liphanthus atratus Liphanthus penai Liphanthus penai Liphanthus pilifrons Liphanthus nsp11 11 Liphanthus nsp11 Liphanthus nsp7 7 Liphanthus nsp18 19 Liphanthus nsp15 20 Liphanthus nsp15 21 Liphanthus brevicornis Liphanthus brevicornis Liphanthus sabulosus Liphanthus sabulosus Liphanthus sabulosus? Liphanthus sabulosus Liphanthus sabulosus
23 The campaign to barcode the bees of the world Inaugural Meeting Reunión Inagural Reunião Inaugural 創立総会 May 12 th 14 th Mayo, Maio, 年 5 月 日
24 Geographic Coverage of Bee Barcodes: Data as of August 30 th 2013
25
26
27 ( 90% of ~500 genera have at least one barcode ~30% of 20,077 species have at least one barcode
28 HELP? Amro Zayed We still need bees from throughout the world. Whenever there are flowers in bloom there will be bees flying: please catch us some! Just using plastic cups with soapy water inside will work.
29 PARTNERS IN FUNDING AND IN-KIND SUPPORT FUNDING The Gordon and Betty Moore Foundation, Natural Sciences and Engineering Research Council (Canada), Canada Research Chairs program, Ontario Foundation for Innovation and Genome Canada through the Ontario Genomics Institute to PDN Hebert Claudia Ratti, Sheila Dumesh, Amro Zayed, Gail Fraser for images CBOL funded the May workshop York University ASSISTANCE Sujeevan Ratnasingham (BOLD) Many workers at BIO for (diligent, careful and enthusiastic lab work) Julie Stahlhut for troubleshooting. COLLABORATORS By now, this represents almost all bee researchers worldwide.
30 Thanks for listening Photo courtesy Dr. S.F. Sakagami
Amy Driskell. Laboratories of Analytical Biology National Museum of Natural History Smithsonian Institution, Wash. DC
DNA Barcoding Amy Driskell Laboratories of Analytical Biology National Museum of Natural History Smithsonian Institution, Wash. DC 1 Outline 1. Barcoding in general 2. Uses & Examples 3. Barcoding Bocas
More informationPollination of Pumpkin and Winter Squash - Thanks to Bumble Bees! Dr. Kimberly Stoner Connecticut Agricultural Experiment Station New Haven
Pollination of Pumpkin and Winter Squash - Thanks to Bumble Bees! Dr. Kimberly Stoner Connecticut Agricultural Experiment Station New Haven Basics of Pumpkin and Squash Flowering and Pollination Separate
More informationThe Pollinator Victory Garden the Bees. Dr. Kimberly Stoner Connecticut Agricultural Experiment Station New Haven
The Pollinator Victory Garden the Bees Dr. Kimberly Stoner Connecticut Agricultural Experiment Station New Haven CT Public Act 16-17 An Act Concerning Pollinator Health Pesticides: Certain neonicotinoid
More informationMutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution
Mutation, Selection, Gene Flow, Genetic Drift, and Nonrandom Mating Results in Evolution 15.2 Intro In biology, evolution refers specifically to changes in the genetic makeup of populations over time.
More informationThe Origin of Species
LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 24 The Origin of Species Lectures
More informationChapter 1-Plants in Our World
Chapter 1-Plants in Our World Formation of earth-4.5-4.6 billion years ago Evidence of life from organic material-3.8 billion years ago Many cyanobacteria are photosynthetic, but these microscopic organisms
More informationSaturday, August 24, Speciation
Speciation New Species Can Emerge Darwin called the first appearance of new beings on earth the mystery of mysteries. The origin of species or speciation is central to evolutionary theory because the appearance
More informationName: Hour: Teacher: ROZEMA. Inheritance & Mutations Connected to Speciation
Name: Hour: Teacher: ROZEMA Inheritance & Mutations Connected to Speciation Let s Review What We Already Know: What Have We Learned? Lesson 26: PI 1 (Projected Image) - Human Karyotype (image from https://en.wikipedia.org/wiki/karyotype#/media/file:nhgri_human_male_karyotype.png)
More informationA DNA Sequence 2017/12/6 1
A DNA Sequence ccgtacgtacgtagagtgctagtctagtcgtagcgccgtagtcgatcgtgtgg gtagtagctgatatgatgcgaggtaggggataggatagcaacagatgagc ggatgctgagtgcagtggcatgcgatgtcgatgatagcggtaggtagacttc gcgcataaagctgcgcgagatgattgcaaagragttagatgagctgatgcta
More informationThe Orchid s Secret By Josh Adler
The Orchid s Secret The Orchid s Secret By Josh Adler Deep in the jungles of Colombia there is a kind of flower that attracts bees with its unique perfume. The male bees store as much scent as possible
More informationActivity: Honey Bee Adaptation Grade Level: Major Emphasis: Major Curriculum Area: Related Curriculum Areas: Program Indicator: Student Outcomes:
Activity: Honey Bee Adaptation Grade Level: Grade 5 Major Emphasis: Invertebrates and Their Environments Major Curriculum Area: Science Related Curriculum Areas: Refer to Outdoor Education Curriculum Matrix
More information3/4/2015. Review. Phenotype
Review Phenotype 1 Genes Crossing Over Frequency cn cinnabar eyes Cy curly wings L lobe eyes pr purple eyes sm smooth abdomen pr - L 9% Cy - L 33% sm - pr 19% cn - pr 2% Cy - sm 43% cn - sm 17% Polygenic
More informationPollination, the Grand Interaction Among Flowers, Bees, Growers and Beekeepers
Pollination, the Grand Interaction Among Flowers, Bees, Growers and Beekeepers EASTERN KENTUCKY BEEKEEPING SCHOOL PROGRAM, January 20, 2018 Hazard Community and Technical College John A. Skinner University
More informationo Can you find any nectar? Brood? Honey? o Can you find any drones and drone cells? o Can you find the queen bee?
o Can you find any nectar? Brood? Honey? o Can you find any drones and drone cells? o Can you find the queen bee? *NOTE: The queen in Observation Hive #1 has a yellow mark on her. Put the wooden panels
More informationFLOWERS AND POLLINATION. This activity introduces the relationship between flower structures and pollination.
FLOWERS AND POLLINATION This activity introduces the relationship between flower structures and pollination. Objectives for Exam #1 1. Identify flower structures and match those structures to specific
More informationADAPTATIONS LESSON PLAN
ADAPTATIONS LESSON PLAN LESSON PLAN Adaptations Change: Life s Only Constant TEACHER INFORMATION Focus: Adaptations and evolution all organisms evolve to have different adaptations in order to survive
More informationSpeciation and Patterns of Evolution
Speciation and Patterns of Evolution What is a species? Biologically, a species is defined as members of a population that can interbreed under natural conditions Different species are considered reproductively
More informationADAPTATIONS LESSON PLAN
ADAPTATIONS LESSON PLAN Change: Life s Only Constant Focus: Adaptations and evolution all organisms evolve to have different adaptations in order to survive plants included! Intended for middle and high
More informationFostering Green Chemistry in the Auto Industry: A Michigan Perspective
Fostering Green Chemistry in the Auto Industry: A Michigan Perspective Clinton S. Boyd (Sustainable Research Group) Carol Henry (George Washington University) 15 th Annual Green Chemistry & Engineering
More informationV Q \ = 7]Z 4IVL 126 Unit 5
126 Unit 5 Is it cold and windy? Or is it a sunny day? Is it raining cats and dogs? Or can we go out to play? I will learn to talk about seasons and weather plant life environments caring for the earth
More informationThese next few slides correspond with 23.4 in your book. Specifically follow along on page Use your book and it will help you!
These next few slides correspond with 23.4 in your book. Specifically follow along on page 462-468. Use your book and it will help you! How does natural selection actually work? Natural selection acts
More informationNothing in biology makes sense except in the light of evolution
Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky (1900-1975) Fruit fly geneticist and founder of the modern evolutionary synthesis Organismal reproductive diversity
More informationTrade in a Long Country. Teacher and School not available. Content Area (Req.): Geography
Instructional Sequence/Procedure (Req.): 1. Have students research and learn about the Four Regions of Chile. 2. Have students fill in the attached chart based on researching the four main regions of Chile
More informationLaunch of the ESPON 2013 Programme. European observation network on territorial development and cohesion
Launch of the ESPON 2013 Programme European observation network on territorial development and cohesion Framework conditions for the ESPON 2013 Programme Policy development in use of territorial evidence
More informationAnalysis of TMT Primary Mirror Control-Structure Interaction (SPIE )
Analysis of TMT Primary Mirror Control-Structure Interaction (SPIE 7017-41) Douglas MacMynowski (Caltech) Peter Thompson (Systems Tech.) Mark Sirota (TMT Observatory) Control Problems TMT.SEN.PRE.08.046.REL01
More informationNorthwestern Garter Snake (Thamnophis. ordinoides)
Northwestern Garter Snake (Thamnophis ordinoides) Speciation I. What is a species? II. Isolating Mechanisms III. Models of Speciation Aristotle coined the term species. Genus -a group that shares generic
More informationMutualism: Inter-specific relationship from which both species benefit
Mutualism Mutualism: Inter-specific relationship from which both species benefit Mutualism Symbiosis: Intimate (generally obligate) inter-specific relationships from which both partners benefit 1 Mutualism
More informationMutualism. Mutualism. Mutualism. Early plants were probably wind pollinated and insects were predators feeding on spores, pollen or ovules
Mutualism Mutualism: Inter-specific relationship from which both species benefit Mutualism Symbiosis: Intimate (generally obligate) inter-specific relationships from which both partners benefit Mutualism
More informationEvolution AP Biology
Darwin s Theory of Evolution How do biologists use evolutionary theory to develop better flu vaccines? Theory: Evolutionary Theory: Why do we need to understand the Theory of Evolution? Charles Darwin:
More informationGlaciology Exchange (Glacio-Ex) Norwegian/Canadian/US Partnership Program
Glaciology Exchange (Glacio-Ex) Norwegian/Canadian/US Partnership Program Luke Copland University of Ottawa, Canada Jon Ove Hagen University of Oslo, Norway Kronebreeen, Svalbard. Photo: Monica Sund The
More informationWhat is GIS? ESRI Canada. August 2011
What is GIS? ESRI Canada August 2011 Geography Matters! Environmental Park Management Agriculture Public Utilities Health Care Emergency 911 Real Estate Marketing Environmental What are the effects of
More informationDNA Barcoding: A New Tool for Identifying Biological Specimens and Managing Species Diversity
DNA Barcoding: A New Tool for Identifying Biological Specimens and Managing Species Diversity DNA barcoding has inspired a global initiative dedicated to: Creating a library of new knowledge about species
More informationAmerican Harris mud crab Rhithropanopeus harrisii
American Harris mud crab Rhithropanopeus harrisii (Gould, 1841) in the Gulf of Gdańsk (southern Baltic Sea): distribution, population structure and basic physiological processes Joanna Hegele-Drywa Alien
More informationChanging Planet: Changing Mosquito Genes
Changing Planet: Changing Mosquito Genes Name Background As the climate changes around the globe, organisms will need to adapt in order to survive. But what does it mean to adapt? When you put on a sweater
More informationBIOL 305L Spring 2018 Laboratory Seven
Please print Full name clearly: BIOL 305L Spring 2018 Laboratory Seven Flowering and reproduction Introduction Flowers are not simple structures, and the diversity of flower shape, color, and fragrance
More informationReproduction and Evolution Practice Exam
Reproduction and Evolution Practice Exam Topics: Genetic concepts from the lecture notes including; o Mitosis and Meiosis, Homologous Chromosomes, Haploid vs Diploid cells Reproductive Strategies Heaviest
More informationPitahayas: introduction, agrotechniques and breeding
Pitahayas: introduction, agrotechniques and breeding The French Associates Institute for Agriculture and Biotechnology of Drylands May 8 Noemi Tel-Zur The J. Blaustein Institutes for Desert Research Ben-Gurion
More informationFlorida Friendly Landscapes?
Florida Friendly Landscapes? Backyards as Habitats Ecology Concepts Ecosystem interacting network of living and non-living components Community association of different species living and interacting in
More informationBiosecurity in the new millennium: DNA barcoding provides a reliable, rapid, and cost effective method of forest pest identification
Biosecurity in the new millennium: DNA barcoding provides a reliable, rapid, and cost effective method of forest pest identification Shelley L. Ball & Karen F. Armstrong Centre for Advanced Bio-protection
More informationBio 1M: The evolution of apes. 1 Example. 2 Patterns of evolution. Similarities and differences. History
Bio 1M: The evolution of apes 1 Example Humans are an example of a biological species that has evolved Possibly of interest, since many of your friends are probably humans Humans seem unique: How do they
More informationClimate Change Vulnerability Assessment for Species
Climate Change Vulnerability Assessment for Species SPECIES: Specify whether you are assessing the entire species or particular populations: This tool assesses the vulnerability or resilience of species
More informationPLANT BIOLOGY (PBIO) Plant Biology (PBIO) 1
Plant Biology (PBIO) 1 PLANT BIOLOGY (PBIO) PBIO 1052 How Plants Shaped Our World (LN) Description: This course is an eclectic dive into the world of plants and their influence on human society. Students
More informationStatistical Approaches to Regional Climate Models for Adaptation
www.nr.no Statistical Approaches to Regional Climate Models for Adaptation SARMA Ola Haug Norsk Regnesentral and SARMA Executive Committee TRI Network kick-off, Oslo 27 28 October 2010 Outline Scientific
More informationMethodological issues in the development of accessibility measures to services: challenges and possible solutions in the Canadian context
Methodological issues in the development of accessibility measures to services: challenges and possible solutions in the Canadian context Alessandro Alasia 1, Frédéric Bédard 2, and Julie Bélanger 1 (1)
More informationFaatasi Malologa (PGSC Chair) Director Department of Lands & Survey, Tuvalu
Seventh Session of the United Nations Committee of Experts on Global Geospatial Information Management (UN-GGIM) - 31 July -4 August 2017 Faatasi Malologa (PGSC Chair) Director Department of Lands & Survey,
More informationOverview of Thirty Meter Telescope Project
Overview of Thirty Meter Telescope Project L. Stepp November 16, 2010 TMT.TEL.PRE.10.016.REL02 1 Outline Introduction to TMT TMT site selection TMT partners Summary of TMT design TMT requirements for segments
More informationGOVERNMENT MAPPING WORKSHOP RECOVER Edmonton s Urban Wellness Plan Mapping Workshop December 4, 2017
GOVERNMENT MAPPING WORKSHOP 12.4.17 RECOVER Edmonton s Urban Wellness Plan Mapping Workshop December 4, 2017 In July of 2017, City Council directed administration to develop RECOVER, Edmonton s Urban Wellness
More informationEvolution. Before You Read. Read to Learn
Evolution 15 section 3 Shaping Evolutionary Theory Biology/Life Sciences 7.e Students know the conditions for Hardy-Weinberg equilibrium in a population and why these conditions are not likely to appear
More informationPeter Dutton. 28 August Halesworth& District
Peter Dutton 28 August 2014 Halesworth& District Bees Hymenoptera - 150,000+ species Sawflies, Wasps, Bees, Ants, Bees - 20,000+ species Most solitary, a few social Honey Bee - The only one which produces
More informationEVOLUTION Unit 1 Part 9 (Chapter 24) Activity #13
AP BIOLOGY EVOLUTION Unit 1 Part 9 (Chapter 24) Activity #13 NAME DATE PERIOD SPECIATION SPECIATION Origin of new species SPECIES BIOLOGICAL CONCEPT Population or groups of populations whose members have
More informationBiology 8 Learning Outcomes
Biology 8 Learning Outcomes CELLS (Bio 8-1) I can connect the names, diagrams, and functions of organelles in a cell I know the major differences between plant and animal cells I can explain cell theory
More informationClimate Change and Plant Reproduction
Quantitative Trait Loci Mapping of Reproductive Traits Involved in Heat Stress Responses in Arabidopsis : Implications for Global Climate Change and Plant Reproduction Lazar Pavlovic, Greta Chiu, Jeffrey
More informationDaucus pusillus Michx. l Sarah Schumann Hort 5051 May 5, 2008
Daucus pusillus Michx. http://www.fireflyforest.com/flowers/whites/white33.htm l Sarah Schumann Hort 5051 May 5, 2008 Taxonomy Scientific Name: Daucus pusillus Michx. Synonyms: D. montevidensis and D.
More informationPheromones by Ellen Miller November 2015
Pheromones by Ellen Miller November 2015 Greek word pherein to carry Greek word hormone to stimulate A released chemical that triggers a social response in members of the same species The chemical is transmitted
More informationSpecial features / Articles spéciaux
DNA barcoding makes an impact on the other side of the globe Muhammad Ashfaq Special features / Articles spéciaux those found in individuals from other species (Pereira et al. 2008). A wide range of molecular
More informationOther matters: * Term paper: 11 (Monday) Nov 15 (Friday), 16, 17? Final * Wednesday, 11 December (8 11 AM)
Nov 4-Nov 8 Nov 11-15 DNA barcoding Molecular systematics in plants (Les) Lab 8: likelihood (Garli and/or RAxML) and Bayesian analyses (Wagner in Austin) Molecular systematics in animals (Simon) (Wagner
More informationEDUCATION PROFESSIONAL APPOINTMENTS
MICHAEL DAVID MARTIN University of Arizona u Department of Entomology u PO Box 210036 u Tucson, AZ 85721 Tel: 919-357-6399 u Email: mdmartin7@gmail.com Web: http://michaelmartinevobio.wordpress.com/ EDUCATION
More informationLesson 1 Sexual Reproduction and Meiosis
Lesson 1 Name Date Class A. What is sexual reproduction? 1. produces an offspring when genetic materials from two different sex cells combine. a. The female sex cell, a(n), forms in an ovary. b. The male
More informationThe architecture of complexity: the structure and dynamics of complex networks.
SMR.1656-36 School and Workshop on Structure and Function of Complex Networks 16-28 May 2005 ------------------------------------------------------------------------------------------------------------------------
More informationUnit 4.2a Natural Selection Study Guide
Unit 4.2a Natural Selection Study Guide 7.11 Organisms and environments. The student knows that populations and species demonstrate variation and inherit many of their unique traits through gradual processes
More informationThere are approximately 25,000 species of Bee in the World There are almost 4000 species of Bee in North America There are approximately 1000
There are approximately 25,000 species of Bee in the World There are almost 4000 species of Bee in North America There are approximately 1000 different species of Bee in Texas There are only 7-9 species
More informationUnit 5.2. Ecogeographic Surveys - 1 -
Ecogeographic Surveys Unit 5.2 Ecogeographic Surveys - 1 - Objectives Ecogeographic Surveys - 2 - Outline Introduction Phase 1 - Project Design Phase 2 - Data Collection and Analysis Phase 3 - Product
More informationHow Does Pollination Work?
How Does Pollination Work? What is pollination? What is pollination? Pollination the transfer of pollen from the anther of one flower to the stigma of another flower Fertilization occurs when the male
More informationThe Common Ground Curriculum. Science: Biology
The Common Ground Curriculum Science: Biology CGC Science : Biology Defining Biology: Biology is the study of living things in their environment. This is not a static, snapshot of the living world but
More informationChapter 5. Heredity. Table of Contents. Section 1 Mendel and His Peas. Section 2 Traits and Inheritance. Section 3 Meiosis
Heredity Table of Contents Section 1 Mendel and His Peas Section 2 Traits and Inheritance Section 3 Meiosis Section 1 Mendel and His Peas Objectives Explain the relationship between traits and heredity.
More informationR E SEARCH HIGHLIGHTS
Canada Research Chair in Urban Change and Adaptation R E SEARCH HIGHLIGHTS PANHANDLING IN WINNIPEG PROJECT: MAPPING METHODOLOGY Research Highlight No. 11 June 2007 Introduction The general methodology
More informationMOR FOSSILS TEACHERS. Making a Fossil Activity Overview BIG IDEA
Making a Fossil Activity Overview BIG IDEA OBJECTIVE BACKGROUND Not every organism that died, including dinosaurs, left behind a fossil. Explore fossilization with this activity. Students will follow a
More informationLeonid Meteor Observer in LEO: A Proposal for a University Microsatellite for the 2001 Leonids
Leonid Meteor Observer in LEO: A Proposal for a University Microsatellite for the 2001 Leonids Kazuya Yoshida* Hajime Yano** *Tohoku University **Institute of Space and Astronautical Science (ISAS) JAPAN
More informationEconomic and Social Council
United Nations Economic and Social Council Distr.: General 18 July 2016 Original: English Committee of Experts on Global Geospatial Information Management Sixth session New York, 3-5 August 2016 Item 2
More informationInsect Investigations
Investigative Questions What are some adaptations that insects have that help them to feed on different foods and from different parts of plants, especially flowers? Goal: Students explore the ways that
More informationDISCUSSION ITEM DEVELOPMENTS REGARDING THE THIRTY METER TELESCOPE AND THE PARTICIPATION OF THE UNIVERSITY OF CALIFORNIA EXECUTIVE SUMMARY
Office of the President E2 TO MEMBERS OF THE COMMITTEE ON EDUCATION POLICY: For Meeting of DISCUSSION ITEM DEVELOPMENTS REGARDING THE THIRTY METER TELESCOPE AND THE PARTICIPATION OF THE UNIVERSITY OF CALIFORNIA
More informationAP Biology Notes Outline Enduring Understanding 1.C. Big Idea 1: The process of evolution drives the diversity and unity of life.
AP Biology Notes Outline Enduring Understanding 1.C Big Idea 1: The process of evolution drives the diversity and unity of life. Enduring Understanding 1.C: Life continues to evolve within a changing environment.
More informationCreating an e-flora for South Africa
SANBI POLICY DOCUMENT DIVISION: Biosystematics Research and Biodiversity Collections EFFECTIVE DATE: 1 April 2014 Compiler: Marianne le Roux & Janine Victor POLICY NUMBER: LAST AMENDED: Creating an e-flora
More informationEDUCATION AND DEGREES
ANDREW G. MCADAM Department of Ecology and Evolutionary Biology Tel.: 831-459-4022 University of California Fax: 831-459-5353 Santa Cruz, CA 95064 USA mcadam@biology.ucsc.edu CITIZENSHIP: Canadian EDUCATION
More informationItem 17.4 of the Provisional Agenda SEVENTH SESSION OF THE GOVERNING BODY. Kigali, Rwanda, 30 October 3 November 2017
August 2017 IT/GB-7/17/25 Add.1 E Item 17.4 of the Provisional Agenda SEVENTH SESSION OF THE GOVERNING BODY Kigali, Rwanda, 30 October 3 November 2017 Report from Norway on the Management of the Svalbard
More informationSurvey Protocols for Monitoring Status and Trends of Pollinators
Survey Protocols for Monitoring Status and Trends of Pollinators This annex presents the bee monitoring protocols to be applied in the context of monitoring status and trends of pollinators in STEP sites.
More informationabout GCC
about GCC Bldg 234, Flat 11, Al Barakat Street, Hail Al Janaubiyah P.O Box: 94, Postal Code: 123, Al Khaudh, Sultante of Oman Fax : +968 24543188 Mobile :+968 96666445 info@gcc-oman.com www.gcc-oman.com
More informationAn Introduction to NatureServe Linking Conservation and Transportation Planning Phoenix, Arizona November 8 & 9, 2006
An Introduction to NatureServe Linking Conservation and Transportation Planning Phoenix, Arizona November 8 & 9, 2006 1 NatureServe in Brief An independent, non-profit conservation organization Provides
More informationAmy Ant. Formica Mica Grant. Dr. Sheila Grant (Mica s mom)
Dr. Sheila Grant (Mica s mom) Formica Mica Grant Amy Ant By Elisabeth Schlegel, Jessica Louton, Natasha Mehdiabadi, and Ted Schultz Illustrated by Katherine Arisumi At the Smithsonian Institution s National
More informationMicroevolutionary changes show us how populations change over time. When do we know that distinctly new species have evolved?
Microevolutionary changes show us how populations change over time. When do we know that distinctly new species have evolved? Critical to determining the limits of a species is understanding if two populations
More informationSpeciation factsheet. What is a species?
What is a species? A species is a group of interbreeding individuals that share a gene pool and are reproductively isolated from other species. It is impossible to determine whether two organisms are from
More informationDNA Barcoding reveals recent speciation, extreme genus-level polyphyly and cryptic species in Neotropical birds
Image from Ridgely and Tudor, Field Guide to the Songbirds of South America DNA Barcoding reveals recent speciation, extreme genus-level polyphyly and cryptic species in Neotropical birds Leonardo Campagna
More informationEnabling Access to Arctic Location Based Information
Enabling Access to Arctic Location Based Information Kevin Gallagher Arctic SDI Board Chair, United States Geological Survey Alaska Surveying and Mapping Conference, GeoJam 15 February 2017 What is Arctic
More informationRNAi Suppression of AGAMOUS-like Genes Causes Field Sterility in Populus
RNAi Suppression of AGAMOUS-like Genes Causes Field Sterility in Populus Haiwei Lu and Steven H. Strauss Oregon State University Forest Tree Workshop PAG XXVI, San Diego, CA, 2018 The containment issue
More informationMiddle School. Teacher s Guide MICROPLANTS MAJOR SPONSOR:
Middle School Teacher s Guide MICROPLANTS MAJOR SPONSOR: Introduction As technology continues to rapidly evolve, scientists are able to collect and store more data. Some scientists find themselves with
More informationInternational Dark Sky Community Annual Designation Update 2018
International Dark Sky Community Annual Designation Update 2018 EXECUTIVE SUMMARY Bon Accord has completed and maintained the majority of schedule of projects within the original designation application
More informationUpskilling community leaders for Australian Pollinator Week
Upskilling community leaders for Australian Pollinator Week Classroom or other educational activities DISCLAIMER Hello and thank you for being part of this project. This presentation is designed to be
More informationprogeny. Observe the phenotypes of the F1 progeny flies resulting from this reciprocal cross.
Name Fruit Fly Exercise 8 Goal In this exercise, you will use the StarGenetics, a software tool that simulates mating experiments, to perform your own simulated genetic crosses to analyze the mode of inheritance
More informationEuropean Grapevine Moth Lobesia botrana
European Grapevine Moth Lobesia botrana Monica L. Cooper UC Cooperative Extension Napa County Viticulture Farm Advisor Monica L. Cooper JK Clark Objectives: Locating the geographical origin of California
More informationPollinator Landing Frequency after Floral Guide Modification Thea Barbelet
Pollinator Landing Frequency after Floral Guide Modification Thea Barbelet TESA 2017 Grade 11 Hendrick Hudson High School Pollinators - Bees European Honey Bee ⅓ of all food pollination $20 billion worth
More informationPea Patch Pollination Game
Pea Patch Pollination Game Classroom Activity: 5-8 Time: One 45-60-minute class period Overview: In this activity, students play a simulation game modeling changes in a plant population (a Pea Patch) caused
More informationU.S. Fish & Wildlife Service. Attracting Pollinators to Your Garden
U.S. Fish & Wildlife Service Attracting Pollinators to Your Garden Why are Pollinators Important? Pollinators are nearly as important as sunlight, soil and water to the reproductive success of over 75%
More informationA project report to the Shackleton Scholarship Fund
THE COST OF SEXUAL PARASITISM A project report to the Shackleton Scholarship Fund Dr. David Stein (PI, Oregon State University, Corvallis, Oregon USA) Dr. Christoph Held (Co-PI, Alfred Wegener Institute,
More informationIntroduction. Description. Bumble bee:
Introduction Bumble bee: There are roughly 800 bee species in Canada. Bees are considered the most important group of pollinators. The bumble bee (genus Bombus) is native to North America. Description
More informationChapter 16: Reconstructing and Using Phylogenies
Chapter Review 1. Use the phylogenetic tree shown at the right to complete the following. a. Explain how many clades are indicated: Three: (1) chimpanzee/human, (2) chimpanzee/ human/gorilla, and (3)chimpanzee/human/
More informationKansas State University Department of Entomology Newsletter
Kansas State University Department of Entomology Newsletter For Agribusinesses, Applicators, Consultants, Extension Personnel & Homeowners Department of Entomology 123 West Waters Hall K-State Research
More informationHabitat Enhancements to Support Bees: Agriculture to Urban Research. Neal Williams Department of Entomology
Habitat Enhancements to Support Bees: Agriculture to Urban Research Neal Williams Department of Entomology nmwilliam@ucdavis.edu Overview Bees and pollination service for agriculture Threats to native
More informationUse of DNA metabarcoding to identify plants from environmental samples: comparisons with traditional approaches
Use of DNA metabarcoding to identify plants from environmental samples: comparisons with traditional approaches Christine E. Edwards 1, Denise L. Lindsay 2, Thomas Minckley 3, and Richard F. Lance 2 1
More information7TH GRADE SCIENCE EXAM REVIEW. 1. The actual gene pair for a trait would be the.
7TH GRADE SCIENCE EXAM REVIEW Genetics: 1. The actual gene pair for a trait would be the. 2. Strands of DNA that control information in the nucleus of a cell are called 3. Segments of DNA the code for
More informationFCOS President s message - November 2017
Novembe r, 2 0 1 7 FCOS President s message - November 2017 I hope all your orchids (and you) successfully made it through the recent heat wave. Remember that when it is very warm to try to increase the
More information