Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011) /tpc

Similar documents
Supplemental Data. Perea-Resa et al. Plant Cell. (2012) /tpc

Supplemental Data. Perrella et al. (2013). Plant Cell /tpc

** * * * Col-0 cau1 CAU1. Actin2 CAS. Actin2. Supplemental Figure 1. CAU1 affects calcium accumulation.

SUPPLEMENTARY INFORMATION

Supplementary Figure S1. Amino acid alignment of selected monocot FT-like and TFL-like sequences. Sequences were aligned using ClustalW and analyzed

Nature Genetics: doi: /ng Supplementary Figure 1. The phenotypes of PI , BR121, and Harosoy under short-day conditions.

Supplementary Figure 1

Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day

Supplementary Figure 1. Phenotype of the HI strain.

SUPPLEMENTARY INFORMATION

Ethylene is critical to the maintenance of primary root growth and Fe. homeostasis under Fe stress in Arabidopsis

Supplemental Table 1. Primers used for cloning and PCR amplification in this study

Supplemental Data. Gao et al. (2012). Plant Cell /tpc

Table S1 List of primers used for genotyping and qrt-pcr.

** LCA LCN PCA

GFP GAL bp 3964 bp

Supplemental Data. Chen and Thelen (2010). Plant Cell /tpc

Supplemental Data. Wang et al. (2014). Plant Cell /tpc

Penghui Li, Beibei Chen, Gaoyang Zhang, Longxiang Chen, Qiang Dong, Jiangqi Wen, Kirankumar S. Mysore and Jian Zhao

Figure 1. Identification of UGT74E2 as an IBA glycosyltransferase. (A) Relative conversion rates of different plant hormones to their glucosylated

Supporting Online Material for

Supplementary Figure 1 Characterization of wild type (WT) and abci8 mutant in the paddy field.

Supplementary Materials for

Nature Genetics: doi: /ng Supplementary Figure 1. ssp mutant phenotypes in a functional SP background.

Supplemental Data. Hou et al. (2016). Plant Cell /tpc

Supplemental Data. Yang et al. (2012). Plant Cell /tpc

EST1 Homology Domain. 100 aa. hest1a / SMG6 PIN TPR TPR. Est1-like DBD? hest1b / SMG5. TPR-like TPR. a helical. hest1c / SMG7.

Ron et al SUPPLEMENTAL DATA

23-. Shoot and root development depend on ratio of IAA/CK

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Development 143: doi: /dev : Supplementary information

Supplemental Data. Yamamoto et al. (2016). Plant Cell /tpc WT + HCO 3. slac1-4/δnc #5 + HCO 3 WT + ABA. slac1-4/δnc #5 + ABA

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

PYR1 PYL1 PYL2 PYL3 PYL4 PYL5 PYL6 PYL7 PYL8 PYL9 PYL10 PYL11/12

SUPPLEMENTARY INFORMATION

Supplemental material

cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work cote cote-yfp spc This work

EXPRESSION OF THE FIS2 PROMOTER IN ARABIDOPSIS THALIANA

JMJ14-HA. Col. Col. jmj14-1. jmj14-1 JMJ14ΔFYR-HA. Methylene Blue. Methylene Blue

Supplementary Figure 1. Nature Genetics: doi: /ng.3848

GFP WxTP-GFP WxTP-GFP. stromules. DsRed WxTP-DsRed WxTP-DsRed. stromules

Heterosis and inbreeding depression of epigenetic Arabidopsis hybrids

Supplementary Figure 1. Real time in vivo imaging of SG secretion. (a) SGs from Drosophila third instar larvae that express Sgs3-GFP (green) and

Lipid transfer proteins confer resistance to trichothecenes

Supplemental Data. Lermontova et al. (2013). Plant Cell /tpc


. Supplementary Information

Photoreceptor Regulation of Constans Protein in Photoperiodic Flowering

Life in an unusual intracellular niche a bacterial symbiont infecting the nucleus of amoebae

Nature Genetics: doi: /ng Supplementary Figure 1. The FIN and FAB genes act separately from the meristem maturation pathway.

Supp- Figure 2 Confocal micrograph of N. benthamiana tissues transiently expressing 35S:YFP-PDCB1. PDCB1 was targeted to plasmodesmata (twin punctate

Supporting Online Material

Supplemental Figure 1. Comparison of Tiller Bud Formation between the Wild Type and d27. (A) and (B) Longitudinal sections of shoot apex in wild-type

SUPPLEMENTAL MATERIAL

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

SUPPLEMENTARY INFORMATION

Arabidopsis COMPASS-Like Complexes Mediate Histone H3 Lysine-4 Trimethylation to Control Floral Transition and Plant Development

Supplementary Figure 1. Nature Biotechnology: doi: /nbt.4067

Supplemental material

SUPPLEMENTARY INFORMATION

concentration ( mol l -1 )

SUPPLEMENTARY INFORMATION

Supplementary Information for. Single-cell dynamics of the chromosome replication and cell division cycles in mycobacteria

Maria V. Yamburenko, Yan O. Zubo, Radomíra Vanková, Victor V. Kusnetsov, Olga N. Kulaeva, Thomas Börner

Genetic interaction and phenotypic analysis of the Arabidopsis MAP kinase pathway mutations mekk1 and mpk4 suggests signaling pathway complexity

Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles

Postdoc Fellowships for non-eu researchers. Final Report

DIA-Umpire: comprehensive computational framework for data independent acquisition proteomics

SUPPLEMENTARY INFORMATION

Characterisation of abiotic stress inducible plant promoters and bacterial genes for osmotolerance using transgenic approach

Transitivity-dependent and transitivity-independent cell-to-cell movement of RNA

Supporting Information

Figure S1. Programmed cell death in the AB lineage occurs in temporally distinct

Genomics and bioinformatics summary. Finding genes -- computer searches

Model plants and their Role in genetic manipulation. Mitesh Shrestha

Biological Roles of Cytokinins

TCP Transcription Factors Link the Regulation of Genes Encoding Mitochondrial Proteins with the Circadian Clock in Arabidopsis thaliana W OA

Supporting Information

Measuring TF-DNA interactions

School of Life Sciences, Tsinghua University, Beijing , China b. College of Animal Sciences, Zhejiang University, Hangzhou , China

By Jonathan I. Watkinson. Virginia Polytechnic Institute and State University. Doctor of Philosophy Horticulture

GENETIC ANALYSES OF ROOT SYSTEM DEVELOPMENT IN THE TOMATO CROP MODEL

Heterozygous BMN lines

SUPPLEMENTARY INFORMATION

BLAST. Varieties of BLAST

Supplementary Information

Supporting online material

HRS1 Acts as a Negative Regulator of Abscisic Acid Signaling to Promote Timely Germination of Arabidopsis Seeds

SUPPLEMENTARY INFORMATION

Supplementary Figure 3

Supplementary Methods

Supplemental Figures. Supplemental Data. Sugliani et al. Plant Cell (2016) /tpc Clades RSH1. Rsh1[HS] RSH2 RSH3. Rsh4[HS] HYD TGS ACT

Regulation of the anthocyanin biosynthetic pathway by the TTG1/bHLH/Myb transcriptional complex in Arabidopsis seedlings

Supplementary Figure 1: To test the role of mir-17~92 in orthologous genetic model of ADPKD, we generated Ksp/Cre;Pkd1 F/F (Pkd1-KO) and Ksp/Cre;Pkd1

Evolution, Expression Differentiation and Interaction Specificity of Heterotrimeric G-Protein Subunit Gene Family in the Mesohexaploid Brassica rapa

Supplementary Materials for

Comparative Protein Modeling of Superoxide Dismutase Isoforms in Maize.

Three Myosins Contribute Uniquely to the Assembly and Constriction of the Fission Yeast Cytokinetic Contractile Ring

Transcription:

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 Supplemental Figure S1. Phylogenetic tree of MYC2-related proteins from Arabidopsis and other plants. Phenogram representation of the Maxima Parsimonia method for 17 Arabidopsis, 1 Populus, 1 Rice and 1 Physcomitrella MYC2 bhlh-related proteins. Sequenced alignment was generated using multiple alignment ClustalW algorithm (T-Coffee web server, (http://tcoffee.vital-it.ch) and the tree was created by MEGA4 program. Bootstrap values based on 100 replicates (from 10000 trials) are shown. The alignment used to generate this tree is available as Supplemental Data set 1 online. 1

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 pdest32 JAZ12 JAZ11 JAZ10 JAZ9 JAZ8 JAZ7 JAZ6 JAZ5 JAZ4 JAZ3 JAZ2 prey JAZ1 bait MYC2 MYC3 1 MYC4 bhlh028 MYC2 1/10 MYC3 MYC4 bhlh028 Supplemental Figure 2. Control growth of yeast cells transformed with MYC3 or MYC4 and with JAZ repressors in yeast two-hybrid assays. Yeast cells co-transformed with pdest22-myc2, pdest22-myc3, pdest22-myc4 or pdest22-bhlh028 (preys) and pdest32-jaz1-12 (baits) were selected and subsequently grown on yeast synthetic dropout lacking Leu and Trp (-2), as a transformation control. 2

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 JID bhlh A * MYC2 MYC3 MYC4 bhlh028 Os10g0575000 Populus P.patens Consensus 69 92 93 JID (JAZ interaction domain) 154 159 Activation Domain 188 B At1g32640/MYC2 At5g46760/MYC3 At4g17880/MYC4 At5g46830/BHLH028 AT5G41315/GL3 At1g63650/EGL3 AT4G09820/TT8 At1g01260/BHLH013 At2g46510/ATAIB At4g16430/BHLH003 consensus 93 JID 188 Figure S3. Alignment of the JAZ-interaction domain of MYC2-related proteins. (A) Aligned sequences of JAZ interacting domain of MYC2, MYC3, MYC4 and At5g46830 from Arabidopsis and MYC2-closest relatives from Rice (NM_001072010), Populus (XM_002329476.1) and Physcomitrella patens (XM_001765109). The alignment was created with T-Coffee web server (http://tcoffee.vital-it.ch) using the multiple aligment ClustalW algorithm. Residues conserved in all three proteins are labelled by asterisks, whereas dots indicate residues belonging to the same functional group. The non-conservative change (G-K) in At5g46830 is highlighted with a red square and a red asterisk. 3 (B) Sequences of the JAZ-interaction domain (JID) of several bhlh proteins of A. thaliana: MYC2, MYC3, MYC4,At5g46830 (BHLH028), At5g41315 (GL3), At1g63650 (EGL3), At4g09820 (TT8), At1g01260 (BHLH013), At2g46510 (AtAIB) and At4g16430 (BHLH003). Sequence alignment was generated as in (A).

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 35S:MYC3-GFP 35S:MYC4-GFP Supplemental Figure 4. MYC3 and MYC4 are nuclear-localized bhlh. Confocal microscope visualization of nuclear-localized MYC4-GFP and MYC3- GFP fusion proteins in the roots of 35S:MYC4-GFP (upper panels) and 35S:MYC3-GFP (lower panels) transgenic Arabidopsis seedlings. Superimposed images from UV (left panels) and visible lights allow the co-localization of GFP with nuclei of Arabidopsis root cells (right panels). 4

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 MYC Relative Expression 9 8 7 6 5 4 3 2 1 0 MYC2 MYC3 MYC4 WT 1h WT 6h WT 24h Supplemental Figure 5. JA dependent induction of MYC3 and MYC4 gene expression. Quantitative RT-PCR analysis of MYC2, MYC3 and MYC4 JA-dependent induction. 8- day-old WT (Col0) seedlings were assayed for the expression of these three genes in a timecourse experiment (1, 6 and 24 hours) in response to 50 µm JA. The measurements (three technical replicates) represent the ratio between mock and treated (50 µm JA) plants and the level of each gene is relative to ACTIN8. Error bars represent standard deviation. 5

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 MYC2 MYC3 MYC4 Supplemental Figure 6. MYC2, MYC3 and MYC4 tissue expression patterns. Genevestigator (www.genevestigator. com) array data of MYC2, MYC3 and MYC4 expression levels in different Arabidopsis thaliana tissues and developmental stages. The tissue specific expression of MYC3 and MYC4 is in agreement with our experimental data (described in figure 6 and highlighted here in black boxes). 6

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc.110.080788 A 1,2 MYC2 Relative Expression 1,0 0,8 0,6 0,4 0,2 * B MYC3 Relative Expression 0,0 1,2 1,0 0,8 0,6 0,4 0,2 WT myc3 myc4 * * * * 0,0 WT myc2 myc4 C MYC4 Relative Expression 1,4 1,2 1,0 0,8 0,6 0,4 0,2 0,0 * * *** *** WT myc2 myc3 Supplemental Figure 7. Expression of MYC genes in myc mutant backgrounds. MYC2, MYC3 and MYC4 expression was analyzed in WT (Col-0) and mutant backgrounds myc2, myc3 and myc4. Quantitative RT-PCR measurements were carried out in 8-days-old seedlings growing in control media. Measurements (three technical replicates) represent the level of each gene relative to ACTIN8 normalized to WT (Col-0) values. Error bar represent standard deviation and asterisks indicate statistically significant differences compared to Col-0 (Student's t test, * P< 0.05, ** P< 0.01, *** P< 0.001).. 7

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011. 10.1105/tcp.110.080788 Supplemental Table 1. MALDI-TOF/TOF-MS identification of MYC2, MYC3, MYC4, JAZ3 and JAZ5 interactors. Bait Prey PMF data MSMS data # Found/ Database Protein RMS error Sequence Unique Total Peptide Variable Bait Prey Locus Prey Name # exp version Score Expect (ppm) coverage % Peptides Ion Score Number Start End Observed Mr(Exp) Mr(Calc) Delta Miss Ions Score Expect Peptide Modification MYC2 AT1G32640 MYC2 (BAIT) 3/3 TAIR8 725 1,00E-68 5 27 15 621 1 341 347 885,42 884,41 884,41 0,00 0 43 5,70E-04 K.FNNTFSR.E 2 608 615 1050,56 1049,55 1049,55 0,00 0 46 7,00E-04 R.IYTQEQLR.A 3 552 560 1090,57 1089,56 1089,56 0,00 0 25 1,10E-01 K.IIGWDAMIR.V Oxidation (M) 4 363 375 1421,70 1420,69 1420,69 0,00 1 79 3,60E-07 R.SGEILNFGDEGKR.S 5 513 525 1498,82 1497,81 1497,82 0,00 1 70 1,40E-06 K.NQLEEVKLELAGR.K 6 484 498 1590,87 1589,86 1589,87-0,01 0 108 2,40E-10 K.ASLLGDAIAYINELK.S 7 376 395 2185,98 2184,97 2184,97 0,00 1 101 6,30E-10 R.SSGNPDPSSYSGQTQFENKR.K 8 186 208 2356,06 2355,06 2355,05 0,00 0 68 1,70E-06 K.AFATGNAVWVSGSDQLSGSGCER.A 9 211 239 2983,49 2982,48 2982,47 0,02 0 83 5,70E-08 K.QGGVFGMHTIACIPSANGVVEVGSTEPIR.Q MYC2 AT5G46760 MYC3 3/3 TAIR8 404 1,30E-36 6 25 11 338 1 192 201 1034,56 1033,56 1033,56 0,00 0 63 1,21E-05 R.AGQGQIYGLK.T 2 324 333 1091,60 1090,59 1090,60-0,01 0 66 6,10E-06 K.DLTFQGGLLK.S 3 518 526 1102,61 1101,60 1101,60 0,00 0 26 6,50E-02 K.IIGWDVMIR.V 4 518 526 1118,60 1117,59 1117,60 0,00 0 24 1,09E-01 K.IIGWDVMIR.V Oxidation (M) 5 570 581 1451,67 1450,66 1450,67-0,01 0 34 7,40E-03 K.MGSQFFNHDQLK.V 6 570 581 1467,66 1466,66 1466,66-0,01 0 35 4,51E-03 K.MGSQFFNHDQLK.V Oxidation (M) 7 447 461 1606,86 1605,86 1605,86 0,00 0 69 1,94E-06 K.ASLLGDAISYINELK.S 8 355 370 1712,79 1711,78 1711,78 0,00 0 23 8,08E-02 K.GSNNDEGMLSFSTVVR.S 9 175 191 1749,85 1748,85 1748,85 0,00 0 55 6,08E-05 R.VIWLSGSGALTGSGCER.A MYC2 AT4G28910 NINJA 3/3 TAIR8 261 2,60E-22 3 37 12 172 1 372 379 896,48 895,48 895,48 0,00 0 40 2,43E-03 R.TISGVTYR.Y 2 276 292 1618,82 1617,81 1617,81 0,00 0 85 6,61E-08 K.DGSGGIVALSQSPFAGR.V 3 73 89 1908,87 1907,87 1907,86 0,00 0 28 1,97E-02 R.SDSGQQPPQNFFNDLSK.A 4 179 197 2124,11 2123,10 2123,10 0,00 0 20 1,74E-01 K.EVVRPPTDTNIVDNLTGQR.R MYC2 AT5G20900 JAZ12 3/3 TAIR8 240 3,30E-20 1 39 7 181 1 161 169 1068,50 1067,49 1067,49 0,00 0 34 7,62E-03 K.NPYPTSDFK.K 2 161 170 1196,59 1195,58 1195,59 0,00 1 49 2,91E-04 K.NPYPTSDFKK.T 3 92 106 1529,79 1528,78 1528,78 0,00 0 63 1,11E-05 K.NSTSISPVSSPALNR.A 4 171 187 1804,90 1803,89 1803,89 0,00 1 25 6,52E-02 K.TDVPTGNVSIKEEFPTA. 5 107 133 2864,40 2863,39 2863,40 0,00 0 10 1,17E+00 R.APSFSSTSNVASPAAQPFPIQPISFCR.S MYC2 AT1G74950 JAZ2 2/3 TAIR8 124 1,30E-08 8 41 6 77 1 15 24 1211,58 1210,58 1210,58 0,00 0 25 6,83E-02 R.KPSFSQTCTR.L 2 110 127 1937,01 1936,00 1936,01 0,00 0 52 1,08E-04 K.SVKPESQSAPLTIFYGGR.V MYC2 AT3G43440 JAZ11 1/3 TAIR8 60 3,40E-02 0 12 2 51 1 80 90 1168,64 1167,64 1167,64 0,00 0 35 4,83E-03 K.NVTGINPALNR.A 2 37 55 2039,97 2038,96 2038,96 0,00 0 16 4,65E-01 R.STEPDASTQLTIIFGGSCR.V MYC3 AT5G46760 MYC3 (BAIT) 4/4 TAIR8 799 4,10E-76 3 27 14 704 1 192 201 1034,56 1033,55 1033,56 0,00 0 71 2,10E-06 R.AGQGQIYGLK.T 2 324 333 1091,61 1090,60 1090,60 0,00 0 77 4,60E-07 K.DLTFQGGLLK.S 3 518 526 1102,60 1101,59 1101,60-0,01 0 54 1,20E-04 K.IIGWDVMIR.V 4 518 526 1118,60 1117,59 1117,60 0,00 0 23 1,50E-01 K.IIGWDVMIR.V Oxidation (M) 5 570 581 1451,67 1450,66 1450,67 0,00 0 72 1,10E-06 K.MGSQFFNHDQLK.V 6 570 581 1467,66 1466,66 1466,66 0,00 0 42 9,20E-04 K.MGSQFFNHDQLK.V Oxidation (M) 7 447 461 1606,87 1605,86 1605,86 0,00 0 98 3,00E-09 K.ASLLGDAISYINELK.S 8 355 370 1712,79 1711,78 1711,78 0,00 0 119 1,90E-11 K.GSNNDEGMLSFSTVVR.S 9 355 370 1728,78 1727,78 1727,78 0,00 0 84 5,50E-08 K.GSNNDEGMLSFSTVVR.S Oxidation (M) 10 175 191 1749,86 1748,85 1748,85 0,00 0 139 2,40E-13 R.VIWLSGSGALTGSGCER.A 11 405 421 1945,98 1944,98 1944,98 0,00 1 75 6,70E-07 R.KPANGREEPLNHVEAER.Q MYC3 AT5G20900 JAZ12 4/4 TAIR8 534 1,30E-49 1 53 8 460 1 161 169 1068,50 1067,49 1067,49 0,00 0 45 5,50E-04 K.NPYPTSDFK.K 2 161 170 1196,59 1195,59 1195,59 0,00 1 60 2,20E-05 K.NPYPTSDFKK.T 3 92 106 1529,79 1528,78 1528,78 0,00 0 76 5,40E-07 K.NSTSISPVSSPALNR.A 4 171 187 1804,89 1803,89 1803,89 0,00 1 68 3,00E-06 K.TDVPTGNVSIKEEFPTA.- 5 10 36 2407,07 2406,07 2406,06 0,01 0 142 5,40E-14 R.ASVEGGCGVADGDGGAAEIGGTGSVEK.S 6 107 133 2864,41 2863,40 2863,40 0,01 0 69 1,60E-06 R.APSFSSTSNVASPAAQPFPIQPISFCR.S MYC3 AT4G28910 NINJA 4/4 TAIR9 409 4,20E-37 3 46 14 291 1 276 292 1618,82 1617,81 1617,81 0,57 0 124 8,80E-12 K.DGSGGIVALSQSPFAGR.V 2 73 89 1908,86 1907,85 1907,87-5,27 0 66 2,40E-06 R.SDSGQQPPQNFFNDLSK.A 3 387 403 2031,89 2030,88 2030,88 1,14 0 17 1,40E-01 K.IVCACHGSHMSPEEFVR.H Oxidation (M) 4 179 197 2124,10 2123,09 2123,10-3,05 0 67 3,20E-06 K.EVVRPPTDTNIVDNLTGQR.R 5 349 371 2295,13 2294,13 2294,13-2,04 0 17 3,50E-01 K.FGGSGARPNLPWVSTTGSGPHGR.T MYC3 AT1G74950 JAZ2 4/4 TAIR8 388 5,20E-35 5 51 8 319 1 15 24 1211,58 1210,58 1210,58 0,00 0 19 2,50E-01 R.KPSFSQTCTR.L 2 128 138 1303,58 1302,58 1302,58 0,00 0 54 2,60E-05 R.VMVFDDFSAEK.A Oxidation (M) 3 110 127 1937,01 1936,00 1936,01 0,00 0 106 4,30E-10 K.SVKPESQSAPLTIFYGGR.V 4 33 53 2170,99 2169,98 2169,98 0,00 0 15 3,60E-01 K.GSFGDLSLGMTCKPDVNGGSR.Q Oxidation (M) 5 153 171 2204,98 2203,97 2203,96 0,01 0 8 1,10E+00 K.SFTCFTAEVNNNHSAYSQK.E 6 186 207 2347,20 2346,20 2346,20 0,00 0 60 1,50E-05 K.TAAQEPIQPNPASLACELPIAR.R 7 226 249 2533,24 2532,23 2532,22 0,00 0 56 4,40E-05 K.APYQIDGSAEASSKPTNPAWLSSR.- MYC3 AT4G17880 MYC4 2/4 TAIR8 183 1,60E-14 4 26 10 126 1 515 523 1074,58 1073,57 1073,57 0,00 0 46 7,80E-04 K.IIGWDAMIR.I 2 515 523 1090,57 1089,56 1089,56 0,00 0 6 9,20E+00 K.IIGWDAMIR.I Oxidation (M) 3 406 422 1945,98 1944,98 1944,98 0,00 1 38 3,40E-03 R.KPANGREEPLNHVEAER.Q 4 177 206 3040,42 3039,41 3039,40 0,01 0 42 5,10E-04 K.GTGLPGQAFSNSDTIWLSGSNALAGSSCER.A MYC4 AT4G17880 MYC4 (BAIT) 4/4 TAIR9 483 1,70E-44 2 22 10 436 1 515 523 1074,58 1073,57 1073,57-0,79 0 59 4,20E-05 K.IIGWDAMIR.I 2 515 523 1090,57 1089,56 1089,56-0,70 0 35 1,10E-02 K.IIGWDAMIR.I Oxidation (M) 3 567 578 1472,68 1471,67 1471,68-3,57 0 71 1,10E-06 K.MGNQFFTQDQLK.V Oxidation (M) 4 448 462 1579,85 1578,85 1578,85-3,18 0 113 7,30E-11 K.ASLLGDAISYISELK.S 5 2 17 1830,89 1829,89 1829,89-2,01 0 91 1,50E-08 M.SPTNVQVTDYHLNQSK.T 6 177 206 3040,42 3039,41 3039,40 3,68 0 103 4,60E-10 K.GTGLPGQAFSNSDTIWLSGSNALAGSSCER.A MYC4 AT5G20900 JAZ12 4/4 TAIR9 618 5,30E-58 2 53 8 540 1 161 169 1068,50 1067,49 1067,49-2,29 0 74 6,10E-07 K.NPYPTSDFK.K 2 171 181 1130,60 1129,60 1129,60-1,85 0 62 2,00E-05 K.TDVPTGNVSIK.E 3 161 170 1196,59 1195,59 1195,59-1,42 1 70 2,30E-06 K.NPYPTSDFKK.T 4 92 106 1529,79 1528,78 1528,78-0,06 0 108 4,00E-10 K.NSTSISPVSSPALNR.A 5 171 187 1804,90 1803,89 1803,89-0,14 1 93 8,70E-09 K.TDVPTGNVSIKEEFPTA.- 6 10 36 2407,08 2406,07 2406,06 4,60 0 100 8,20E-10 R.ASVEGGCGVADGDGGAAEIGGTGSVEK.S 7 107 133 2864,41 2863,41 2863,40 3,15 0 32 7,60E-03 R.APSFSSTSNVASPAAQPFPIQPISFCR.S 8

MYC4 AT5G46760 MYC3 4/4 TAIR8 467 6,50E-43 6 23 10 408 1 192 201 1034,56 1033,56 1033,56 0,00 0 56 5,90E-05 R.AGQGQIYGLK.T 2 518 526 1102,61 1101,60 1101,60 0,00 0 24 1,00E-01 K.IIGWDVMIR.V 3 518 526 1118,60 1117,60 1117,60 0,00 0 26 7,20E-02 K.IIGWDVMIR.V Oxidation (M) 4 570 581 1467,67 1466,66 1466,66 0,00 0 27 3,00E-02 K.MGSQFFNHDQLK.V Oxidation (M) 5 447 461 1606,87 1605,86 1605,86 0,00 0 84 7,00E-08 K.ASLLGDAISYINELK.S 6 355 370 1712,79 1711,79 1711,78 0,00 0 13 8,30E-01 K.GSNNDEGMLSFSTVVR.S 7 355 370 1728,78 1727,77 1727,78 0,00 0 44 5,20E-04 K.GSNNDEGMLSFSTVVR.S Oxidation (M) 8 175 191 1749,86 1748,85 1748,85 0,00 0 107 4,00E-10 R.VIWLSGSGALTGSGCER.A 9 316 333 2023,03 2022,02 2022,05-0,02 1 59 2,40E-05 R.QSSCLVEKDLTFQGGLLK.S 10 545 569 2782,43 2781,42 2781,42 0,00 0 6 2,90E+00 K.ELDLEVNHASLSVVNDLMIQQATVK.M Oxidation (M) MYC4 AT4G28910 NINJA 4/4 TAIR8 449 4,10E-41 3 46 14 328 1 276 292 1618,82 1617,81 1617,81 0,00 0 125 6,60E-12 K.DGSGGIVALSQSPFAGR.V 2 73 89 1908,87 1907,86 1907,86-0,01 0 53 5,30E-05 R.SDSGQQPPQNFFNDLSK.A 3 179 197 2124,10 2123,10 2123,10 0,00 0 43 7,70E-04 K.EVVRPPTDTNIVDNLTGQR.R 4 349 371 2295,13 2294,12 2294,13-0,01 0 10 1,60E+00 K.FGGSGARPNLPWVSTTGSGPHGR.T 5 90 110 2345,16 2344,15 2344,15 0,00 1 96 4,20E-09 K.APTTEAEASTKPLWVEDESRK.E MYC4 AT1G74950 JAZ2 3/4 TAIR8 291 2,60E-25 2 50 7 224 1 15 24 1211,58 1210,57 1210,58 0,00 0 45 6,20E-04 R.KPSFSQTCTR.L 2 128 138 1303,59 1302,58 1302,58 0,00 0 55 2,70E-05 R.VMVFDDFSAEK.A Oxidation (M) 3 110 127 1937,01 1936,00 1936,01 0,00 0 86 4,70E-08 K.SVKPESQSAPLTIFYGGR.V 4 226 249 2533,23 2532,22 2532,22 0,00 0 39 2,20E-03 K.APYQIDGSAEASSKPTNPAWLSSR.- MYC4 AT3G43440 JAZ11 4/4 TAIR8 184 1,30E-14 1 22 3 163 1 80 90 1168,64 1167,64 1167,64 0,00 0 47 3,40E-04 K.NVTGINPALNR.A 2 37 55 2039,97 2038,96 2038,96 0,00 0 116 3,90E-11 R.STEPDASTQLTIIFGGSCR.V JAZ3 AT3G17860 JAZ3 (BAIT) 2/2 TAIR9 393 1,70E-35 6 59 11 285 1 89 98 1063,55 1062,55 1062,55 0,58 0 90 3,10E-08 K.APYSSVQGVR.M 2 88 98 1191,65 1190,64 1190,64 1,56 1 93 1,10E-08 R.KAPYSSVQGVR.M 3 42 59 2041,99 2040,98 2040,99-2,33 0 36 4,10E-03 K.VSASSSQFLSFRPTQEDR.H 4 63 87 2727,21 2726,20 2726,20-1,06 0 41 5,30E-04 K.SGNYHLPHSGSFMPSSVADVYDSTR.K Oxidation (M) 5 168 197 3216,60 3215,59 3215,57 7,43 0 23 4,90E-02 R.SSSKPIGSPAQLTIFYAGSVCVYDDISPEK.A JAZ3 AT4G28910 NINJA 2/2 TAIR9 510 3,30E-47 4 42 14 396 1 199 212 1509,64 1508,63 1508,63-1,38 0 88 8,20E-09 R.SNHGGSGTEEFTMR.N 2 199 212 1525,63 1524,63 1524,63-0,59 0 22 2,40E-02 R.SNHGGSGTEEFTMR.N Oxidation (M) 3 276 292 1618,82 1617,81 1617,81 0,45 0 141 1,80E-13 K.DGSGGIVALSQSPFAGR.V 4 73 89 1908,86 1907,85 1907,87-7,31 0 63 4,90E-06 R.SDSGQQPPQNFFNDLSK.A 5 387 403 2031,88 2030,88 2030,88-0,28 0 29 7,10E-03 K.IVCACHGSHMSPEEFVR.H Oxidation (M) 6 179 197 2124,10 2123,09 2123,10-2,49 0 62 9,90E-06 K.EVVRPPTDTNIVDNLTGQR.R 7 349 371 2295,13 2294,13 2294,13-1,64 0 12 1,10E+00 K.FGGSGARPNLPWVSTTGSGPHGR.T JAZ3 AT5G46760 MYC3 1/2 TAIR9 153 1,70E-11 6 18 8 116 1 518 526 1102,61 1101,60 1101,60-1,05 0 34 1,10E-02 K.IIGWDVMIR.V 2 518 526 1118,60 1117,59 1117,60-2,39 0 24 1,10E-01 K.IIGWDVMIR.V Oxidation (M) 3 447 461 1606,85 1605,85 1605,86-9,54 0 38 3,60E-03 K.ASLLGDAISYINELK.S 4 355 370 1728,78 1727,77 1727,78-3,10 0 17 2,30E-01 K.GSNNDEGMLSFSTVVR.S Oxidation (M) 5 175 191 1749,87 1748,86 1748,85 3,57 0 27 4,00E-02 R.VIWLSGSGALTGSGCER.A JAZ3 AT1G80490/AT1G15750 TPR1/TOPLESS 1/2 TAIR9 / / / / / 36 1 114 125 1476,79 1475,78 1475,80-10,80 0 36 6,20E-03 K.EITQLLTLENFR.E JAZ5 AT1G17380 JAZ5 (BAIT) 4/4 TAIR8 581 2,60E-54 3 50 10 502 1 33 44 1311,67 1310,66 1310,66 0,00 0 85 6,70E-08 K.GSFGNIDLGLYR.K 2 107 117 1322,69 1321,69 1321,69 0,00 0 54 1,00E-04 K.VLVYNEFPVDK.A 3 203 215 1491,71 1490,71 1490,71-0,01 0 89 2,70E-08 R.APYQVNQNAGHHR.Y 4 31 44 1568,80 1567,79 1567,80-0,01 1 39 2,40E-03 K.EKGSFGNIDLGLYR.K 5 168 181 1784,84 1783,84 1783,84-0,01 0 85 5,80E-08 K.EQQQQQEQNQIVER.I 6 149 167 2125,01 2124,01 2124,02-0,01 0 75 4,50E-07 K.SSMVLPDLNEPTDNNHLTK.E 7 149 167 2141,01 2140,00 2140,01-0,01 0 78 2,30E-07 K.SSMVLPDLNEPTDNNHLTK.E Oxidation (M) 8 127 148 2494,25 2493,24 2493,25 0,00 0 72 8,60E-07 K.QAKPVTEINIQTPINDENNNNK.S JAZ5 AT4G28910 NINJA 4/4 TAIR8 564 1,30E-52 3 44 13 454 1 199 212 1509,64 1508,63 1508,63 0,00 0 82 3,50E-08 R.SNHGGSGTEEFTMR.N 2 276 292 1618,82 1617,81 1617,81 0,00 0 129 2,60E-12 K.DGSGGIVALSQSPFAGR.V 3 73 89 1908,87 1907,87 1907,86 0,00 0 38 1,80E-03 R.SDSGQQPPQNFFNDLSK.A 4 179 197 2124,10 2123,09 2123,10 0,00 0 42 1,10E-03 K.EVVRPPTDTNIVDNLTGQR.R 5 349 371 2295,14 2294,13 2294,13 0,00 0 42 9,90E-04 K.FGGSGARPNLPWVSTTGSGPHGR.T 6 90 110 2345,15 2344,15 2344,15-0,01 1 106 3,80E-10 K.APTTEAEASTKPLWVEDESRK.E 7 48 72 2813,40 2812,40 2812,39 0,01 1 14 4,80E-01 K.VIDDFKNFLHPTSQRPAEPSSGSQR.S JAZ5 AT1G15750 TOPLESS 2/4 TAIR8 530 3,30E-49 6 29 23 385 1 150 158 1072,61 1071,61 1071,61 0,00 0 48 3,80E-04 K.LIEANPLFR.D 2 159 167 1117,63 1116,63 1116,63 0,00 1 57 4,10E-05 R.DKLQFPTLR.N 3 534 543 1212,55 1211,54 1211,54 0,00 0 38 2,20E-03 K.AWLYDNMGSR.V 4 103 113 1360,67 1359,66 1359,67-0,01 0 47 3,90E-04 K.VFSTFNEELFK.E 5 114 125 1476,80 1475,79 1475,80 0,00 0 80 2,00E-07 K.EITQLLTLENFR.E 6 518 531 1582,81 1581,80 1581,80 0,00 0 65 6,90E-06 K.ENIQFIFSTALDGK.I 7 368 388 2227,18 2226,18 2226,20-0,03 0 50 1,10E-04 K.QTLLLVGTNVGDIGLWEVGSR.E JAZ5 AT5G20900 JAZ12 4/4 TAIR8 455 1,00E-41 4 53 7 390 1 161 170 1196,59 1195,58 1195,59 0,00 1 57 4,70E-05 K.NPYPTSDFKK.T 2 92 106 1529,78 1528,78 1528,78-0,01 0 73 1,10E-06 K.NSTSISPVSSPALNR.A 3 171 187 1804,89 1803,89 1803,89 0,00 1 68 3,00E-06 K.TDVPTGNVSIKEEFPTA.- 4 10 36 2407,09 2406,08 2406,06 0,02 0 123 5,20E-12 R.ASVEGGCGVADGDGGAAEIGGTGSVEK.S 5 107 133 2864,41 2863,40 2863,40 0,00 0 70 1,30E-06 R.APSFSSTSNVASPAAQPFPIQPISFCR.S JAZ5 AT5G46760 MYC3 2/4 TAIR8 338 5,20E-30 7 24 11 274 1 192 201 1034,56 1033,55 1033,56 0,00 0 61 2,00E-05 R.AGQGQIYGLK.T 2 324 333 1091,60 1090,59 1090,60-0,01 0 59 3,60E-05 K.DLTFQGGLLK.S 3 518 526 1102,60 1101,60 1101,60 0,00 0 27 6,20E-02 K.IIGWDVMIR.V 4 518 526 1118,60 1117,60 1117,60 0,00 0 25 8,50E-02 K.IIGWDVMIR.V Oxidation (M) 5 570 581 1451,67 1450,67 1450,67 0,00 0 39 2,00E-03 K.MGSQFFNHDQLK.V 6 570 581 1467,67 1466,66 1466,66 0,00 0 17 2,90E-01 K.MGSQFFNHDQLK.V Oxidation (M) 7 355 370 1712,79 1711,79 1711,78 0,00 0 50 1,40E-04 K.GSNNDEGMLSFSTVVR.S 8 355 370 1728,79 1727,78 1727,78 0,00 0 21 1,20E-01 K.GSNNDEGMLSFSTVVR.S Oxidation (M) 9 175 191 1749,86 1748,85 1748,85 0,00 0 38 2,80E-03 R.VIWLSGSGALTGSGCER.A JAZ5 AT3G16830 TPR2 1/4 TAIR8 232 2,10E-19 5 14 13 189 1 150 158 1072,61 1071,61 1071,61 0,00 0 60 2,70E-05 K.LIEANPLFR.E 2 114 125 1476,80 1475,79 1475,80-0,01 0 38 3,20E-03 K.EITQLLTLENFR.E 3 508 521 1582,81 1581,80 1581,80 0,00 0 62 1,30E-05 K.ENIQFIFSTALDGK.I 4 771 790 2018,11 2017,10 2017,10 0,00 0 29 9,80E-03 R.LLYTNSGVGVLALGSNGVQR.L JAZ5 AT5G27030 TPR3 1/4 TAIR8 190 3,30E-15 9 11 10 164 1 150 158 1072,61 1071,61 1071,61 0,00 0 60 2,70E-05 K.LIEANPLFR.D 2 507 520 1582,81 1581,80 1581,80 0,00 0 62 1,30E-05 K.ENIQFIFSTAIDGK.I 3 429 443 1743,92 1742,91 1742,91 0,00 0 42 1,00E-03 K.HLIQLYAFSGPNDLR.Q JAZ5 AT1G74950 JAZ2 2/4 TAIR8 98 5,30E-06 10 42 6 52 1 110 127 1937,01 1936,00 1936,01 0,00 0 52 1,20E-04 K.SVKPESQSAPLTIFYGGR.V 9

Supplemental Data. Fernández-Calvo et al. Plant Cell. (2011). 10.1105/tpc. 110.080788 Supplemental Table2. List of primers used. Oligonucleotide sequences used within this work to amplify and genotype indicated genes. Primer Name Sequence 5 to 3 Used to LBGabiKat8409 ATATTGACCATCATACTCATTGC Genotyping LBGabiKat8760 GGGCTACACTGAATTGGTAGCTC Genotyping MYC3FwGKgenespecific AAGGTGGGTTGTTGAAATCTAATG Genotyping MYC3RvCDS TCAATAGTTTTCTCCGACTTTC Genotyping MYC4FwCDS ATGTCTCCGACGAATGTTCA Genotyping MYC4RvGKgeneespecific AACCAAATTCACCACCACCAT Genotyping MYC3Fwgateway ggggacaagtttgtacaaaaaagcaggcttcatgaacggcacaacatcatca Full lenght MYC3 MYC3Rvstopgateway ggggaccactttgtacaagaaagctgggttcaatagttttctccgacttt Full lenght MYC3 MYC3Rvnonstopgateway ggggaccactttgtacaagaaagctgggtcatagttttctccgactttt Full lenght MYC3 (no stop) MYC4Fwgateway ggggacaagtttgtacaaaaaagcaggcttcatgtctccgacgaatgttca Full lenght MYC4 MYC4Rvstopgateway ggggaccactttgtacaagaaagctgggttcatggacattctccaactttc Full lenght MYC4 MYC4Rvnonstopgateway ggggaccactttgtacaagaaagctgggtctggacattctccaactttc Full lenght MYC4 (no stop) At5g46830Fwgateway ggggacaagtttgtacaaaaaagcaggcttcatgattaataccgacgataac Full lenght At5g46830 At5g46830Rvstopgateway ggggaccactttgtacaagaaagctgggttcagctaattttcgacatcaa Full lenght At5g46830 At5g46830Rvnonstopgateway ggggaccactttgtacaagaaagctgggtcgctaattttcgacatcaa Full lenght At5g46830 (no stop) AtAIBFwgateway ggggacaagtttgtacaaaaaagcaggcttcatgaatatgagtgatttaggt Full lenght AtAIB AtAIBRvstopgateway ggggaccactttgtacaagaaagctgggtttatatatcaccagagacctgt Full lenght AtAIB AtAIBRvnonstopgateway ggggaccactttgtacaagaaagctgggtctatatcaccagagacctgt Full lenght AtAIB (no stop) MYC3TAPFw ggggacaagtttgtacaaaaaagcaggctccaccatgaacggcacaacatcatcaatc MYC3TAP clone MYC4TAPFw ggggacaagtttgtacaaaaaagcaggctccaccatgtctccgacgaatgttcaag MYC4TAP clone JAZ3TAPFw ggggacaagtttgtacaaaaaagcaggctccaccatggagagagattttctcgggttgg JAZ3TAP clone JAZ5TAPRv ggggacaagtttgtacaaaaaagcaggctccaccatgtcgtcgagcaatgaaaatgc JAZ5TAP clone MYC3promFw cacctgttattagcgcaaagaggatcg pmyc3:gus MYC3promRv GAAGTTGATTGATGATGTTGTGCCGTTCAT pmyc3:gus MYC4promFw caccacagtactaacgtttgatggaaacat pmyc4:gus MYC4promRv ATCGGTTACTTGAACATTCGTCGGAGACAT pmyc4:gus PDF1.2qPCRFw AGTTGTGCGAGAAGCCAAGT PDF1.2 qpcr amplification PDF1.2qPCRRv GTTGCATGATCCATGTTTGG PDF1.2 qpcr amplification VSP2qPCRFw CGTCGATTCGAAAACCATCT VSP2 qpcr amplification VSP2qPCRRv GGCACCGTGTCGAAGTCTAT VSP2 qpcr amplification JAZ10qPCRFW GAGAAGCGCAAGGAGAGATTAG JAZ10 qpcr amplification JAZ10qPCRRv CTTAGTAGGTAACGTAATCTCC JAZ10 qpcr amplification MYC2qPCRFw GTGCGGGATTAGCTGGTAAA MYC2 qpcr amplification MYC2qPCRRv ATGCATCCCAAACACTCCTC MYC2 qpcr amplification MYC3qPCRFw TGTTGAAGCAGAGAGGCAGA MYC3 qpcr amplification MYC3qPCRRv CTCCGAGAAGCGAAGCTTTA MYC3 qpcr amplification MYC4qPCRFw AGGAGCAAACGAGAACTGGA MYC4 qpcr amplification MYC4qPCRRv CCATCTCCCCAACCTAACAA MYC4 qpcr amplification 10

ACTIN-8qPCRFw CCAGTGGTCGTACAACCGGTA ACTIN8 qpcr amplification ACTIN-8qPCRRv TAGTTCTTTTCGATGGAGGAGCTG ACTIN8 qpcr amplification MYC2N-term-attB1-F1old ggggacaagtttgtacaaaaaagcaggcttcatggagattccggcacaggcg MYC2N MYC2N-term-attB2-R1 ggggaccactttgtacaagaaagctgggtcggaggcgccggagaaatcata MYC2N MYC2midFw ggggacaagtttgtacaaaaaagcaggctcgggattagctggtaaagcg MYC2-mid MYC2midRv ggggaccactttgtacaagaaagctgggtcttaatgaaccggactcggagt MYC2-mid MYC2NTFw ggggacaagtttgtacaaaaaagcaggcttcatggagattccggcacaggcg MYC2-Nt MYC2NTRv ggggaccactttgtacaagaaagctgggtctcacgctttaccagctaatcccg MYC2-Nt MYC2Fw55 ggggacaagtttgtacaaaaaagcaggcttcatggagattccggcacaggcg MYC2-D55-99 MYC2Rv99 ggggaccactttgtacaagaaagctgggtcggaggcgccggagaaatcata MYC2-D55-99 MYC2Fw93 ggggacaagtttgtacaaaaaagcaggcttcatgtatgatttctccggcgcctcc MYC2-D93-160 MYC2Rv160 ggggaccactttgtacaagaaagctgggtcctcctcatcaacagcgtcatc MYC2-D93-160 MYC3dom44Fw ggggacaagtttgtacaaaaaagcaggcttccagcctcagttcaacgaagat MYC3-D44-87 MYC3dom87Rv ggggaccactttgtacaagaaagctgggtcactgtgttatctccggtgga MYC3-D44-87 MYC3Fw82 ggggacaagtttgtacaaaaaagcaggcttcgacttcgattcatccaccgga MYC3-D82-141 MYC3Rv141 ggggaccactttgtacaagaaagctgggtcttcatcgtttgattcatcgga MYC3-D82-141 JAZ2FwEcoR1 GTCACGAATTCATGTCGAGTTTTTCTGCCG JAZ2pGBKT7 Y2H JAZ2RvPst-1 GACGTCTGCAGTTACCGTGAACTGAGCCAAG JAZ2pGBKT7 Y2H JAZ3FwEcoR1 CGGAATTCCGGTTCATGGAGAGAGAT JAZ3pGBKT7 Y2H JAZ3RvPst-1 CCAATGCATTGGTTCTGCAGTTTTAGGTTGC JAZ3pGBKT7 Y2H pdest32fw AACCGAAGTGCGCCAAGTGTCTG Check clones pdest32rv CAGAGGTTAGTTCCAACAGCCGA Check clones pdest22fw TATAACGCGTTTGGAATCACT Check clones pdest22rv AGCCGACAACCTTGATTGGAGAC Check clones T7 promoter (-20) TAATACGACTCACTATAGGG Check clones 11

2024 © sciencedocbox.com Privacy Policy | Terms of Service | Feedback