Declarative Merging of and Reasoning about Decision Diagrams

Similar documents
Liberal Safety for Answer Set Programs with External Sources

Inconsistency Management for Traffic Regulations

Diagnosing Automatic Whitelisting for Dynamic Remarketing Ads Using Hybrid ASP

A theory of modular and dynamic knowledge representation

Bayesian Networks BY: MOHAMAD ALSABBAGH

Model Checking for Propositions CS477 Formal Software Dev Methods

Modern Information Retrieval

Introduction to Theoretical Computer Science

Pattern Recognition and Machine Learning. Learning and Evaluation of Pattern Recognition Processes

Negotiation Using Logic Programming with Consistency Restoring Rules

Individuals and Relations

Jeffrey D. Ullman Stanford University

High Performance Absorption Algorithms for Terminological Reasoning

Anomaly Detection for the CERN Large Hadron Collider injection magnets

Models. Models of Computation, Turing Machines, and the Limits of Turing Computation. Effective Calculability. Motivation for Models of Computation

Hierachical Name Entity Recognition

Qualifying Exam in Machine Learning

Binary Decision Diagrams

Realizing Default Logic over Description Logic Knowledge Bases. Minh Dao-Tran, Thomas Eiter, Thomas Krennwallner

Binary Decision Diagrams. Graphs. Boolean Functions

A brief introduction to Logic. (slides from

Lectures on Medical Biophysics Department of Biophysics, Medical Faculty, Masaryk University in Brno. Biocybernetics

A model building framework for Answer Set Programming with external computations

Intelligent Systems (AI-2)

Unranked Tree Automata with Sibling Equalities and Disequalities

STA 4273H: Statistical Machine Learning

Knowledge representation DATA INFORMATION KNOWLEDGE WISDOM. Figure Relation ship between data, information knowledge and wisdom.

A short introduction to supervised learning, with applications to cancer pathway analysis Dr. Christina Leslie

Resolving Conflicts in Action Descriptions

CTL-RP: A Computational Tree Logic Resolution Prover

Intelligent Systems (AI-2)

Introduction to Machine Learning CMU-10701

Classification Based on Logical Concept Analysis

Lecture 8. Instructor: Haipeng Luo

Finding Explanations of Inconsistency in Multi-Context Systems

Algorithms for Classification: The Basic Methods

Computing Least Common Subsumers in Description Logics with Existential Restrictions*

Preference-based Inconsistency Assessment in Multi-Context Systems

Towards Lifelong Machine Learning Multi-Task and Lifelong Learning with Unlabeled Tasks Christoph Lampert

1 Circuit Complexity. CS 6743 Lecture 15 1 Fall Definitions

Induction on Decision Trees

LTCS Report. A finite basis for the set of EL-implications holding in a finite model

Machine Learning Recitation 8 Oct 21, Oznur Tastan

Learning Methods for Linear Detectors

A Stochastic l-calculus

A Database Framework for Classifier Engineering

Business Process Technology Master Seminar

Bayesian belief networks

Robotics 2 AdaBoost for People and Place Detection

The exam is closed book, closed calculator, and closed notes except your one-page crib sheet.

10-701/ Machine Learning, Fall

Lecture 7: Passive Learning

18.6 Regression and Classification with Linear Models

Logic in AI Chapter 7. Mausam (Based on slides of Dan Weld, Stuart Russell, Dieter Fox, Henry Kautz )

Improved Algorithms for Module Extraction and Atomic Decomposition

Induction of Decision Trees

Classification Using Decision Trees

A graph kernel approach to the identification and characterisation of structured non-coding RNAs using multiple sequence alignment information

Support Vector Machines

Deciding Equivalence between Extended Datalog Programs. A Brief Survey.

3 Propositional Logic

Kernel Methods & Support Vector Machines

Infinite Ensemble Learning with Support Vector Machinery

Machine Learning Lecture 2

Decision Trees: Overfitting

CS6375: Machine Learning Gautam Kunapuli. Decision Trees

Comp487/587 - Boolean Formulas

CSCE 222 Discrete Structures for Computing. Propositional Logic. Dr. Hyunyoung Lee. !!!!!! Based on slides by Andreas Klappenecker

CMSC 422 Introduction to Machine Learning Lecture 4 Geometry and Nearest Neighbors. Furong Huang /

Incremental Learning and Concept Drift: Overview

Probabilistic and Logistic Circuits: A New Synthesis of Logic and Machine Learning

Scalable robust hypothesis tests using graphical models

Complexity Theory Part Two

Object Oriented Knowledge Bases in Logic Programming. Vinay K. Chaudhri Stijn Heymans Michael Weseel Son Cao Tran

Data Mining. 3.6 Regression Analysis. Fall Instructor: Dr. Masoud Yaghini. Numeric Prediction

Cardinal and Ordinal Preferences. Introduction to Logic in Computer Science: Autumn Dinner Plans. Preference Modelling

Domain Modelling: An Example (LOGICAL) DOMAIN MODELLING. Modelling Steps. Example Domain: Electronic Circuits (Russell/Norvig)

13th International Conference on Relational and Algebraic Methods in Computer Science (RAMiCS 13)

Theory of Computer Science

Automata-based Verification - III

Bayesian belief networks. Inference.

Theory of Computer Science. Theory of Computer Science. E1.1 Motivation. E1.2 How to Measure Runtime? E1.3 Decision Problems. E1.

Linear Classifiers. Michael Collins. January 18, 2012

Click Prediction and Preference Ranking of RSS Feeds

Correcting Access Restrictions: a Range-based Approach

Tree Automata with Generalized Transition Relations

Machine Learning

Lecture 7: DecisionTrees

Chapter 11: Automated Proof Systems

Learning Decision Trees

Statistical learning theory, Support vector machines, and Bioinformatics

Basing Decisions on Sentences in Decision Diagrams

Randomized Decision Trees

Introduction to Machine Learning

Final. Introduction to Artificial Intelligence. CS 188 Spring You have approximately 2 hours and 50 minutes.

(Type) Constraints. Solving constraints Type inference

Probabilistic Graphical Models for Image Analysis - Lecture 1

Data Mining and Machine Learning

ECE521 Lecture7. Logistic Regression

Linear Classifiers IV

Transcription:

Declarative Merging of and Reasoning about Decision Diagrams Thomas Eiter Thomas Krennwallner Christoph Redl {eiter,tkren,redl}@kr.tuwien.ac.at September 12, 2011 Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 1 / 26

Outline 1 Motivation 2 Preliminaries: MELD 3 Merging of Decision Diagrams 4 Reasoning about Decision Diagrams 5 Application: DNA Classification 6 Conclusion Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 2 / 26

Motivation Outline 1 Motivation 2 Preliminaries: MELD 3 Merging of Decision Diagrams 4 Reasoning about Decision Diagrams 5 Application: DNA Classification 6 Conclusion Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 3 / 26

Motivation Motivation Decision Diagrams Important means for decision making Intuitively understandable Not only for knowledge engineers Examples ATGCAGGCCTAGCCGCCTAGATGG v=(f 1,..., f 20 ) feature1>12,50 Severity ratings (e.g. TNM system) Diagnosis of personality disorders DNA classification feature8<0,06 feature3>7,50 feature20<1,42 feature20>1,42 feature20<1,42 coding noncoding coding noncoding coding noncoding feature8<0,06 feature20>1,42 feature3>7,50 noncoding coding feature20<1,42 feature20>1,42 noncoding coding coding noncoding Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 4 / 26

Motivation Multiple Diagrams Reasons Different opinions Randomized machine-learning algorithms Statistical impreciseness Question: How to combine them? Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 5 / 26

Motivation Multiple Diagram Integration The DDM System Integration process declaratively described Ingredients: 1 input decision diagrams 2 merging algorithms (predefined or user-defined) Focus: process formalization experimenting with different (combinations of) merging algorithms declarative reasoning for controlling the merging process We do not focus: concrete merging strategies accuracy improvement Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 6 / 26

Preliminaries: MELD Outline 1 Motivation 2 Preliminaries: MELD 3 Merging of Decision Diagrams 4 Reasoning about Decision Diagrams 5 Application: DNA Classification 6 Conclusion Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 7 / 26

Preliminaries: MELD MELD Task Collection of knowledge bases: KB = KB 1,..., KB n Associated collections of belief sets: BS(KB 1 ),..., BS(KB n ) B Σ Goal: Integrate them into a single set of belief sets Method: Merging Operators ( n,m : 2 B Σ ) n Example }{{} collections of belief sets A 1... A }{{ m 2 } BΣ operator arguments Operator definition: 2,0 (B 1, B 2 ) = {B 1 B 2 B 1 B 1, B 2 B 2, A : {A, A} (B 1 B 2 )}, Application: B 1 = {{a, b, c}, { a, c}}, B 2 = {{ a, d}, {c, d}} 2,0 (B 1, B 2 ) = {{a, b, c, d}, { a, c, d}} Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 8 / 26

Preliminaries: MELD MELD Merging Plan Hierarchical arrangement of merging operators Example \ BS(KB 1 ) BS(KB 2 ) BS(KB 3 ) BS(KB 4 ) BS(KB 5 ) Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 9 / 26

Preliminaries: MELD MELD Merging Tasks User provides belief bases with associated collections of belief sets merging plan optional: user-defined merging operators MELD: automated evaluation Advantages Reuse of operators Quick restructuring of merging plan Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 10 / 26

Merging of Decision Diagrams Outline 1 Motivation 2 Preliminaries: MELD 3 Merging of Decision Diagrams 4 Reasoning about Decision Diagrams 5 Application: DNA Classification 6 Conclusion Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 11 / 26

Merging of Decision Diagrams Decision Diagrams Definition (Decision Diagram) A decision diagram over D and C is a labelled rooted directed acyclic graph D = V, E, l C, l E V... nonempty set of nodes with unique root node r D V E V V... set of directed edges l C : V C... partial function assigning a class to all leafs l E : E Q... assign queries Q(z) : D {true, false} to edges Query language: O 1 O 2 with operands O 1, O 2 and {<,, =,,, >} or else Example D = {1, 2, 3, 4, 5} C = {c 1, c 2 } r D z < 3 else v 1 z < 4 v 2 z < 2 else v 3 c 1 else c 2 v 4 Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 12 / 26

Merging of Decision Diagrams Decision Diagrams Definition (Decision Diagram) A decision diagram over D and C is a labelled rooted directed acyclic graph D = V, E, l C, l E V... nonempty set of nodes with unique root node r D V E V V... set of directed edges l C : V C... partial function assigning a class to all leafs l E : E Q... assign queries Q(z) : D {true, false} to edges Query language: O 1 O 2 with operands O 1, O 2 and {<,, =,,, >} or else Example D = {1, 2, 3, 4, 5} C = {c 1, c 2 } Classify: 4 r D z < 3 else v 1 z < 4 v 2 z < 2 else v 3 c 1 else c 2 v 4 Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 12 / 26

Merging of Decision Diagrams Decision Diagrams Definition (Decision Diagram) A decision diagram over D and C is a labelled rooted directed acyclic graph D = V, E, l C, l E V... nonempty set of nodes with unique root node r D V E V V... set of directed edges l C : V C... partial function assigning a class to all leafs l E : E Q... assign queries Q(z) : D {true, false} to edges Query language: O 1 O 2 with operands O 1, O 2 and {<,, =,,, >} or else Example D = {1, 2, 3, 4, 5} C = {c 1, c 2 } Classify: 4 r D z < 3 else v 1 z < 4 v 2 z < 2 else v 3 c 1 else c 2 v 4 Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 12 / 26

Merging of Decision Diagrams Decision Diagrams Definition (Decision Diagram) A decision diagram over D and C is a labelled rooted directed acyclic graph D = V, E, l C, l E V... nonempty set of nodes with unique root node r D V E V V... set of directed edges l C : V C... partial function assigning a class to all leafs l E : E Q... assign queries Q(z) : D {true, false} to edges Query language: O 1 O 2 with operands O 1, O 2 and {<,, =,,, >} or else Example D = {1, 2, 3, 4, 5} C = {c 1, c 2 } Classify: 4 c 2 r D z < 3 else v 1 z < 4 v 2 z < 2 else else v 3 c 1 c 2 v 4 Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 12 / 26

Merging of Decision Diagrams Decision Diagrams Definition (Decision Diagram) A decision diagram over D and C is a labelled rooted directed acyclic graph D = V, E, l C, l E V... nonempty set of nodes with unique root node r D V E V V... set of directed edges l C : V C... partial function assigning a class to all leafs l E : E Q... assign queries Q(z) : D {true, false} to edges Query language: O 1 O 2 with operands O 1, O 2 and {<,, =,,, >} or else Example D = {1, 2, 3, 4, 5} C = {c 1, c 2 } Classify: 4 c 2 r D z < 3 else v 1 z < 4 v 2 z < 2 else else v 3 c 1 c 2 v 4 Note: D may consist of composed objects, e.g. Q(z) = z.tsh > 4.5mU/l Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 12 / 26

Merging of Decision Diagrams Decision Diagram Merging Instantiation of MELD How to use MELD for decision diagram merging? Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 13 / 26

Merging of Decision Diagrams Decision Diagram Merging Instantiation of MELD How to use MELD for decision diagram merging? 1 Encode decision diagrams as belief sets 2 Merging by special operators Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 13 / 26

Merging of Decision Diagrams Decision Diagram Merging Instantiation of MELD How to use MELD for decision diagram merging? 1 Encode decision diagrams as belief sets 2 Merging by special operators 1. Encoding Define nodes root(n), inner(n), leaf (n, l) Arcs between nodes, labelled with conditions cond(n 1, n 2, o 1, c, o 2 ), else(n 1, n 2 ) Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 13 / 26

Merging of Decision Diagrams 1. Encoding of Decision Diagrams Example Decision Diagram D: r D z < 3 else v 1 z < 4 v 2 z < 2 else v 3 c 1 else c 2 v 4 E(D) = { root(r D ); inner(r D ); inner(v 1 ); inner(v 2 ); leaf (v 3, c 1 ); leaf (v 4, c 2 ); cond(r D, v 1, z, <, 3); else(r D, v 2 ); cond(v 1, v 3, z, <, 2); else(v 1, v 4 ); cond(v 2, v 3, z, <, 4); else(v 2, v 4 )} Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 14 / 26

Merging of Decision Diagrams 2. Merging of Decision Diagrams Merging Belief sets = encoded diagrams X Y Z W BS(KB 1 ) BS(KB 2 ) BS(KB 3 ) BS(KB 4 ) BS(KB 5 ) Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 15 / 26

Merging of Decision Diagrams 2. Merging of Decision Diagrams Merging Belief sets = encoded diagrams X Y Z W E(D 1 ) E(D 2 ) E(D 3 ) E(D 4 ) E(D 5 ) Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 15 / 26

Merging of Decision Diagrams 2. Merging of Decision Diagrams Merging Belief sets = encoded diagrams X Y Z W E(D 1 ) E(D 2 ) E(D 3 ) E(D 4 ) E(D 5 ) Special merging operators W, X, Y, Z required! Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 15 / 26

Merging of Decision Diagrams 2. Merging of Decision Diagrams Some Examples of Predefined Operators User Preferences Give some class label preference over another D 1 D 2 X > 3 X 3 Y > 2 Y 2 c 1 c 2 c 1 c 2 pref (D 1, D 2, c 2 > c 1 ) X > 3 X 3 Y > 2 Y 2 Y > 2 Y 2 c 1 c 2?? Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 16 / 26

Merging of Decision Diagrams 2. Merging of Decision Diagrams Some Examples of Predefined Operators User Preferences Give some class label preference over another D 1 D 2 X > 3 X 3 Y > 2 Y 2 c 1 c 2 c 1 c 2 pref (D 1, D 2, c 2 > c 1 ) X > 3 X 3 Y > 2 Y 2 Y > 2 Y 2 c 1 c 2 c 2 c 2 Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 16 / 26

Merging of Decision Diagrams 2. Merging of Decision Diagrams Some Examples of Predefined Operators User Preferences Give some class label preference over another Majority Voting Majority of input diagrams decides upon an element s class Simplification Decrease redundancy MORGAN merging strategy see later... Note: Operators may produce multiple results! Example: Majority voting for classes with equal number of votes Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 16 / 26

Reasoning about Decision Diagrams Outline 1 Motivation 2 Preliminaries: MELD 3 Merging of Decision Diagrams 4 Reasoning about Decision Diagrams 5 Application: DNA Classification 6 Conclusion Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 17 / 26

Reasoning about Decision Diagrams Reasoning about Decision Diagrams Goal Compute diagram properties e.g. height, variable occurrences, redundancy Properties may control the merging process by filtering Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 18 / 26

Reasoning about Decision Diagrams Reasoning about Decision Diagrams Goal Compute diagram properties e.g. height, variable occurrences, redundancy Properties may control the merging process by filtering Realization Special unary operator... set of decision diagrams P... ASP program P := P Ê(D) D asp (, P), Extended Encoding Ê: Multiple diagrams within one set of facts: leaf (L, C) leaf in (I, L, C) Evaluate P under ASP semantics Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 18 / 26

Reasoning about Decision Diagrams Reasoning about Decision Diagrams Example: Node Count Minimization maj ( ) D 1 D 2 asp (, P min ) simp ( ) maj ( ) asp (, P min ) simp ( ) maj ( ) D 3 D 4 P min = {cnt(i, C) LC = #count{l : leaf in (I, L, C)}, IC = #count{n : inner in(i, N)}, root in(i, R), C = LC + IC c(i) root in(i, R), not c(i) c(i) c(j) root in(i, R), root in(j, S), I J leaf (L, C) c(i), leaf in (I, L, C)... else(n 1, N 2) c(i), else in(i, N 1, N 2) M = #min{nc : cnt(i, NC)}, c(i), cnt(i, C), C > M} Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 19 / 26

Application: DNA Classification Outline 1 Motivation 2 Preliminaries: MELD 3 Merging of Decision Diagrams 4 Reasoning about Decision Diagrams 5 Application: DNA Classification 6 Conclusion Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 20 / 26

Application: DNA Classification DNA Classification Motivation Given: Sequence over {A, C, G, T} Question: Is it coding or junk DNA? Usual Approach Training 1 Annotated training set 2 Compute statistical features 3 Machine-learning algorithms Classification 1 Compute the same features 2 Apply decision diagram Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 21 / 26

Application: DNA Classification DNA Classification Advanced Approach [Salzberg et al., 1998] Train multiple diagrams varying training sets, algorithms, features, etc. Merge them afterwards Benefits Parallelization Increase accuracy (cf. genetic algorithms) Smaller training set suffices Hardcoded implementation: MORGAN system Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 22 / 26

Application: DNA Classification DNA Classification MORGAN s strategy in MELD MORGAN s strategy plugged into MELD as merging operator M Benefits identified in [5] confirmed MORGAN vs. MELD-based system Not hardcoded but modular Clear separation: merging operation / other system components reuse / exchange of the merging operator Experiment with different merging strategies Produce multiple diagrams and reason about them Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 23 / 26

Conclusion Outline 1 Motivation 2 Preliminaries: MELD 3 Merging of Decision Diagrams 4 Reasoning about Decision Diagrams 5 Application: DNA Classification 6 Conclusion Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 24 / 26

Conclusion Conclusion Summary MELD: Integration of multiple collections of belief sets Instantiation for decision diagram merging: 1 Encoding of decision diagrams as belief sets 2 Special merging operators for decision diagrams Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 25 / 26

Conclusion Conclusion Summary MELD: Integration of multiple collections of belief sets Instantiation for decision diagram merging: 1 Encoding of decision diagrams as belief sets 2 Special merging operators for decision diagrams Advantages Reuse of operators Evaluate different operators empirically Automatic recomputation of result Release user from routine tasks Download URL: http://www.kr.tuwien.ac.at/research/dlvhex/ddm.html Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 25 / 26

Conclusion References Dov M. Gabbay, Odinaldo Rodrigues, Gabriella Pigozzi Connections between Belief Revision, Belief Merging and Social Choice In: Journal of Logic and Computation 19(3) (2009) Konieczny, S., Pérez, R.P.: On the logic of merging. In: KR 98. (1998) 488 498 Redl, C.: Merging of Biomedical Decision Diagrams Master s thesis, Vienna University of Technology (October 2010) http://www.ub.tuwien.ac.at/dipl/2010/ac07808795.pdf Eiter, T., Ianni, G., Schindlauer, R., Tompits, H.: dlvhex: A system for integrating multiple semantics in an answer-set programming framework. In: WLP 06. (2006) 206 210 Salzberg, S., Delcher, A.L., Fasman, K.H., Henderson, J.: A decision tree system for finding genes in DNA. Journal of Computational Biology 5(4) (1998) 667 680 Eiter T., Krennwallner T., Redl C. (TU Vienna) Dec. Merging of and Reasoning about Decision Diagrams September 12, 2011 26 / 26

2024 © sciencedocbox.com Privacy Policy | Terms of Service | Feedback