Supplemental data. Vos et al. (2008). The plant TPX2 protein regulates pro-spindle assembly before nuclear envelope breakdown.

Similar documents
Practical Bioinformatics

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

SUPPORTING INFORMATION FOR. SEquence-Enabled Reassembly of β-lactamase (SEER-LAC): a Sensitive Method for the Detection of Double-Stranded DNA

Supplemental data. Pommerrenig et al. (2011). Plant Cell /tpc

High throughput near infrared screening discovers DNA-templated silver clusters with peak fluorescence beyond 950 nm

AtTIL-P91V. AtTIL-P92V. AtTIL-P95V. AtTIL-P98V YFP-HPR

Supplemental Table 1. Primers used for cloning and PCR amplification in this study

Clay Carter. Department of Biology. QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture.

Advanced topics in bioinformatics

Supplemental Figure 1.

Characterization of Pathogenic Genes through Condensed Matrix Method, Case Study through Bacterial Zeta Toxin

Electronic supplementary material

Crick s early Hypothesis Revisited

SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS. Prokaryotes and Eukaryotes. DNA and RNA

SUPPLEMENTARY DATA - 1 -

Supplementary Information

SSR ( ) Vol. 48 No ( Microsatellite marker) ( Simple sequence repeat,ssr),

evoglow - express N kit Cat. No.: product information broad host range vectors - gram negative bacteria

Supplementary Information for

TM1 TM2 TM3 TM4 TM5 TM6 TM bp

NSCI Basic Properties of Life and The Biochemistry of Life on Earth

Number-controlled spatial arrangement of gold nanoparticles with

evoglow - express N kit distributed by Cat.#: FP product information broad host range vectors - gram negative bacteria

The Process of Cell Division. Lesson Overview. Lesson Overview The Process of Cell Division

Supporting Information

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008

Table S1. Primers and PCR conditions used in this paper Primers Sequence (5 3 ) Thermal conditions Reference Rhizobacteria 27F 1492R

Regulatory Sequence Analysis. Sequence models (Bernoulli and Markov models)

Supporting Information for. Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)-

Unit 2: Characteristics of Living Things Lesson 25: Mitosis

Genome Sequencing & DNA Sequence Analysis

Building a Multifunctional Aptamer-Based DNA Nanoassembly for Targeted Cancer Therapy

SUPPLEMENTARY INFORMATION

Dr. Mahmood S. Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering & Regenerative Medicine King Edward Medical University

The Cell Cycle & Cell Division

Introduction to Molecular Phylogeny

3. Evolution makes sense of homologies. 3. Evolution makes sense of homologies. 3. Evolution makes sense of homologies

The role of the FliD C-terminal domain in pentamer formation and

Describe the process of cell division in prokaryotic cells. The Cell Cycle

SUPPLEMENTARY INFORMATION

Cell Division. Genetic info must be copied. Each cell gets a complete copy of that info. It occurs in two main stages:

Evolvable Neural Networks for Time Series Prediction with Adaptive Learning Interval

Cell Growth, Division, and Reproduction

Protein Threading. Combinatorial optimization approach. Stefan Balev.

Topic 8 Mitosis & Meiosis Ch.12 & 13. The Eukaryotic Genome. The Eukaryotic Genome. The Eukaryotic Genome

Cell Cycle and Mitosis

11.4 Meiosis. Vocabulary: Homologous Diploid Haploid Meiosis Crossing-over Tetrad

The 3 Genomic Numbers Discovery: How Our Genome Single-Stranded DNA Sequence Is Self-Designed as a Numerical Whole

Modelling and Analysis in Bioinformatics. Lecture 1: Genomic k-mer Statistics

CELL GROWTH AND DIVISION. Chapter 10

Biology: Life on Earth

Honors Biology Test Chapter 8 Mitosis and Meiosis

Chapter 5: Mitosis is the Basis of Asexual Reproduction

10.1 Growth and Cell Reproduction

The Trigram and other Fundamental Philosophies

AP Biology Fall Semester Set 1

Sex-Linked Inheritance in Macaque Monkeys: Implications for Effective Population Size and Dispersal to Sulawesi

Biology 2018 Final Review. Miller and Levine

Typical Life Cycle of Algae and Fungi. 5 Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

Meiosis. Bởi: OpenStaxCollege

Cell Division: the process of copying and dividing entire cells The cell grows, prepares for division, and then divides to form new daughter cells.

3.2.2 All cells arise from other cells

The Microscopic Observation of Mitosis in Plant and Animal Cells

Mitosis & Meiosis. PPT Questions. 4. Why must each new cell get a complete copy of the original cell s DNA?

AP Biology - Cell cycle / division

Codon Distribution in Error-Detecting Circular Codes

Cell Reproduction Review

Comparing Genomes! Homologies and Families! Sequence Alignments!

CELL DIVISION IN EUKARYOTES. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc.

Cellular Division. copyright cmassengale

Ginkgo leaf. Ginkgo is dioecious, separate sexes: male and female plants are separate. Monoecious plants have both male and female parts.

Evolutionary dynamics of abundant stop codon readthrough in Anopheles and Drosophila

Mitosis and Meiosis Cell growth and division

CELL CYCLE AND CELL DIVISION

2. is the period of growth and development for a cell. 3. During interphase, most cells go through three stages rapid growth and

Biology Unit 6 Chromosomes and Mitosis

Why do more divergent sequences produce smaller nonsynonymous/synonymous

Bio 10: 10.1 Cell Growth, Division, and Reproduction

Topic 6 Cell Cycle and Mitosis. Day 1

Biology. Chapter 10 Cell Reproduction. I. Chromosomes

Cell Growth and Division

Re- engineering cellular physiology by rewiring high- level global regulatory genes

2:1 Chromosomes DNA Genes Chromatin Chromosomes CHROMATIN: nuclear material in non-dividing cell, composed of DNA/protein in thin uncoiled strands

Cell Growth and Reproduction Module B, Anchor 1

FliZ Is a Posttranslational Activator of FlhD 4 C 2 -Dependent Flagellar Gene Expression

7th 4.2 review. 1. Chromosomes line up single file at the middle of the cell. 2. Two identical nuclei form. 3. Sister chromatids separate.

Bio 102 Practice Problems Cell Cycle and Cell Division

E. Incorrect! At telophase II, cells are nearly completed with meiosis, with no cross-over.

Cell Division: the process of copying and dividing entire cells The cell grows, prepares for division, and then divides to form new daughter cells.

Name Chapter 10: Chromosomes, Mitosis, and Meiosis Mrs. Laux Take home test #7 DUE: MONDAY, NOVEMBER 16, 2009 MULTIPLE CHOICE QUESTIONS

10.1 Cell Growth, Division, and Reproduction

Near-instant surface-selective fluorogenic protein quantification using sulfonated

Cell Division. Binary Fission, Mitosis & Meiosis 2/9/2016. Dr. Saud Alamri

Cell Cycle (mitosis and meiosis) Test Review

Cell Division. Mitosis

Cell Growth and Division

Cell Size. Cell Growth and Reproduction 12/3/14

Supplemental Figure 1. Differences in amino acid composition between the paralogous copies Os MADS17 and Os MADS6.

ChemiScreen CaS Calcium Sensor Receptor Stable Cell Line

Mitosis Verses Meiosis

Transcription:

Supplemental data. Vos et al. (2008). The plant TPX2 protein regulates pro-spindle assembly before nuclear envelope breakdown. SUPPLEMENTAL FIGURE 1 ONLINE Xenopus laevis! Xenopus tropicalis! Danio rerio! Salmo salar! Oncorhynchus mykiss! Gallus gallus! Monodelphis domestica! Oryctolagus cuniculus! Canis familiaris! Bos taurus! Rattus norvegicus! Mus musculus! Macaca mulatta! Pan troglodites! Pongo pymaeus! Homo sapiens! Physcomitrella Patens 1! Physcomitrella patens 2! Zamia fischeri 1! Zamia fischeri 2! Gossypium hirsutum 1! Gossypium hirsutum 2! Asparagus officinalis 1! Festuca arundinacea 1! Festuca arundinacea 2! Saccharum officinarum 1! Saccharum officinarum 2! Triticum aestivum 1! Triticum aestivum 2! Zea mays 1! Zea mays 2! Oriza sativa 1! Oriza sativa 2! Hordeum vulgare 2! Hordeum vulgare 1! Vitis vinifera 1! Vitis vinifera 2! Arabidopsis thaliana 1! Arabidopsis thaliana 2! Brassica oleracea 1! Brassica oleracea 2! Trifolium pratense 1! Medicago truncatula 2! Lycopersicon esculentum 1! Helianthus annuus 2! Triticum aestivum 2b! Zea Mays 1b 10 20 R H R P V T C K S A A E L E A E E L E M I N Q Y K F K A R L R P V M C K S A A E L E A E E L E R I Q Q Y K F K A R H R P T T V K S T A E L E A E E V E K L Q Q F K F K A R S R P T V V K S S A E L E A E E L Q K L Q Q F K F K A R S R P T A V K S S A E L E A E E L Q K L Q Q F K F K A R F R P V A C K S A A E L E A E E I E K I Q Q Y K F K A R T R P V T C K S T A E L E A E E L E K I Q Q Y K F K A R A R P V T Y K S A A D Q E A E E L E K L Q Q Y K F K A R T R P V T Y K S A A D Q E A E E L E K L Q Q Y K F K A R T R P V T C K S A A D L E A E E L E K Q Q Q Y K F K A R A R A V T C K S A A E K E A E E L E K L Q Q Y K F K A R T R A V T C K S T A E Q E A E E L E K L Q Q Y K F K A R A R P V T C K S A A E L E A E E F E K L Q Q Y K F K A R A R P V T C K S T A E V E A E E L E K L Q Q Y K F K A R A R P V T C K S T A E L E A E E L E K L Q Q Y K F K A R A R A V T C K S T A E L E A E E L E K L Q Q Y K F K A R T R P S K M K S T A E I E E E M I A N L - - P K F K A R A R P I S V K S T E E L E A E Q L A K I - - P K F K A R A R P I R V K S T A E L E E E M L A K I - - P K F K A R A R P P K V K S S E E L E L E E L E K M - - P K F K A R M R P V A V K S T A E L E E E M M A K I - - P K F K A R A R P I T V K S S I E L E Q E E L E K A - - P K F K A R V R A V R I K S S A E L E E E M L A K I - - P K F K A R V R A V R M K N S S E L E E E M L A K I - - P K F R A R A R P S R A K S S Q E L E L E E L E N A - - P K F K A R V R A V K V K S S A E L E E E M L A K I - - P K F R A R V R P P S V K S S Q E L E L E E L E K A - - P K F K A R V R A V R M K S S S E L E E E M L A K I - - P K F K A R A R P S R V K S S E E L E L E E L E K A - - P K F K A R V R A V K V K S S A E I E E E M L A K I - - P K F R A R A R P P S V K S F Q E L E L E E L E K A - - P K F K A R V R A V R V K S S A E L E E E M L A K I - - P K F R A R A R P P R V K S S Q E L E L E E L E K A - - P K F K A R A R P S R V K S S Q E L E L E E L E K A - - P K F K A R V R A V R M K S S S E L E E E M L A K I - - P K F R A R V R S V R V K S T A E L E E E M M A K I - - P K F K A R A R P P R V K S S V E L E Q E A L E K V - - L P F K A R A R P L R V K S S A E L E E E M L A K I - - P K F K A R A R P T I A K T T A E L E Q E E L E K A - - P K F K A R A R P V R V K S S A E L E E E M L A K I - - P K F K A R A R P T K A K T T A E L E Q E E L E K A - - P K F K A R V R P A R V K S A A E L E E E M M A K M - - P K F K A R A R P P T V K S S L E I E Q E E L E K I - - P K F K A R V R P T T V K S S A E L E E E M M A K I - - P K F K A R A R A P N V K S T E E L E R E E L E K A - - P K F K A R A R P S R V K S T Q E L E L E E L E K A - - P K F K A R I R A V K V K S S A E I E E E M L A K I - - P K F R A Alignment of the TPX2 Signature Motifs. Blast searches identified TPX2 motifs in the protein of various animals and plants, but not in insects, worms or fungi. All researched species that were used to make a relationship tree in Supplemental Figure 2 are shown.

SUPPLEMENTAL FIGURE 2 ONLINE Phylogram of Eukaryote TPX2 Signatures. The relationship tree was constructed on both At TPX2 signature sequences using the Neighbor Joining method and Poisson distance correction. All land plants, including the moss Physcomitrella, possess two copies of the TPX2 signature, suggesting that the duplication occurred before land plant speciation. The TPX2 signature found in vertebrates is more closely related to the second plant signature than to the first one. Interestingly, evolution is quite well respected despite the short length of the signature. Number 1 and 2 refer to the signature positions from N- to C-terminus of TPX2 found in plant species.

SUPPLEMENTAL FIGURE 3 ONLINE -TPX2-f1 At TPX2-f1 16 7 22 37 -TPX2-f2 At TPX2-f2 30 43 38 57 Sequence Alignment of Arabidopsis and Human Aurora and TPX2. Shown are the amino acid sequence alignment of with the crystallographic partial sequence of Hs Aurora A (; top) and the alignment of At TPX2 with the two crystallographic sequences of Hs TPX2 that interact with HsAurora A in the crystal (bottom). The 38 amino acids from human Aurora A indicated by triangles (!, colored according to Fig. 2A) are involved in the interaction with Hs TPX2 and show a variation of their accessible surface when calculated with or without the presence of TPX2. The full length sequence, which may have conserved this function, shows 74% identity and 95% similarity to the human Aurora A sequence.

SUPPLEMENTAL FIGURE 4 ONLINE At TPX2 Localization during Cell Division in Immunolabeled BY-2 cells. (A-H). Endogenous TPX2 (Top), microtubule (middle) and dapi (bottom) staining of cycling cells. TPX2 localization is intranuclear in late G2 (A) and perinuclear in early prophase (B). In late prophase (C) it forms two polar crescents outside of the nucleus. After NEB the spindle becomes labeled (D, E). The polar labeling progressively disappears during anaphase-telophase transition (F-H).

SUPPLEMENTAL FIGURE 5 ONLINE Dynamics of At TPX2 during Cell Division. GFP-At TPX2 fluorescence intensity graph of various BY-2 cell parts during prophase, mitosis and cytokinesis. The nuclear fluorescence is quickly reduced before NEB. The peak at the onset of metaphase is due to the intense labeling of the first microtubule bundles in the plain of focus (see also Figure 3 K at T=3 ). Thereafter, the protein becomes distributed over many newly polymerized microtubules. At the end of anaphase the protein is focused to the shortening kinetochore fibers and is then clearly degraded. All fluorescence intensities were measured as the mean pixel intensities in 50 x 50 pixel boxes of the cell in movie S3, except the nuclear envelope measurements, which were based on a 15 x 15 pixel box. All data were corrected to the background intensity.

SUPPLEMENTAL FIGURE 6 ONLINE Microinjection of TRITC-dextran. As a control, TRITC conjugated dextran (160 kda) was microinjected in a Tradescantia virginiana stamen hair cell during late prophase. The inert polysaccharide distributes throughout the cytoplasmic volume of the cell, but is excluded from the nucleus and the vacuole. Just before NEB (35 to 45 min after injection) a fluorescent halo becomes visible around the nucleus. This coincides with the (organelles excluding) pro-spindle that is formed at that time. The dextran is again excluded from the reforming nucleus during telophase due to the restricted accessible volume between the decondensing chromosomes. Needle concentration was 0.5 mg/ml, time in minutes after injection and the bar is 20!m.

SUPPLEMENTAL FIGURE 7 ONLINE HindIII SphI! -lactamase 3600 3800 4000 0 200 400 600 CaMV 35S SalI StyI NcoI XmaI 3400 800 KpnI SmaI 3200 pneg-x1 4209bp 3000 2800 2600 1600 1400 1000 1200 E-TAG-s65tGFP fusion protein ORI 2400 2200 2000 1800 NOS 3' MluI TliI EcoRI XhoI HpaI SacII Multiple cloning site 5' end of egfp NotI SalI NcoI KpnI XmaI! ACAATTACAGTCGACTCTAGAGGATCC ATG GTA CCC GGG GCT CCA GTG CCT TAT CCA GAT CCA CTT GAA CCT CGC ATG GTG AGC! TGTTAATGTCAGCTGAGATCTCCTAGG TAC CAT GGG CCC CGA GGT CAC GGA ATA GGT CTA GGT GAA CTT GGA GCG TAC CAC TCG! M V P G A P V P Y P D P L E P R M V S!!!!!!!!!!!! E-Tag egfp Multiple cloning site 3' end of egfp MluI XhoI HpaI SacII NotI! GCC GCC GGG ATC ACT CAC GGC ATG GAC GAG CTG TAC AAA CGC GTC TCG AGT TAA CCGCGGCGGCCGCCCGGCTGCAGATC! CGG CGG CCC TAG TGA GTG CCG TAC CTG CTC GAC ATG TTT GCG CAG AGC TCA ATT GGCGCCGCCGGCGGGCCGACGTCTAG! A A G I T H G M D E L Y K R V S S *! egfp Map and multiple cloning sites of pneg-x1. Map of the puc derivative pneg-x1 showing the position of AmpR resistance gene, ORI, CaMV 35S promoter, E-tag-eGFP coding frame, NOS terminator as well as localization of important single cutter restriction enzymes. 5' and 3' MCS sequences are detailled below the map showing also the peptide sequence of the E-tag and translation frame.

SUPPLEMENTAL TABLE 1 ONLINE Combined Results of Experiments Concerning GFP:At TPX2 Expression. GFP-constructs full length 1-758 Protein size in kda Nuclear only At TPX2 expression / labeling Nuclear + Cytoplasmic Nuclear excluded Microtubule (interphase and/or mitosis) 113 60% 5% 35% yes 1-758 113-4% 96% yes 1-758 113-100% - yes Organism Arabidopsis root meristem N. plumba. protoplasts N.bentha. leaves Number of cells Illustrations 300 Fig 3J 25-300 - 1-758 113 80% 20% - yes BY-2 cells 80 Fig 3K 1-758 + colchicin 10!M 113 98% 2% - no BY-2 cells 50-1-758 + oryzalin 2!M 113 96% 4% - no BY-2 cells 25-1-758 + latrunculin B 10!M 113 82% 18% - yes BY-2 cells 50-1-579 92-100% - yes BY-2 cells 72 Fig 4B 1-463 79 90% 10% - no BY-2 cells 62 Fig 4A 1-303 61 80% 20% - no BY-2 cells 64 Fig 4A 1-104 39-100% - no BY-2 cells 30 Fig 4C 1-403 + 463-758 106 87% 13% - yes BY-2 cells 46 Fig 4A 1-303 + 463-758 95 70% 30% - yes BY-2 cells 34 Fig 4A 163-463 61 80% 20% - no BY-2 cells 60 Fig 4A 220-463 55 100% - - no BY-2 cells 18 Fig 4A 220-463 55-100% - yes BY-2 cells 22 Fig 4B NLS1 mut 303-463 45-100% - no BY-2 cells 50 Fig 4C ChS/1-72 79 11% 34% 55% no BY-2 cells 18 Fig 4D ChS/59-72 72-16% 84% no BY-2 cells 38 Fig 4D ChS/220-303 80 100% - - no BY-2 cells 22 Fig 4A 463-758 62 100% - - no BY-2 cells 32 Fig 4A 220-303 + 463-758 72 100% - - no BY-2 cells 25 Fig 4A 610-758 44 100% - - no BY-2 cells 18 Fig 4A 610-758 NLS2 mut 44 - - 100% yes BY-2 cells 30 Fig 4B 303-610 63 - - 100% yes BY-2 cells 25 Fig 4D 303-610 + LMB 63-100% - no BY-2 cells 25-463-610 44,5 - - 100 % yes BY-2 cells 25 Fig 4D 463-610 44,5-100% - no BY-2 cells 21 Fig 4C NES mut 463-610 + LMB 44,5-100% - no BY-2 cells 25 Fig 5B 550-630 37-100% - no BY-2 cells 18 Fig 4C 684-758 21 - - - yes BY-2 cells 11 Fig 4B

SUPPLEMENTAL TABLE 2 ONLINE Accession numbers Animal organism Accession number Plant organism Accession number Bos Taurus NP_001092368 (2) Arabidopsis thaliana AT1G03780 (1,2) Canis familiaris XP_850934 (2) Asparagus officinalis CV461179 (1) Danio rerio BX927210.9 (2) Brassica oleracea DY025756 (1,2) Gallus gallus NP_989768 (2) Festuca arundinacea DT685973 (1,2) Homo sapiens BAG50902 (2) Gossypium hirsutum ES817692 (1) DR462351 (2) Macaca mulatta XP_001109645 (2) Helianthus annuus BU028081 (2) Monodelphis domestica XP_001364540 (2) Hordeum vulgare CK123033 (1,2) Mus musculus EDL05995 (2) Medicago truncatula BQ147900 (2) Oryctolagus cuniculus ENSOCUP000000 02784 (2) Lycopersicon esculentum BE462309 (1) Oncorhynchus mykiss BX085216.3 (2) Oryza sativa CK070246 (1,2) Pan troglodites XP_514566 (2) Physcomitrella Patens XP_001755041 (1,2) Pongo pymaeus NP_001125744 (2) Saccharum officinarum CA249551 (1) CA293532 (2) Rattus norvegicus NP_001101260 (2) Trifolium pratense BB912562 (1) Salmo salar DY736807.1 (2) Triticum aestivum CD924467 (2) BE637442 (2b) Xenopus tropicalis AAI35343 (2) Vitis vinifera CAO69775 (1,2) Xenopus laevis AAH68637 (2) Zamia fischeri DY030926 (1,2) Zea mays BQ487079 (1) CF015305 (1b) CF036158 (2) Oryza sativa CK070246 (1,2) Physcomitrella Patens XP_001755041 (1,2) Accession numbers corresponding to various organism sequences in which a TPX2 signature is present. (1) and (2) refers to the closest similarity to respectively the first and second signature motif found in Arabidopsis thaliana. (1,2) refers to sequences including both signatures.

SUPPLEMENTAL TABLE 3 ONLINE List of primers used in generating various At TPX2 constructs GFP-constructs Oligos used for GFP fusions in pnegx1 forward reverse 1-758 GTCTCGAGTATGGAAGCAACGGCGGAG GCGGCCGCTTATCTCATCTGACCAGC 463-758 GTCTCGAGTGAAAGTAAAGGAGAAATG GCGGCCGCTTATCTCATCTGACCAGC 1-579 GTCTCGAGTATGGAAGCAACGGCGGAG GCGGCCGCAGGTTCTGGTTTTGGTGG 1-463 GTCTCGAGTATGGAAGCAACGGCGGAG GCGGCCGCAAATATCTTTTTGTTCAA 1-303 GTCTCGAGTATGGAAGCAACGGCGGAG GCGGCCGCGCTTGTTTGGAACTTCTT 1-104 GTCTCGAGTATGGAAGCAACGGCGGAG GCGGCCGCAGAAGGCTGCGATTGTAA 1-403 GTCTCGAGTATGGAAGCAACGGCGGAG GCGGCCGCTGAAGCTATTGAAGATGT 163-463 GTCTCGAGTCCCAAACCACCAATGCAG GCGGCCGCAAATATCTTTTTGTTCAA 220-463 GTCTCGAGTACTACCAATCTGATTCAA GCGGCCGCAAATATCTTTTTGTTCAA 220-463 NLS1 mut GTCTCGAGTACTACCAATCTGATTCAA GCGGCCGCAAATATCTTTTTGTTCAA 303-463 GTCTCGAGTAGCACGCGAGACCTATTC GCGGCCGCAAATATCTTTTTGTTCAA 463-758 GTCTCGAGTTTTGAAAGTAAAGGAGAA GCGGCCGCTTATCTCATCTGACCAGC 220-303 GTCTCGAGTACTACCAATCTGATTCAA GCGGCCGCGCTTGTTTGGAACTTCTT 610-758 GTCTCGAGTATGGAGACAGAAGAAGCC GCGGCCGCTTATCTCATCTGACCAGC 610-758 NLS2 mut GTCTCGAGTATGGAGACAGAAGAAGCC GCGGCCGCTTATCTCATCTGACCAGC 303-610 GTCTCGAGTAGCACGCGAGACCTATTC GCGGCCGCTCTCCTCCTCTCTTCCCT 463-610 CACGCGTGTTTGAAAGTAAAGGAGAA GCGGCCGCTCTCCTCCTCTCTTCCCT 463-610 NES mut CACGCGTGTTTGAAAGTAAAGGAGAA GCGGCCGCTCTCCTCCTCTCTTCCCT 550-630 GTCTCGAGTAAATTAGGAGATGTAAAG GCGGCCGCTGGGTCCTCTTTTATAAC 684-758 GTCTCGAGTATGGTGGAGGAAGAGAGA GCGGCCGCTTATCTCATCTGACCAGC in pkc-gfp-chs ChS/1-72 ChS/59-72 ChS/220-303 CACGCGTGGGGGCGGAGGGGGATGGAAG- -CAACGGCGGAG CACGCGTGGGGGCGGAGGGGGCCTAGAAT- -CAAAGCAAGG CACGCGTGGGGGCGGAGGGGGTCAAGCCA- -TCAAAAGGC TCTAGATTATTAGGCCTCTACCTTGAACGA TCTAGATTATTAGGCCTCTACCTTGAACGA TCTAGATTATTACAGTGTCAGCTTAGGTCG GFP-constructs Oligos used for Mutagenesis in pnegx1 forward reverse 220-463 NLS1 mut CAAGCCATCAAttGGCAAAAGCTAG CTAGCTTTTGCCaaTTGATGGCTTG 610-758 NLS2 mut GAACCAGTACAAtgGATACCGTGAAG CTTCACGGTATCcaTTGTACTGGTTC 463-610 NES mut CTGTCTTtGATATATTCGACAAGtTCTCACTG CAGTGAGAaCTTGTCGAATATATCaAAGACAG Restriction sites corresponding to XhoI (red), NotI (blue), MulI (pink) and XbaI (green) are shown upstream of the TPX2 coding sequence. Lower case letters correspond to mutagenized bases.

2024 © sciencedocbox.com Privacy Policy | Terms of Service | Feedback