Tex 25mer ssrna Binding Stoichiometry

Similar documents
According to the manufacture s direction (Pierce), RNA and DNA

SUPPLEMENTARY FIGURES

Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a

Acta Crystallographica Section D

Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc

SUPPLEMENTARY INFORMATION

Structure and RNA-binding properties. of the Not1 Not2 Not5 module of the yeast Ccr4 Not complex

A conserved P-loop anchor limits the structural dynamics that mediate. nucleotide dissociation in EF-Tu.

Data Sheet. Azide Cy5 RNA T7 Transcription Kit

Functional Genomics Research Stream

InDel 3-5. InDel 8-9. InDel 3-5. InDel 8-9. InDel InDel 8-9

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Phenol-Chloroform reagents. Selection guide. OH ; MW : High quality reagents for use in nucleic acid purification.

Marcin Nowotny, Sergei A. Gaidamakov, Rodolfo Ghirlando, Susana M. Cerritelli, Robert J. Crouch, and Wei Yang

Supplementary Figure 1. Aligned sequences of yeast IDH1 (top) and IDH2 (bottom) with isocitrate

SUPPLEMENTARY INFORMATION. Pistol Ribozyme Adopts a Pseudoknot Fold. Facilitating Site-specific In-line Cleavage

Analysis of nucleotide binding to p97 reveals the properties of a tandem AAA hexameric ATPase

Structural insights into energy regulation of light-harvesting complex from spinach CP29

Supplementary Figure 1 Pairing alignments, turns and extensions within the structure of the ribozyme-product complex. (a) The alignment of the G27

Supporting Information

Supplemental Materials and Methods

Figure 2. Amino acid sequence alignment of L-carbamoylases. A BLAST search was conducted with BsLcar sequence, using the UNIREF100 sequence cluster

08/21/2017 BLAST. Multiple Sequence Alignments: Clustal Omega

SUPPLEMENTARY INFORMATION

Supporting Information for: Kinetic Mechanisms Governing Stable Ribonucleotide Incorporation in Individual DNA Polymerase Complexes

Full-length GlpG sequence was generated by PCR from E. coli genomic DNA. (with two sequence variations, D51E/L52V, from the gene bank entry aac28166),

EST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.

The structure of the deubiquitinase USP15 reveals a misaligned catalytic triad and an open ubiquitin-binding channel

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Supporting Information

THE CRYSTAL STRUCTURE OF THE SGT1-SKP1 COMPLEX: THE LINK BETWEEN

Sequence Analysis '17- lecture 8. Multiple sequence alignment

Simulative and experimental characterization of a ph-dependent

Supporting information for

for Molecular Biology and Neuroscience and Institute of Medical Microbiology, Rikshospitalet-Radiumhospitalet

Protocol for 2D-E. Protein Extraction

SUPPLEMENTARY INFORMATION

Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27

DSC Characterization of the Structure/Function Relationship for Proteins

SUPPLEMENTARY FIGURES. Structure of the cholera toxin secretion channel in its. closed state

Department of Chemistry IIT Kharagpur. Biochemical Techniques Laboratory (CY49006)

Supporting Text Z = 2Γ 2+ + Γ + Γ [1]

Effects of Gap Open and Gap Extension Penalties

Reconfigurable DNA Origami Nanocapsule for ph- Controlled Encapsulation and Display of Cargo

Malachite Green Phosphate Detection Kit Catalog Number: DY996

Supplemental Data for: Direct Observation of Translocation in Individual DNA Polymerase Complexes

Supplementary Figure 1 Crystal packing of ClR and electron density maps. Crystal packing of type A crystal (a) and type B crystal (b).

SDS-polyacrylamide gel electrophoresis

Exquisite Sequence Selectivity with Small Conditional RNAs

Genomics and bioinformatics summary. Finding genes -- computer searches

SUPPLEMENTARY INFORMATION

A profile-based protein sequence alignment algorithm for a domain clustering database

Basics on bioinforma-cs Lecture 7. Nunzio D Agostino

An Efficient Algorithm for Protein-Protein Interaction Network Analysis to Discover Overlapping Functional Modules

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.

Meet Our Uncle: 12 Stability Applications on One Platform

2 Dean C. Adams and Gavin J. P. Naylor the best three-dimensional ordination of the structure space is found through an eigen-decomposition (correspon

Supplementary Figure 1. Stability constants of metal monohydroxides. The log K values are summarized according to the atomic number of each element

From Gen. Chem.: 1. WHAT is an ACID? 2. WHAT is a BASE?

Supplementary Figure 2. Negative stain EM reconstructions. 4

Controlling the Catalytic Functions of DNAzymes within Constitutional. Dynamic Networks of DNA Nanostructures

Programmed ph-driven Reversible Association and Dissociation of Inter-Connected. Circular DNA Dimer Nanostructures

A New Solvatochromic Fluorophore for Exploring Nonpolar Environments Created by Biopolymers

Qubit RNA IQ Assay Kits

SUPPLEMENTARY INFORMATION. doi: /nature07461

Supplemental data for

Locus specific chromatin purification protocol (optimized for Hela S3 telomeres).

Unit 1: Chemistry - Guided Notes

Previous Class. Reasons for analyzing pre-steady state conditions Methods for pre-steady state measurements. Today

Fluorescence Workshop UMN Physics June 8-10, 2006 Basic Spectroscopic Principles Joachim Mueller

Presentation Microcalorimetry for Life Science Research

General context Anchor-based method Evaluation Discussion. CoCoGen meeting. Accuracy of the anchor-based strategy for genome alignment.

Structural Mechanism for the Fidelity Modulation of DNA Polymerase λ. 128 Academia Road Sec. 2, Nankang, Taipei, 115, Taiwan

Supplementary Information. The Solution Structural Ensembles of RNA Kink-turn Motifs and Their Protein Complexes

Substrate and Cation Binding Mechanism of Glutamate Transporter Homologs Jensen, Sonja

RNA Labeling Kit. User Manual

Copy into Note Packet and Return to Teacher

Supplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

Supporting Information

BCHS 6229 Protein Structure and Function. Lecture 3 (October 18, 2011) Protein Folding: Forces, Mechanisms & Characterization

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1)

Structure and function of Hip, an attenuator of the Hsp70 chaperone cycle

RNA Polymerase I Contains a TFIIF-Related DNA-Binding Subcomplex

1) NMR is a method of chemical analysis. (Who uses NMR in this way?) 2) NMR is used as a method for medical imaging. (called MRI )

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Figure 2.1

Magnesium-dependent folding of self-splicing RNA: Exploring the link between cooperativity, thermodynamics, and kinetics

Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a ph-assisted and Surfactant-Free Route

UNIT 1: BIOCHEMISTRY

SUPPLEMENTARY INFORMATION

Supplementary Information. Overlap between folding and functional energy landscapes for. adenylate kinase conformational change

Structure and Function of Neisseria gonorrhoeae MtrF Illuminates a Class of Antimetabolite Efflux Pumps

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Isothermal Titration Calorimetry in Drug Discovery. Geoff Holdgate Structure & Biophysics, Discovery Sciences, AstraZeneca October 2017

Small RNA in rice genome

Some Problems from Enzyme Families

1. (5) Draw a diagram of an isomeric molecule to demonstrate a structural, geometric, and an enantiomer organization.

Supporting Information. Molecular Engineering of Acoustic Protein Nanostructures

Cross talk between the 173/294 interaction and the cleavage site in RNase P RNA mediated cleavage

Z -LYTE Assay Setup Guide on the BMG LABTECH CLARIOstar Reader

Transcription:

Figure S. Determination of Tex:2nt ssrna binding stoichiometry using fluorescence polarization. Fluorescein labeled RNA was held at a constant concentration 2-fold above the K d. Tex protein was titrated in at increasing concentration. An inflection point representing the molar ratio where the binding sites have become saturated occurs at equimolar concentrations of Tex and 2nt ssrna indicating a : binding stoichiometry. The assay was performed in mm Tris 7., mm NaCl, % glycerol and measured using a Tecan fluorimeter. 2 Tex 2mer ssrna Binding Stoichiometry 9 mp (arbitrary units) 7 3 9 7.... 2. 2. 3. [Tex]/[RNA] (mm)

Figure S2. Tex does not appear to have nuclease activity. WT Tex was assayed in a time course experiment in parallel with RNase T, Micrococcal Nuclease, and the Tex YqgF domain active site mutant E33A/D42A. In the assay, the Tex proteins were at a molar concentration x that of Micrococcal Nuclease. Substrate used in this assay is a radio-labeled 3 nt single-stranded RNA and the assay was performed in mm Tris 7., mm NaCl, % glycerol, 3mM MgCl2, mm CaCl2 at 37 C. Reactions were quenched by the addition of an equal volume of phenol/chloroform ph 6.6 and 2mM EDTA. Samples were spun down and the aqueous phase extracted and mixed with 2x formamide loading dye. Samples were run on a 2% acrylamide (9:)/7M Urea denaturing gel in TBE buffer and the gel was scanned using a TYPHOON imaging system (GE Healthsciences). Time (min) No Protein RNase T Micrococcal Nuclease WT Tex E33A/D42A Tex

Figure S3. Predicted sites of sequence insertion for Spt6, with respect to the Tex structure. Front (A) and back (B) stereo views of the Tex structure. Highlighted regions (purple) indicate sites where additional sequence exists in Spt6 when aligned with Tex sequences. All highlighted regions lie on the surface of the Tex structure and appear to be able to accommodate additional sequence without disrupting the core structural scaffold. A B

Figure S4. Amino acid sequence alignment of Tex (P. aeruginosa) and Spt6 (S. cerevisiae). Observed Tex secondary structure is indicated above the Tex sequence. Highlighted regions indicate identical (red) and similar (yellow) residues. Sequence alignment was performed using ClustalW. Figure was created using ESPript. 2...................................................................... Spt6-Full_Length-S._cerevisiae M D Y K D D D D K T R E E T G D S K L V P R D E E E I V N D N D E T K A P S E E E E G E D V F D S S E E D E D I D E D E D E A R K V Q E G F 2 2 3 3 4 4 6 6 7...................................................................... Spt6-Full_Length-S._cerevisiae 7 I V N D D D E N E D P G T S I S K K R R K H K R R E R E E D D R L S E D D L D L L M E N A G V E R T K A S S S S G K F K R L K R V G D E G N 7 8 8 9 9 2 2 3 3 4...................................................................... Spt6-Full_Length-S._cerevisiae 4 A A E S E S D N V A A S R Q D S T S K L E D F F S E D E E E E E S G L R N G R N N E Y G R D E E D H E N R N R T A D K G G I L D E L D D F I 4 6 6 7 7 8 8 9 9 2 2 2...................................................................... Spt6-Full_Length-S._cerevisiae 2 E D D E F S D E D D E T R Q R R I Q E K K L L R E Q S I K Q P T Q I T G L S S D K I D E M Y D I F G D G H D Y D W A L E I E N E E L E N G N 2 2 2 2 2 2 3 2 3 2 4 2 4 2 2 2 6 2 6 2 7 2 7 2 8 H............................................ M D S I N T R I A E E L S A L P S......... Spt6-Full_Length-S._cerevisiae 28 D N N E A E E E E I D E E T G A I K S T K K K I S L Q D I Y D L E D L K K N L M T E G D M K I R K T D I P E R Y Q E L R A G I T D Y G N M S consensus>7............................................ M.... T. I. E.... L........... 2 8 2 9 2 9 3 3 3 3 3 2 3 2 3 3 3 3 3 4 3 4 3 H2 H3 H4 8............................ G R V Q P Q Q V A A A V A L L D E G S T V P F I A R Y R K E V T G S....... L Spt6-Full_Length-S._cerevisiae 3 S E D Q E L E R N W I A E K I S V D K N F D A N Y D L T. E F K E A I G N A I K F I T K E N L E V P F I Y A Y R R N Y I S S R E K D G F L L consensus>7..................................... A...... E... V P F I.. Y R. #... S....... L 3 3 6 3 6 3 7 3 7 3 8 3 8 3 9 3 9 4 4 4 4 4 2 H H6 H7 3 D D T Q L R M L E E R L R Y L R E L E E R R G A I L A S I E E Q G..... K L T P E L A R D I K L A D T K T R L E D L Y L P Y K Q K R.. Spt6-Full_Length-S._cerevisiae 42 T E D D L W D I V S L D I E F H S L V N K K D Y V Q R F Y A E L H I D D P I V T E Y F K N Q N T A S I A E L N S L Q D I Y D Y L E F K Y A N consensus>7. #. # L............ L. #....!..... E............... #......... L # D. Y..... K... 4 2 4 3 4 3 4 4 4 4 4 4 4 6 4 6 4 7 4 7 4 8 4 8 4 9 H8 H9 H..... 6................... R T K G Q I A L E A G L G A L A D A L F D D P. T L V P E S E A A R F V D A E K G F A D V K..... Spt6-Full_Length-S._cerevisiae 49 E I N E M F I N H T G K T G K K H L K N S S Y E K F K A S P L Y Q A V S D I G I S A E D V G E N I S S Q H Q I H P P V D H P S S K P V E V I consensus>7....................... #...... L................ #......!......... K..... 4 9 2 2 3 3 4 4 6................... H H2 β 6................... A V L E G A K Y I L M E R F A E D A T L L D K L R V F M K N E A T L T A R V V P.... G K E Q E G A Spt6-Full_Length-S._cerevisiae 6 E S I L N A N S G D L Q V F T S N T K L A I D T V Q K Y Y S L E L S K N T K I R E K V R S D F S K Y Y L A D V V L T A K G K K E I Q K G S L consensus>7...................... #............ #.... # K. R..................... #.... 6 7 7 8 8 9 9 6 6 6 6 6 2 6 2 6 3 β2 H3 β3. H4 28 K F S D Y F E H D E P L K S A P S H R A L A I F R G R N E G V L S A S L K V G. E E A P G T L H P. C E V M IA E R F G L S N Q G R A A D K Spt6-Full_Length-S._cerevisiae 63 Y E D I K Y A I N R T P M H F R R D P D V F L K M V E A E S L N L L S V K L H M S S. Q A Q Y I E H L F Q I AL E T T N T S D I A I E W N N consensus>7..... %.. #................... E..... S. K................... E.... S #..... #. 6 3 6 4 6 4 6 6 6 6 6 6 6 7 6 7 6 8 6 8 6 9 6 9 7 H β4 276 W L A E V V R W T W K V K L Y T H L E T D L F G E L R D G A E D E A I S V F A R N L H D L L L A A P A G P........... R A T L G L Spt6-Full_Length-S._cerevisiae 699 F R K L A F N Q A M D K. I F Q D I S Q E V K D N L T K N C Q K L V A K T V R H K F M T K L D Q A P F I P N V R D P K I P K I L S L T C G Q consensus>7.............. %..... #... # L.... #.............. L.. A P.. P............. T. G. 7 7 7 7 2 7 2 7 3 7 3 7 4 7 4 7 7 7 6 7 6 7 7

β β6 H6 β7 33 D P G L R T G V K V A V V D A T G K L L D T A T V Y P H A P K N Q.... W D Q T L A V L A A L C A K H Q V E L I A I G N...... G T A Spt6-Full_Length-S._cerevisiae 768 G R F G A D A I I A V Y V N R K G D F I R D Y K I V D N P F... D K T N P E K F E D T L D N I I Q S C Q P N A I G I N G P N P K T Q K F Y consensus>7.......!.... V #.. G.......!............. #..... L....... Q. #. I. I........... 7 7 7 8 7 8 7 9 7 9 8 8 8 8 8 2 8 2 8 3 8 3 8 4 H7 β8 H8 H9 H2 H2 39 S R E T D K L A G E L I K K Y P G M K L T K I M V S E A G A S V Y S A S E L A A K E F P E L D V S L R G A V S I A R R L Q D P L A E L V K I Spt6-Full_Length-S._cerevisiae 83 K R L Q E V L H K K Q I V D S R G H T I P I I Y V E D E V A I R Y Q N S E R A A Q E F P N K P P L V K Y C I A L A R Y M H S P L L E Y A N L consensus>7. R.. #. L.... I.... G..... I. V. #.. A.. Y.. S E. A A. E F P #........!.. A R. $.. P L. E.... 8 4 8 8 8 6 8 6 8 7 8 7 8 8 8 8 8 9 8 9 9 9 9 H22 H23 β9 H24 H2 46 E P... K S I G V G Q Y Q H D V S Q L K L A R S L D A V V E D C V N A V G V D V N T A S..... A A L L A R I S G L N S T L A Q N I V A Spt6-Full_Length-S._cerevisiae 9 T S E E V R S L S I H P H Q N L L S S E Q L S W A L E T A F V D I V N L V S V E V N K A T D N N Y Y A S A L K Y I S G F G K R K A I D F L Q consensus>7...... S..!... Q... S... L... L #.... D. V N. V. V # V N. A...... A.. L.. I S G..... A. #... 9 9 2 9 2 9 3 9 3 9 4 9 4 9 9 9 6 9 6 9 7 9 7 9 8 H26 H27 β H28 H29 27 H R D A. N G A F R T R D E L K K V S R L G E K T F E Q A A G F L R V M N G.......... D N P L D A S A V H P E T Y P L V Q R I AA Spt6-Full_Length-S._cerevisiae 97 S L Q R L N E P L L A R Q Q L I T H N I L H K T I F M N S A G F L Y I S W N E K R Q K Y E D L E H D Q L D S T R I H P E D Y H L A T K V AA consensus>7.. #.. N..... R # # L..... L.... F. #. A G F L.!.............. #. L D...! H P E. Y. L...! A A 9 8 9 9 9 9 2 2 3 3 4 4 H3.................. H3 H32 H33 86 D T E R D I R S.................. L I G D.. S A F L K R L D P K K F T D E T...... F G L P T V T D I L K E L D K P Spt6-Full_Length-S._cerevisiae 4 D A L E Y D P D T I A E K E E Q G T M S E F I E L L R E D P D R R A K L E S L N L E S Y A E E L E K N T G L R K L N N L N T I V L E L L D G consensus>7 D................................ A. L.. L #... %. # E......... L..... I.. E L... 6 6 7 7 8 8 9 9 2 H34 β β2..... β3 H3 63 G R D P R P E F K T A E F Q E G V E S L K D L K P G M V L E G V V T N V T N F G..... A F V D I G V H Q D G L V H I S A L S E K F V K D Spt6-Full_Length-S._cerevisiae F E E L R N D F H P L Q G D E I F Q S L T G E S E K T F F K G S I I P V R V E R F W H N D I I C T T N S E V E C V V N A Q R H A G A Q L R R consensus>7.. #. R. # F... #. # E.. # S L.......... G.!.. V.................. #.. V............ 2 3 3 4 4 6 6 7 7 8 8 9 H36. β4 β 69 P Y. E V V K A G D I V K V K V M E V D I P R N R V G L S M R M S D T P G E K V E G Q R G G R P T G S. G Q P R Q E R G A P R G Q S A P P A Spt6-Full_Length-S._cerevisiae 8 P A N E I Y E I G K T Y P A K V I Y I D Y A N I T A E V S L L D H D V K Q Q Y V P. I S Y S K D P S I W D L K Q E L E D A E E E R K L M M A consensus>7 P.. E!... G..... K V..! D........ S $... D... #. V................ #... A........ A 9 2 2 2 2 2 2 2 2 2 3 2 3 2 4 2 4 2 2 2 6 763 N N A M A A L F A N A K Q L K K K..................................................... Spt6-Full_Length-S._cerevisiae 24 E A R A K R T H R V I N H P Y Y F P F N G R Q A E D Y L R S K E R G E F V I R Q S S R G D D H L V I T W K L D K D L F Q H I D I Q E L E K E consensus>7 #..................................................................... 2 6 2 7 2 7 2 8 2 8 2 9 2 9 3 3 3 3 3 2 3 2 3 3...................................................................... Spt6-Full_Length-S._cerevisiae 324 N P L A L G K V L I V D N Q K Y N D L D Q I I V E Y L Q N K V R L L N E M T S S E K F K S G T K K D V V K F I E D Y S R V N P N K S V Y Y F 3 3 3 4 3 4 3 3 3 6 3 6 3 7 3 7 3 8 3 8 3 9 3 9 4.................................................................... Spt6-Full_Length-S._cerevisiae 394 S L N H D N P G W F Y L M F K I N A N S K L Y T W N V K L T N T G Y F L V N Y N Y P S V I Q L C N G F K T L L K S N S S K N R M N N Y R consensus>7.................................................................... 4 4 4 4 2 4 2 4 3 4 3 4 4 4 4 4 4 4 6 4 6 References. Higgins D., Thompson J., Gibson T., Thompson J.D., Higgins D.G., Gibson T.J. (994). CLUSTAL W: improving the sensitivity of progressivemultiple sequence alignment through sequence weighting,position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673-468. 2. Gouet, P., Courcelle, E., Stuart, D. I. & Metoz, F. (999). ESPript: multiple sequence alignments in PostScript. Bioinformatics, 3-38.

2024 © sciencedocbox.com Privacy Policy | Terms of Service | Feedback