oi: 10.1038/ntur05770 Supplntry Figur 1 g h SUPPEMENTARY FIGURE 1 Exprssion o th ProCDKA;1:CDKA;1:YFP trnsgn. -, Fluorsn irogrphs showing 4',6-Diiino-2-phnylinol (DAPI- stin nuli (, n yllow luorsnt protin (YFP luorsn (, in k;1 -/- polln rsu y ProCDKA;1:CDKA;1:YFP usion onstrut (hrtr rrr to s k;1 -/- ; CDKA;1:YFP., In htrozygous k;1 -/- ; k;1:yp +/- plnts, two lsss o polln r prou. Th irst lss rprsnts wil-typ-lik polln with on vgttiv ll (strisks n two gts (rrowhs., All nuli r rk y YFP luorsn, th two spr lls nuli (rrowhs strongr thn th vgttiv ll nulus., Th son polln lss rsls k;1 utnt polln with on vgttiv ll (strisks n only on gt (rrowh., Ths polln show only vry int YFP signl. -, Projtions o onol Z-sris showing YFP luorsn in Col x k;1 -/- ;CDKA;1:YFP +/+ ss. Both rtiliztion prouts, th ryo (rrowhs n th nospr r rk y YFP luorsn., Col x k;1 -/- ; CDKA;1:YFP +/+ s 2..p.., Col x k;1 -/- ;CDKA;1:YFP +/+ s 4..p.. g-h, Projtions o onol Z-sris showing YFP luorsn n r utoluorsn in -/- x k;1 -/- ; k;1:yp +/- ss t 6..p.. g, -/- x k;1 -/- ; k;1:yp +/- s pollint y wil-typ-lik polln rrying th CDKA;1:YFP onstrut n xprssing YFP in th rrst hrt-stg ryo (rrowh n th nospr. h, In th sll rsu ss in -/- x k;1 -/- ; k;1:yp +/- rosss, th ryo (rrowh n th nospr o not show YFP luorsn, initing tht ths ss wr gnrt y YFP-ngtiv k;1 utntlik polln. www.ntur.o/ntur 1
oi: 10.1038/ntur05770 Supplntry Figur 2 g h i wil typ is-lss is-lss x k;1 + /- SUPPEMENTARY FIGURE 2: Enospr irntition in +/- n i +/- utnts pollint with k,1 +/- polln isplys wil-typ hrtristis. -, Z-sris projtions o onol irogrphs showing th KS22 grn luorsnt protin (GFP signl n r utoluorsn., In wil typ ss, KS22 xprssion is onin to rly nospr vlopnt, whrs, in i-11 utnts, GFP xprssion prsists in th orting ss., In i-11 +/- x k;1 +/- ss, lss o sll rsu ss is tt tht stop xprssing KS22 s thy tur. -, Mirogrphs showing G222 GUS rportr-gn tivity s lu stining in th nospr., In th turing wil-typ s th GUS rportr G222 is xprss in th nospr., Th nospr o ss os not irntit n os not xprss th G222 GUS rportr., In sll +/- x k;1 +/- rsu ss, G222 is xprss s in h wil typ. g-i, Mirogrphs o s stions showing nospr llulriztion. g, In wil-typ ss, th nospr strts to or ll wlls roun th lt hrt stg ryo. h, In orting ss th nospr os not llulriz. i, In sll -/- x k;1 +/- rsu ss, th nospr llulrizs. Arvitions r: is-lss, +/- or i +/- utnts; k;1 +/-, htrozygous k;1 utnt. Sl rs r 100µ. www.ntur.o/ntur 2
oi: 10.1038/ntur05770 Supplntry Figur 3 s r (2 0.25 0.2 0.15 0.1 0.05 - (n =1 x 01 CD KA ;1 :Y FP + /+ (n =3 x 5, YF k P+ ;1:y p +/ (n =9 x 6, YP k F- ;1:y p + / (n =1 s 0 1 l 100 root lngth ( grintion rt (% (n r x =1 C 01 ol (n r x =1 01 k, Y ;1 FP :y + p +/- (n r s =1 l 01 0 80 60 40 20 0 r x YFP+ (n=63 25 r x YFP+ (n=59 20 15 x YFP(n=51 10 5 x YFP(n=64 1..g. 3..g. 5..g. g h i k l plnt ry wight (g 1.5 1.0 0.5 - ;1 :Y FP + /+ (n =2 x 5, YF k P+ ;1:y p +/ (n =2 x 7, YF k P- ;1:y p + / KA (n =2 x 6 CD (n =1 s 6 l (n r x =2 5, k YF ;1 P+ :y p +/- (n r x =2 C 8 ol (n r s =2 l 5 0 SUPPEMENTARY FIGURE 3: Post-ryo vlopnt o -/- x CDKA;1:YFP+/- F1 plnts., S siz o -/- x k;1:yp+/- F1 ss. Ss o th -/- x k;1:yp+/- ross tht lk YFP (signt YFP-, r nur 7 rwww.ntur.o/ntur likly to prou y YFP-ngtiv k;1 utnt-lik polln n to vlop with uniprntl, iploi nospr. Thy 2 r signiintly sllr thn ss o th s -/- x k;1:yp+/- ross tht rry YFP (signt YFP+, r nur 6 whih hv vlop s th wil typ with triploi, iprntl nospr. Sttistil nlysis ws pror using th Stunt-Nwn-KulsTst. -/- x k;1:yp+/- YFP-ngtiv ss or th only r o hoognous sust tht ws signiintly irnt ro ll othr susts. For th surnts, only vil-looking, i.. light rown, pl ss wr hosn., Grintion o -/- x k;1:yp+/- F1 plnts. F1 ss o r x Col n -/- x k;1:yp+/- rosss wr slt oring to th ritrion whthr thy wr vil-looking, i.. light rown n pl, or not. Vi-looking ss wr tst or grintion on gr plts. In r x Col, 99% o th ss grint, whil in -/- x k;1:yp+/- F1 ss roun 88% o th sll rsu ss grint. Error rs rprsnt th stnr vition twn thr inpnnt rosss., Root growth rt o -/- x k;1:yp+/- F1 plnts. F1 slings o r x Col n -/- x k;1:yp+/- rosss wr put on vrtil gr plts. Root growth ws sur 1, 3, n 5 ys tr grintion (..g.. t grinting slings wr not tkn into ount. Slings ro -/- x k;1:yp+/-rosss sting ro sll rsu ss h shortr roots thn th r x Col ontrol t 1..g.. Although th n growth rt pr y o th sll rsu slings (0.46 ws slightly highr thn th on o wil typ ontrol (0.40, uring th irst 5 ys o root growth, thy oul not th up with th wil-typ slings. -, Typil F1 plnts o r x Col n -/- x k;1:yp+/- rosss t 7..g. on gros plts., r x Col., Th roots o -/- x k;1:yp+/- F1 r rkly sllr thn th ons o r x Col plnts. -l, F1 plnts o -/- x k;1:yp+/- rosss n o th orrsponing ontrols 28..g.., r sl. g, r x Col. h, r x k;1:yp+/-, YFP positiv. i, -/- sl. k, -/- x Col. l, -/- x k;1:yp+/-, YFP ngtiv. Th -/- x k;1:yp+/- YFP ngtiv plnts r rkly sllr thn th ontrol plnts., Finl ioss o th -/- x k;1:yp+/- F1 ospring. Dry wight o th shoots ov th rostt lvs o -/- x k;1:yp+/- F1 plnts n th ontrol groups sur tr th plnts i n ri out. Th F1 plnts tht grow ro -/x k;1:yp+/- YFP-ngtiv ss (YFP- inlly rh th s siz s th ons rrying YFP (YFP+ n thir wil-typ ontrols. Sttistil nlysis ws pror using th Stunt-Nwn-Kuls-Tst. -/- x k;1:yp+/- (YFP- F1 plnts (r nur 7 or highly signiint hoognous sust with F1 YFP-positiv plnts ro -/- x k;1:yp+/- (YFP+ n F1 plnts ro th -/- x k;1-/-; CDKA;1:YFP+/+ ross. Not tht th rosss twn irnt Ariopsis ssions tn to uult or ioss, proly u to htrosis ts (Myr, R. C. t l., Plnt Physiol 134, 1813-23 [2004]. Th rs show th vrg vlus, rror rs rprsnt th stnr vition. Piturs o ss wr tkn with i stro irosop n susquntly th s surs projt on th piturs wr trin with th DISKUS sotwr pkg (Crl H. Hilgrs Thnishs Büro, vrsion 4.30.19. Mn vlus r pitur y th rs, rror rs rprsnt th stnr vition. Arvitions r:, hoozygous utnt; YFP+, -/- x k;1:yp+/- ss rrying th YFP, thror rprsnting ss rt y YFP-positiv wil-typ-lik polln ; YFP-, -/- x k;1:yp+/- ss lking th YFP, thror rprsnting ss rt y YFP-ngtiv k;1 utnt-lik polln; n, nur o plnts sur. Sl rs r 0.2 in n, n 2 in -l. www.ntur.o/ntur 3
oi: 10.1038/ntur05770 -/- x -/- Supplntry Figur 4 -/- x k;1+/- YABBY SHOOT MERISTEMESS (STM WUSCHE (WUS SUPPEMENTARY FIGURE 4 Exprssion pttrn o YABBY, SHOOT MERISTEMESS (STM n WUSCHE (WUS RNA in vloping -/- n -/- x k;1+/- ryos., Exprssion pttrn o YABBY in -/- in otylons o vloping hrt stg ryo., YABBY in -/- x k;1+/- ryo ro sll s. Arrows init loliz xprssion., STM xprssion in hrt stg ryo shoot pil rist (SAM,, siilr STM SAM xprssion in -/- x k;1+/- ryo ro s stg., oliz WUS xprssion in th lowr prt o th SAM in wil typ hrt stg ryo,, loliz WUS xprssion in -/- x k;1+/- ryo t th s stg. Stion is rott 90 grs opr to stions -. In situ hyriiztion n prossing o tissu ws pror s sri prviously (Jkson DP (1991 In situ hyriistion in plnts. In: Bowls DJ, Gurr SJ, MPhrson M (s Molulr plnt pthology: prtil pproh. Oxor Univrsity Prss, Oxor, pp 163 174. Hyriiztion pros r sri in; STM (ong J, Brton MK. Initition o xillry n lorl rists in Ariopsis. Dv Biol. 2000 F 15;218(2:341-53, WUS (Shoo H, nhr M, Hkr A, Myr KF, Jurgns G, ux T. Th st ll popultion o Ariopsis shoot rists in intin y rgultory loop twn th CAVATA n WUSCHE gns. Cll. 2000 Mr 17;100(6:635-44, YABBY (Sigri KR, Esh Y, Bu SF, Otsug D, Drws GN, Bown J. Mrs o th YABBY gn ily spiy xil ll t in Ariopsis. Dvlopnt. 1999 Sp;126(18:4117-28. Sl rs r 50 µ. www.ntur.o/ntur 4
oi: 10.1038/ntur05770 SUPPEMENTARY TABE 1 Flowring ti in -/- x k;1 +/- F1 gnotyp o prnts (l x l n (..g. stv n sust r sl 31 1.4 27 1 r x Col 35 1.3 28 2 r x CDKA;1:YFP +/+ 35 1.5 24 2 n 3 -/- x CDKA;1:YFP +/+ 36 3.6 27 2 n 3 -/- sl 36 3.9 27 2 n 3 -/- x k;1:yp +/- (+YFP 37 3.8 28 3 -/- x k;1:yp +/- (-YFP 41 4.2 28 4 hoognous susts s trin y Stunt-Nwn-Kuls-Tst...g., ys tr grintion; n, nur o F1 plnts sor; CDKA;1:YFP +/+, hoozygous k;1 -/- utnt rsu y hoozygous Pro CDKA;1 :CDKA;1:YFP onstrut opltly oplnting th k;1 utnt phnotyp; k;1:yp +/-, hoozygous k;1 -/- utnt rsu y htrozygous Pro CDKA;1:CDKA;1:YFP onstrut phnoopying th htrozygous k;1 +/- utnt; (+YFP, F1 ss rrying th Pro CDKA;1 :CDKA;1:YFP onstrut; (-YFP, F1 ss not rrying th Pro CDKA;1 :CDKA;1:YFP onstrut. www.ntur.o/ntur www.ntur.o/ntur 5 2
oi: 10.1038/ntur05770 SUPPEMENTARY TABE 2 Prir squns n qrt PCR pros n prir squns (5-3 trgt sit ACT_2_102_R CGCTCTTTCTTTCCAAGCTC ACTIN2 (At3g18780right prir or quntittiv RT-PCR ACT_2_102_ ACT_2_102 Aplion CCGGTACCATTGTCACACAC ACTIN2 (At3g18780 lt prir or quntittiv RT-PCR CGCTCTTTCTTTCCAAGCTC ATAAAAAATGGCTGAGGCTG ATGATATTCAACCAATCGTGT GTGACAATGGTACCGG 77 nt plion o ACT_2_102 lt n right prirs or quntittiv RT-PCR. Th UP#102 pro squn is highlight in ol itlis. J504 BA1_EXT N034_S N035_AS N048_S N049_AS ND10_S ND13_AS ND14_AS ND15_S GCGTGGACCGCTTGCTGCA ACTCTCTCAGG TGGTTCACGTAGTGGGGCCA TCG CCAGATTCTCCGTGGAATTG CG GGAGATCGACTCCATCGGG ATC CAGATCTCTTCCTGGTTATTC ACA TGTACAAGCGAATAAAGACA TTTGA AACACAAGTTTGTACAAAAAA GCAGGCTTCAACAATGGATC AGTACGAGAAAG AACACCACTTTGTACAAGAA AGCTGGGTCTTACTTGTACA GCTCGTCC CTTGCTCACCATAGGCATGC CTCCAAGATCCT GGAGGCATGCCTATGGTGA GCAAGGGCGAGG lt orr T-DNA prir or k;1-1 (Slk inry vtor pbin-rok lt orr T-DNA prir or k;1-1 (Slk inry vtor pbin-rok wil-typ CDKA;1, xon 4 wil-typ CDKA;1, xon 7 wil-typ CDKA;1, intron 4 wil-typ CDKA;1, intron 6 Gtwy ttb1-rointion sit n 5 strt o th CDKA;1 CDS n o th YFP CDS plus Gtwy ttb2-rointion sit usion prir: CDKA;1 or plus YFP ovrlp usion prir : YFP or plus CDKA ;1 ovrlp www.ntur.o/ntur www.ntur.o/ntur 6 2
oi: 10.1038/ntur05770 NGA6 upstr prir ATGGAGAAGCTTACACTGAT C sipl squn polyorphis NGA6 ownstr prir PHE1_147_R TGGATTTCTTCCTCTCTTCAC sipl squn polyorphis CGTAGCCCGTACAACTCGAT PHERES1 right prir or quntittiv RT-PCR PHE1_147_ PHE1_147 Aplion CATCACTTCTTCAACGCCTT C CGTAGCCCGTACAACTCGAT CCAGGAGCCTTGGCCATCA AGGGAAGGCGTTGAAGAAG TGATG PHERES1 lt prir or quntittiv RT-PCR 63 nt plion o PHE1_147 lt n right prirs or quntittiv RT-PCR. Th UP#147 pro squn is highlight in ol itlis. Fi-11_F Fi-11_R ATTGGCTCACCACACTTAGA ACTTCATAGC TGTACAATTGTCTCGGAGAT GGTGCC orwr RFP-prir to rogniz th i-11 lll (igst Bsp1286I; wt: 293p+325p, i-11: 618p rvrs RFP-prir to rogniz th i-11 lll (igst Bsp1286I; wt: 293p+325p, i-11: 618p www.ntur.o/ntur www.ntur.o/ntur 7 2