Introduction to Evolution
What is evolution? A basic definition of evolution evolution can be precisely defined as any change in the frequency of alleles within a gene pool from one generation to the next." - Helena Curtis and N. Sue Barnes, Biology, 5th ed. 1989 Worth Publishers, p.974
So what does the definition mean? Evolution is a change in the number of times specific genes that code for specific characteristics occur within an interbreeding population Individuals don t evolve, populations do There is no implied improvement in evolution
Genetic Variation and Evolution Evolution: changes through time 1. Species accumulate difference 2. Descendants differ from their ancestors 3. New species arise from existing ones
A brief history of Charles Darwin Born on February 12, 1809 in England. From 1831 to 1836 Darwin served as naturalist aboard the H.M.S. Beagle on a British science expedition around the world.
A brief history of Charles Darwin He observed variation in related or similar species of plants and animals that were geographically isolated from each other. These observations were the basis for his ideas.
Natural Selection Darwin knew nothing of genes What he did have were two observations From these he made inferences that provided the motive force for evolution
Natural Selection Observation 1: Organisms generally have more offspring than can survive to adulthood. Observation 2: Offspring are not identical. There is variation in their appearance, size, and other characteristics.
Natural Selection Inference: Those organisms that are better adapted to their environment have a greater likelihood of surviving to adulthood and passing these characteristics on to their offspring. Survival of the fittest.
Survival of the fittest. Darwin s theory for how long necks evolved in giraffes
Natural selection: mechanism of evolutionary change Individuals have specific inherited characteristics They produce more surviving offspring The population includes more individuals with these specific characteristics The population evolves and is better adapted to its present environment
Fitness in Biology Fitness: A phenotype with greater fitness usually increases in frequency Fitness is a combination of: Survival: how long does an organism live Mating success: how often it mates Number of offspring per mating that survive
Hardy Weinberg principle Genotype frequencies in a population remain constant or are in equilibrium from generation to generation unless specific disturbing influences are introduced.
Hardy Weinberg principle Those disturbing influences include 1. new mutations 2. gene flow 3. genetic drift 4. selection 5. non-random mating
In genetics terms, evolution is any change in the relative frequency of alleles in a gene pool of a population.
Points to Make: 1. Gene pool -- all genes (alleles) that are present in a population. 2. Frequency -- the number of times that allele occurs in a gene pool. 3. Evolution is studied and understood at the population level NOT species level. a. Populations evolve not individuals.
Why do allele frequencies change?
5. Non-Random Mating AKA selective mating examples: Inbreeding or mating between relatives Assortative matingchoosing mates with similar phenotypes Competition
All living things share a common ancestor. We can draw a Tree of Life to show how every species is related.
Evolution is a theory and a fact. The theory of Evolution deals with how Evolution happens. Our understanding of this process is always changing. Evolution is also a fact as there is a huge amount of indisputable evidence for its occurrence. Rodin s The Thinker
The genetic make-up of an organism is known as its genotype. An organism s genotype and the environment in which it lives determines its total characteristic traits i.e. its phenotype. commons.wikimedia.org/wiki/image:dna_double_helix_vertikal.png
The double-helix structure of DNA was discovered in 1953. Watson and Crick and their model of DNA DNA replication www.chem.ucsb.edu/~kalju/chem110l/public/tutorial/images/watsoncrick.jpg en.wikipedia.org/wiki/dna This showed how genetic information is transferred from one cell to another almost without error.
Types of mutation Occasional mutations or copying errors can occur when DNA is replicated. Mutations may be caused by radiation, viruses, or carcinogens. Mutant fruit fly Mutations are rare and often have damaging effects. upload.wikimedia.org/wikipedia/commons/7/79/types-of-mutation.png humansystemstherapeutics.com/bb.htm
Some mutations will persist and increase genetic variation within a population. Variants of a particular gene are known as alleles. For example, one of the genes for hair color comprises brown/blonde alleles. majorityrights.com/index. php/weblog/comments/racial_variation_in_some_parts_of_the_skull_in
Selection of dark gene Mutant alleles spread through a population by sexual reproduction. If an allele exerts a harmful effect, it will reduce the ability of the individual to reproduce and the allele will probably be removed from the population. In contrast, mutants with favorable effects are passed on
http://en.wikipedia.org/wiki/image:biston.betularia.7200.jpg en.wikipedia.org/wiki/image:biston.betularia.f.carbonaria.7209.jpg en.wikipedia.org/wiki/j._b._s._haldane The Peppered Moth is an example of Natural Selection in action During the Industrial Revolution the trees on which the moth rested became soot-covered. This selected against the allele for pale colour in the population (which were poorly camouflaged from predators) and selected for the dark color allele.
The dog is another example of how selection can change the frequency of alleles in a population. Dogs have been artificially selected for certain characteristics for many years, and different breeds have different alleles. Dogs are wolves All breeds of dog belong to the same species, Canis lupus (the wolf) so this is an example of Microevolution as no new species has resulted. www.puppy-training-solutions.com/image-files/dog-breed-information.jpg
However, if two populations of a species become isolated from one another for tens of thousands of years, genetic difference may become marked. If the two populations can no-longer interbreed, new species are born. This is called Macroevolution. Galapagos finches Darwin s Galapagos finches are an example of this process in action. www.ingala.gov.ec/galapagosislands/images/stories/ingala_images/galapagos_take_a_tour/small_pics/galapagos_map_2.jpg
The mosquito was introduced to the London Underground during its construction around 1900. London Underground Mosquito en.wikipedia.org/wiki/image:gb-lu-angel-southbound.jpg en.wikipedia.org/wiki/culex Studies indicate several genetic differences from its above-ground ancestors. Interbreeding between populations is difficult suggesting that speciation may be occurring.
The basic similarity of all living things suggests that they evolved from a single common ancestor. All living things pass on information from generation to generation using the DNA. DNA for Information Transfer All living things also use a molecule called ATP to carry energy around the organism. en.wikipedia.org/wiki/image:atp-xtal-3d-sticks.png ATP for Energy Transfer
HUMAN CHIMPANZEE GORILLA CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCA TGACTGTTGAACGA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA Genetic code of chimps and gorillas is almost identical to humans If evolution is true then we might also expect that closely related organisms will be more similar to one another than more distantly related organisms. Comparison of the human genetic code with that of other organisms show that chimpanzees are nearly genetically identical (differ by less than 1.2%) whereas the mouse differs by 15%.
Similar comparisons can be made based on anatomical evidence. The skeleton of humans and gorillas are very similar suggesting they shared a recent common ancestor, but very different from the more distantly related woodlouse Human and Gorilla yet all have a common shared characteristic: bilateral symmetry en.wikipedia.org/wiki/image:primatenskelett-drawing.jpg Woodlouse
The pentadactyl limb is ancestral to all vertebrates but modified for different uses en.wikipedia.org/wiki/image:evolution_pl.png
As evolution progresses, some structures get side-lined as they are not longer of use. These are known as vestigial structures. The coccyx is a much reduced version of an ancestral tail, which was formerly adapted to aid balance and climbing. The coccyx is a vestigial tail Another vestigial structure in humans is the appendix. en.wikipedia.org/wiki/image:illu_vertebral_column.jpg
http://en.wikipedia.org/wiki/geologic_time_scale World Health Org. en.wikipedia.org/wiki/image:eopraptor_sketch5.png NASA origins bacteria complex cells dinosaurs humans The fossil record shows a sequence from simple bacteria to more complicated organisms through tim.
Many fossils show a clear transition from one species, or group, to another. Archaeopteryx was found in Germany in 1861. It share many characteristics with both dinosaurs and birds. Archaeopteryx en.wikipedia.org/wiki/image:archaeopteryx_lithographica_paris.jpg It provides good evidence that birds arose from dinosaur ancestors
Marsupials Geographic spread of organisms also tells of their past evolution. Marsupials occur in two populations today in the Americas and Australia. evolution.berkeley.edu/evosite/lines/ivcexperiments.shtml en.wikipedia.org/wiki/image:kangaroo_and_joey03.jpg This shows the group evolved before the continents drifted apart
Staphylococcus Certain bacteria can become resistant to antibiotics This is an example of natural selection in action. The antibiotic acts as an environmental pressure. It weeds out those bacteria with low resistance and only those with high resistance survive to reproduce. http://en.wikipedia.org/wiki/image:antibiotic_resistance.svg en.wikipedia.org/wiki/image:staphylococcus_aureus%2c_50%2c000x%2c_usda%2c_ars%2c_emu.jpg