Life ciences 1a Lecture lides et 3 Fall 2006-2007 rof. David R. Liu Lectures 3-5: ucleic acids & the chemical requirements for replicating information 1. The primary biological roles of nucleic acids 2. The molecular components of DA and RA a. The primary structure of deoxyribonucleic acid b. The phosphate group in DA; equilibrium, acidity, and protonation states c. The sugar group in DA; strand orientation and macromolecular chirality d. The bases of DA e. The primary structure of ribonucleic acid f. Why does DA use deoxyribose? Why T? 3. The factors behind DA base pairing a. DA hybridization as an equilibrium b. The role of hydrogen bonding c. The role of the hydrophobic effect and base stacking 4. The molecular basis of DA replication a. DA replication; chemical reactions, substrates, and products Lecture Readings Required: Lecture otes, McMurray 796-813, 197-202, Ch. 10, 837-838; Alberts pp. 56-58, 68-69, 76-77, 168-171,175-177, 195-197 b. The role of DA polymerase: faster and more accurate DA replication c. The polymerase chain reaction (CR) and its impact on the life sciences 1
ucleic Acids Encode the Molecules of Life Information storage device lueprint ouse ATGTACGTAGCTAAGTGATCT TGACTGACGGGTACCGTGCTG ATCGTGACTGATTTTCGAGGA GGATCAATCTAATAATCTAGA ucleic acid Gene rotein rganization of DA in the Cell ucleus Chromosome (Complete set = genome) Cell DA 2
ucleic Acids are Replicable Information Carriers in the Cell cell replication (very complex) DA replication (understood in molecular detail) Each cell division requires replication of the cell s genome Molecular Replication in the Laboratory: The olymerase Chain Reaction (CR) h no known process X h h h h h h h h h h one molecule of penicillin multiple copies of that penicillin molecule $2 of readily available ingredients one molecule of DA 1 hour CR 1,000,000 copies of that molecule of DA The ability to replicate (both in the cell and in the laboratory) is a unique feature of nucleic acids 3
What are the Requirements for a Replicable Information Carrier? 1) Resist degradation 2) e recognized by cellular machinery 3) Contain multiple possible structures (bits) at each position 4) ossess redundancy for error correction and faithful copying ow does DA (or RA) satisfy these requirements? The DA olymer: A Double elix + Double-stranded DA typically adopts a double-helical conformation; single-stranded DA is more disordered 4
The DA Monomer: A ucleotide 2 hosphate ase ugar The monomer of nucleic acids is the nucleotide, which consists of a phosphate, sugar, and base The hosphate ackbone, Acids, and Conjugate ases + + - acid (protonated form) proton + conjugate base (deprotonated form of the acid) Acidity is the tendency of a molecule to give up protons The phosphate group is acidic and therefore is mostly negatively charged under physiological conditions 5
Equilibrium: A Dynamic alancing Act Liquid water Water vapor Water, carbon dioxide + C C Carbonic acid ingle-stranded DA + Double-stranded DA At equilibrium, the concentrations of two interconverting states do not change (forward rate = reverse rate) The Equilibrium Constant (K eq ) K eq = A + C + D [C] [D] [A] [] at equilibrium [A] = concentration of A in moles per liter 1 mole = ~6 x 10 23 molecules Alternatively: C + D A + [A] [] K eq (reverse) = = [C] [D] 1 K eq (forward) K eq reflects which side of an equilibrium is favored (> 1: right side; < 1: left side), and to what degree 6
Increasing Acidity Acidity and pk a K a = K eq for A A + + (the deprotonation reaction) (in water, + becomes 3 + and K a = K eq [ 2 ] = [A ][ 3 + ]/[A]) acid conjugate base K a pk a (= log K a ) hosphoric acid + + - 10-2 2 DA backbone + + - 10-2 2 Citric acid Acetic acid + + - + + - 10-3 10-5 3 5 Ammonium ion + + + 10-9 9 What Does p Mean? K eq (= K a ) A A + + p = log [ + ] (In water, p = log [ 3 + ]) The lower the p, the higher the [ + ], indicating a more acidic solution Each p unit represents a 10-fold change in [ + ] 7
The Relationship etween pk a, p, and rotonation tate pk a = p + log Two key implications: [A] [A ] (aka the enderson- asselbalch equation) 1) If p increases by 1: The ratio of [A ] (deprotonated) to [A] increases by 10-fold Conversely, if p decreases by 1: The ratio of [A] (protonated) to [A ] increases by 10-fold 2) When p = pk a, then [A ] = [A] Examples: pk a, p, and rotonation tates Acetic acid - + + pk a = 5 At p 5.0 1 : 1 At p 7.0 1 : 100 At p 9.0 1 : 10,000 Ammonium cation + pk a = 9 + + At p 5.0 10,000 : 1 At p 7.0 100 : 1 At p 9.0 1 : 1 8
rilosec, p, and pk a rilosec (omeprazole, sold by AstraZeneca) Treats heartburn; 1998-2002 sales averaged $5,000,000,000 per year 3 C 3 C C 3 C 3 pk a = 4 3 C 3 C + C + 3 C 3 Accumulates in cells iologically active Travels between cells iologically inactive Target of prilosec: a protein in the acid-secreting parietal cells of the stomach, facing the stomach lumen (p = ~1) p 7 (typical cells): prilosec is 99.9% inactive and mobile p 1 (stomach lumen): prilosec is 99.9% active and immobile hosphates Form Ionic onds With Cations pk a = 2 + + 99.999% in the deprotonated, anionic form at p 7 rotein pk a = 12 + Arginine side chain DA - ase ase Cells form ionic bonds with the phosphates of DA and RA to recognize and manipulate nucleic acids 9
The hosphate Group hields DA - ydrolysis - - DA strand breakage, possible mutation or cell death! - Electrostatic repulsion slows down DA hydrolysis The negative charge surrounding the phosphate group protects DA from hydrolysis Ribose: The ugar of ucleic Acids 4' 4' 1' 2' (D)-Ribose found in RA 1' 2' (D)-2' Deoxyribose found in DA 3 end 5 end 4' 1' 2' ase 10
Ribose tructure Defines the Directionality of DA trands ase ase Double-stranded DA is antiparallel Ribose is a Chiral Molecule Mirror images D-ribose (natural enantiomer) L-ribose (not present in any natural nucleic acids) 11
The Chirality of Ribose Determines the Macromolecular Chirality of DA D-ribose Right-handed double helix Wrong Wrong Wrong Wrong Wrong The ucleic Acid ases urines yrimidines The order of bases in DA and RA encode information (2 bits per base) The bases of DA and RA are flat (and therefore are achiral) Know thyself: learn these structures Adenine 3 C Thymine (DA only) Guanine Cytosine 12
Watson-Crick ase airing adenosine A thymidine T C 3 guanosine G cytidine C Each base displays a unique constellation of hydrogen bond donors and acceptors that can pair when juxtaposed The Complementarity of DA Enables Error Correction = C - G C - G damage G -? C - G repair C - G Infer correct base since A pairs with T and G pairs with C 13
DA Replicates emi-conservatively ne strand of parental DA per daughter cell arental cell emi-conservative replication facilitates error correction by allowing cells to distinguish new and original DA strands RA tructure 4' 1' o methyl group 2' (D)-Ribose found in RA Uracil (RA only) 4' 1' 2' (D)-2' Deoxyribose found in DA 3 C Thymidine (DA only) RA and DA structure differ in two ways 14
RA Exhibits Great tructural Diversity epatitus delta virus RA ammerhead RA tra Tetrahymena rra Why Does DA Use Deoxyribose? A + lower A Faster DA - Intermolecular reaction slower - - RA - Intramolecular reaction faster - Intramolecular reactions are much faster than corresponding intermolecular reactions DA is more resistant to strand cleavage due to deoxyribose 15