DOI: 1.138/nc8 Top-GFP!-ctenin GFP Intensity 3 1 1 3 5 6 7 8 Nucler Bet-Ctenin c MUC FABP KRT 8 5 3 6 15 1 5 LGR5 ASCL AXIN 15 5 15 5 Figure S1 TOP-GFP expression nd reltion with nucler β-ctenin, wnt trgets nd differentition mrkers. () Co-immunostining of TOP-GFP spheroid culture with GFP nd β-ctenin ntiody demonstrtes cler correltion etween TOP-GFP levels nd nucler locliztion of β-ctenin (scle r, 5µm), quntifiction shown in (). (c) Microrry nlysis of specific gene-set in high, intermedite nd low TOP-GFP cell 15 5 frctions indictes grdul increse in differentition mrker expression nd decrese in Wnt trget gene expression from to popultions (Ech ox plot represents miniml of two dt points from seprte single-cell cloned TOP-GFP CSC cultures). Genes were picked sed on significnt differences oserved in Fig 1d. www.nture.com/nturecelliology 1 1 Mcmilln Pulishers Limited. All rights reserved.
18 6 TOP-GFP Low 1 in every 3 16 8 Apo.1.A Apo.1.B Apo.1.C Top-GFP ki67 * * Figure S Limiting dilution on vrious clones, Ki-67 stining. () Limiting dilution ssy nd clonogenic potentil of 3 independent lines derived from the sme ptient s Apo.1 (Apo.1.A, Apo.1.B nd Apo.1.C). Errors rs represent 95% CI. Representtive exmples re shown. See Methods for detils on limiting dilution ssys. () Ki-67 co-stining with GFP in TOP-GFP xenogrfts. Ki-67 positivity encompsses oth GFP positive nd negtive cells. Scle r, µm. www.nture.com/nturecelliology 1 Mcmilln Pulishers Limited. All rights reserved.
"-SMA EGF/FGF FCS FCS + 18Co FCS + c GF FCS Muc FABP Figure S3 Myofirolsts prevent differentition of colon CSCs. () Immunohistochemistry for α-sma shows myofirolsts in the strom of primry humn colorectl mlignncies. (Scle r, 5µm) () Phse rst pictures to show morphologicl differentition of CSC. Upper left represents spheroid culture growing in medium ining EGF nd FGF, upper right is fter differentition in % FCS. Lower left is differentition with % FCS, ut plted on myofirolsts (18Co) nd lower right is differentition with FCS in the presence of. (Scle r, µm) (c) Immunofluorescence for FABP nd Muc on cytospins of spheroid cells (EGF/FGF) or cells induced to differentite with % FCS in the sence (middle) or presence of (right). (Scle r, µm) www.nture.com/nturecelliology 3 1 Mcmilln Pulishers Limited. All rights reserved.
3 Reltive spot intensity Co Co MCP-1 TIMP-1 TIMP- GRO IGFBP-1 Osteoprotegerin Eotxin IL-8 8 GRO-lph rol Angiogenin PARC IGFBP- MIP-3-lph IL-7 MCP- c-met IL-6 IL-3 c-met % of Mx 6 gpdh 1 1 3 1 1 5 APC-A c 5 1 3 CSC med 5 1 3 rol 1 3 + PHA 1 3 + PHA 15 p-met 15 p-met 5 5 5!-ctin 5!-ctin 5 5 Figure S Myofirolsts produce nd humn colon CSCs express c-met. () A grph depicting the detected secreted fctors in (see Methods for detils). () PCR showing expression of c-met in spheroid cultured colon CSCs. Right pnel shows FACS nlysis for c-met. (red; ckground nd lue; c-met) (c) Full lot of phospho-c-met nd β-ctin of Co stimulted with 18Co conditioned medium () or CSC rol medium for the time indicted. www.nture.com/nturecelliology 1 Mcmilln Pulishers Limited. All rights reserved.
Reltive Luciferse Intensity 6 TOP DLD1 FOP + PHA + PHA PHA Reltive Luciferse Intensity 3 1 TOP HCT116 FOP + PHA + PHA PHA Reltive Luciferse Intensity 3 1 TOP HT9 FOP + PHA + PHA PHA Reltive Luciferse Intensity 3 1 TOP LM5 FOP + PHA + Antiody Figure S5 TOP/FOP ssy on vrious lines nd with vrious conditions. Depicted re the results of TOP/FOP ssys on different humn colon cncer lines including severl estlished colorectl cncer lines (DLD1, HCT116, HT9). LM5 is liver metstsis derived primry CSC line. The stimultory effect of is dependent. Error rs represent SEM (n=3), dt from t lest replictes is shown. www.nture.com/nturecelliology 5 1 Mcmilln Pulishers Limited. All rights reserved.
CRC1 CRC CRC3 CRC CRC5 CRC6 Norml DAPI "SMA "-SMA Desmin Vimentin c 18Co MF9 18Co MF-9 MF-66 H O!-ctin MF66 Figure S6 Humn colon crcinom ssocited myofirolsts express. Six different humn primry colorectl cncer specimens nd one norml humn colon specimen ws stined for oth nd α-sma. In out of 6 smples we detected in α-sma-positive cells. Scle Brs, 5µm. () Both n estlished colon myofirolst line (18Co) s well s two primry lines (MF9, MF66) isolted from colorectl cncer ptients express mrkers ssocited with myofirolsts (Scle rs, µm) nd revel production y (c) PCR. 6 www.nture.com/nturecelliology 1 Mcmilln Pulishers Limited. All rights reserved.
Correspond to Fig.5 h Correspond to Fig.5 i h h 8h 16h 15 5 met 15 5 p-met 15 5 p-!-ct (S55) 5 p-kt (S73) 5 kt 15 5!-ct 5 p-gsk3! (S9) 5 Gsk3! 5 5 15 15 p-!-ct (T1/S5)!-ct Figure S7 Full lots. Represented re the full Western lots of Fig. 5h nd i. www.nture.com/nturecelliology 7 1 Mcmilln Pulishers Limited. All rights reserved.
Tle S1 Genes showing most differentil expression etween nd cell popultions. A list of the most differentilly regulted genes in the versus frctions from two different single cell cultures is summrized in Tle S1, indicted vlues represent Log foldchnges. Tle S List of primers used in this study. Tle S1 Gene Proeset G7 A FABP1 589_s_t -.9-1.7 AKR1B1 6561_s_t -.6 -.5 MUC 673_t -3.6-1.8 ST6GALNAC1 775_t -3. -1.5 GCNT3 1958_t -.7-1.3 SPINK 71_t -. -1.5 HEPACAM 61_t -1.9-1.7 GMPR 187_t 1.8 1.5 CAB39L 5915_t.3 1. TSPAN5 989_t.5 1.5 NEURL1B 5355_t.7 1.3 TUBBB 13_x_t.8 1.6 LGR5 1388_t.9 1.3 SERPINI1 535_t 3. 1.9 LEF1 1558_s_t 3. 1.6 LRP 185_s_t 3.1 1. CXCR 178_t 3.3.7 SP5 3585_t 3.7 1.9 DEFA5 9_t 5.1 3.9 APCDD1 516_t 5..3 Tle S Primers Sequences Fwd Rev Lgr5 CTGCCTGCAATCTACAAGGT CCCTTGGGAATGTATGTCAGA Survivin GCCCAGTGTTTCTTCTGCTT CCGGACGAATGCTTTTTATG Axin CTCCTTATCGTGTGGGCAGT CTTCATCCTCTCGGATCTGC Muc CGAAACCACGGCCACAACGT GACCACGGCCCCGTTAAGCA Krt TGTCCTGCAAATTGATAATGCT AGACGTATTCCTCTCTCACTCTCATA Fp TGGAAGGTAGACCGGAGT AGGTCCCCCTGAGTTCAGTT c-met CTGCCTGCAATCTACAAGGT ATGGTCAGCCTTGTCCCTC Hgf CCTATTTCTCGTTGTGAAGGT TGTTTCGTTTTGGCACAAGA!-ctin ATGGAAGAAGAGATCGCCGC TCGTAGATGGGCACCGTGTG 8 www.nture.com/nturecelliology 1 Mcmilln Pulishers Limited. All rights reserved.