A wt spoiiiaδ spoiiiahδ bofaδ B C D E spoiiiaδ, bofaδ Supplemental Figure 1. GFP-SpoIVFA is more mislocalized in the absence of both BofA and SpoIIIAH. Sporulation was induced by resuspension in wild-type and mutant strains and GFP-SpoIVFA localization was monitored by fluorescence microscopy between hour 2 and 2.5. (A) wild-type (strain BDR528). (B) spoiiiaδ (strain BDR718). (C) spoiiiahδ (strain BTD569). (D) bofaδ (strain BDR706). (E) spoiiiahδ, bofaδ (strain BDR779). Scale bar, 1 µm.
wt A IIDΔ, IIPΔ, IIMΔ C 1 2 B D mb mb Supplemental Figure 2. MalF-GFP accumulates at the second polar septum in the spoiid, spoiip, spoiim triple mutant. The malf gene (encoding the integral membrane protein MalF from Escherichia coli) was fused to the gene encoding GFP and the fusion was placed under the control of the spoivf promoter. MalF-GFP was evenly distributed in all mother-cell membranes in wild-type sporulating cells (A). In the spoiid, spoiip, spoiim triple mutant, MalF-GFP accumulated to significant levels at the second disordered septum but was not enriched at the first polar septum (see carets in C). This result is most consistent with the idea that the second septum serves as a non-specific sink for integral membrane proteins. Sporulation was induced by resuspension and MalF-GFP localization was monitored between hour 2 and 2.5 by fluorescence microscopy. (A) MalF-GFP localization in wild type (strain BDR461). (B) The same field as in (A) stained with the membrane dye TMA- DPH. (C) MalF-GFP localization in the spoiid, spoiip, spoiim triple mutant (strain BTD213). The filled caret marks the first polar septum. The empty caret indicates a strong concentration of MalF-GFP at the second polar septum. (D) The same field as in (C) stained with the membrane dye TMA-DPH. Scale bar, 1 µm.
CFP-SpoIIIAH wt spoiiiaδ spoivfδ, bofaδ Supplemental Figure 3. SpoIIIAH localization to the OFM does not require the proteins encoded by the spoiiia locus or SpoIVFA. CFP-SpoIIIAH [saca::p spoiiia -cfp-spoiiiah] was analyzed by fluorescence microscopy in wild type (strain BTD23), spoiiiaδ (strain BTD39) and spoivfδ, bofaδ (strain BTD86) at hour 2.5 of sporulation. Scale bar, 1 µm.
A B spoiiqδ spoiiqδ, spoiiiaδ spoiiqδ, spoiiiaδ, bofaδ B C Supplemental Figure 4. The subcellular localization of GFP-SpoIVFA requires SpoIIQ in the forespore and SpoIIIA in the mother cell. The localization of YFP-SpoIVFA was monitored by fluorescence microscopy at hour 2.5 of sporulation in (A) spoiiqδ (strain BTD505), (B) spoiiqδ, spoiiiaδ (strain BTD507), (C) spoiiqδ, spoiiiaδ, bofaδ (strain BTD511). Scale bar, 1 µm.
The resynthesized cfp gene with codons optimized for synthesis in B. subtilis HindIII RBS aagcttacataaggaggaactact ATG GTT TCA AAA GGC GAA GAA CTG TTT ACG GGA GTA GTG CCG ATT CTG GTC GAA TTA GAT GGC GAT GTC AAT GGC CAT ttcgaatgtattcctccttgatga TAC CAA AGT TTT CCG CTT CTT GAC AAA TGC CCT CAT CAC GGC TAA GAC CAG CTT AAT CTA CCG CTA CAG TTA CCG GTA M V S K G E E L F T G V V P I L V E L D G D V N G H NcoI AAA TTT TCT GTC TCA GGC GAG GGA GAA GGA GAT GCT ACG TAC GGC AAA CTG ACG CTT AAG TTC ATC TGC ACA ACA GGA AAG TTA CCT GTC CCA TGG CCT TTT AAA AGA CAG AGT CCG CTC CCT CTT CCT CTA CGA TGC ATG CCG TTT GAC TGC GAA TTC AAG TAG ACG TGT TGT CCT TTC AAT GGA CAG GGT ACC GGA K F S V S G E G E G D A T Y G K L T L K F I C T T G K L P V P W P F64L S65TY66W ACA TTA GTC ACG ACA CTT ACG TGG GGA GTA CAG TGC TTC AGC AGA TAC CCG GAT CAC ATG AAA CAG CAC GAT TTC TTC AAA TCA GCC ATG CCG GAA GGC TGT AAT CAG TGC TGT GAA TGC ACC CCT CAT GTC ACG AAG TCG TCT ATG GGC CTA GTG TAC TTT GTC GTG CTA AAG AAG TTT AGT CGG TAC GGC CTT CCG T L V T T L T W G V Q C F S R Y P D H M K Q H D F F K S A M P E G TAT GTG CAA GAA CGC ACG ATT TTT TTC AAG GAC GAC GGA AAT TAT AAA ACA CGC GCG GAA GTC AAA TTT GAA GGC GAC ACG CTT GTC AAT AGA ATC GAA ATA CAC GTT CTT GCG TGC TAA AAA AAG TTC CTG CTG CCT TTA ATA TTT TGT GCG CGC CTT CAG TTT AAA CTT CCG CTG TGC GAA CAG TTA TCT TAG CTT Y V Q E R T I F F K D D G N Y K T R A E V K F E G D T L V N R I E N146I M153T CTG AAA GGA ATT GAC TTT AAG GAG GAT GGC AAC ATC TTA GGA CAC AAA CTG GAA TAT AAT TAC ATC TCT CAC AAT GTT TAT ATC ACA GCA GAT AAG CAA GAC TTT CCT TAA CTG AAA TTC CTC CTA CCG TTG TAG AAT CCT GTG TTT GAC CTT ATA TTA ATG TAG AGA GTG TTA CAA ATA TAG TGT CGT CTA TTC GTT L K G I D F K E D G N I L G H K L E Y N Y I S H N V Y I T A D K Q V163A AAA AAC GGA ATC AAG GCT AAT TTC AAA ATC CGC CAT AAC ATT GAG GAC GGA AGC GTT CAA TTA GCA GAT CAT TAC CAG CAG AAT ACA CCG ATT GGA GAT TTT TTG CCT TAG TTC CGA TTA AAG TTT TAG GCG GTA TTG TAA CTC CTG CCT TCG CAA GTT AAT CGT CTA GTA ATG GTC GTC TTA TGT GGC TAA CCT CTA K N G I K A N F K I R H N I E D G S V Q L A D H Y Q Q N T P I G D A206K (dimerization blocker) GGA CCG GTT CTT CTT CCT GAC AAC CAT TAC TTA AGC ACG CAA TCT AAG CTG TCA AAA GAC CCT AAC GAA AAG CGC GAT CAC ATG GTT CTG TTA GAG TTT CCT GGC CAA GAA GAA GGA CTG TTG GTA ATG AAT TCG TGC GTT AGA TTC GAC AGT TTT CTG GGA TTG CTT TTC GCG CTA GTG TAC CAA GAC AAT CTC AAA G P V L L P D N H Y L S T Q S K L S K D P N E K R D H M V L L E F PvuII BamHI GTC ACA GCT GCG GGC ATT ACA CTT GGC ATG GAC GAA CTT TAT AAG TAAggatcc CAG TGT CGA CGC CCG TAA TGT GAA CCG TAC CTG CTT GAA ATA TTC ATTcctagg V T A A G I T L G M D E L Y K Supplemental Figure 5. Codon-optimized cfp [cfp(bs)] The gene encoding ecfp (Clonetech) was resynthesized with codons optimized for B. subtilis (http://www.kazusa.or.jp/codon/) by DNA TwoPointO, Inc. (www.dnatwopointo.com/). An optimized RBS (Vellanoweth and Rabinowitz, 1992) and an amino acid substitution A206K that prevents dimerization (Zacharias et al., 2002) were included in the synthesis. The amino acid substitutions in GFP that shift excitation and emission spectra from green to cyan are indicated. The fluorescence intensity of this codon-optimized version of CFP was compared to Jelly Fish (Aequorea victoria) CFP(W7) (Lemon and Grossman, 2000) and ecfp (Clonetech). The B. subtilis codon-optimized CFP was ~3X brighter than the Jelly Fish version and more than 10-fold brighter than ecfp. The ecfp gene has been codon-optimized for mammals and contains several codons that are underrepresented in B. subtilis.
CFP + membranes ecfp (Clonetech) CFP(W7) (Jelly Fish) CFP (B. subtilis) 1200-1800 3600-4095 Supplemental Figure 6. Comparison of CFP fluorescence. Cells harboring fusions of three different cfp genes to the forespore-specific promoter PspoIIQ were induced to sporulate by resuspension. The first panel shows the localization of CFP (false-colored green) in the forespore cytoplasm. The membranes are labeled with TMA-DPH (false-colored red). Fluorescence intensity of the B. subtilis codon-optimized version of CFP (B. subtilis) was ~3X brighter than CFP containing Aequorea victoria (Jelly Fish) codons (Lemon & Grossman Mol. Cell 2000) and more than 10-fold brighter than ecfp. Sporulating cells were analyzed at the same time point. Exposure times were 200ms. The range of pixel intensity (arbitrary units) of CFP in the forespore is indicated. Scale bar, 1 µm.
Supplemental Table 1. Strains used in this study Strain Genotype Source BRD528 amye::p spoivf-gfp-spoivfa (spec) Rudner and Losick, 2002 BDR776 amye::p xyla-gfp-spoivfa (cat) This work BDR1101 spoiigb::erm, amye:p xyla-gfp-spoivfa (cat) This work BDR706 bofa::cat, amye::p spoivf-gfp-spoivfa (spec) This work BDR779 spoiiia::erm, bofa::cat, amye::p spoivf-gfp-spoivfa (spec) This work BDR718 spoiiia::erm, amye::p spoivf-gfp-spoivfa (spec) This work BTD569 spoiiiah (phleo), amye::p spoivf-gfp-spoivfa (spec) This work BTD75 spoiid::cat, amye::p spoivf-gfp-spoivfa (spec) This work BTD3 spoiid::cat, spoiip::kan, spoiim::tn917::erm, amye::p spoivf-gfp-spoivfa (spec) This work BTD561 spoiid::cat, spoiip::kan, spoiim::tn917::erm, spoiiiah (phleo), bofa::tet, amye::p spoivf-gfp-spoivfa (spec) This work BTD23 saca::p spoiiia-cfp(bs)-spoiiiah (phleo) This work BKM162 spoiiac::erm, amye::p spoiie-spoiir (neo), pelb::p spoivf-gfp-spoivfa (cat) This work BKM164 spoiiac::erm, amye::p spoiie-spoiir (neo), saca::p spoiiia-cfp(bs)-spoiiiah (phleo) This work BKM119 laca::p spoivf-yfp(jf)-spoivfa (erm) This work BTD147 spoiiq::spec, laca::p spoivf-yfp(jf)-spoivfa (erm) This work BTD149 spoiiq::spec, saca::p spoiiia-cfp(bs)-spoiiiah (phleo) This work BTD505 spoiiq::spec, saca::p spoivf-yfp(jf)-spoivfa (phleo) This work BTD507 spoiiq::spec, spoiiia::erm, saca::p spoivf-yfp(jf)-spoivfa (phleo) This work BTD511 spoiiq::spec, spoiiia::erm, bofa::tet, saca::p spoivf-yfp(jf)-spoivfa (phleo) This work BTD231 spoiiq::spec, sac::p spoiiq-cfp(bs)-spoiiq (tet) This work BTD277 spoiiq::spec, spoivf::cat, sac::p spoiiq-cfp(bs)-spoiiq (tet) This work Bs: Bacillus subtilis JF: Jelly Fish
Supplemental Table 2. Plasmids used in this study plasmid Description Source or Reference pax01 laca ectopic integration vector Hartl B. et al., 2001 por277 amye::pxyla (cat) Resnekov O. et al., 1996 prm58 saca (kan) ectopic integration vector Middleton R. and Hofmeister A., 2004 pnc15 saca (phleo) ectopic integration vector N. Campo and DZR, unpublished pnc17 saca (tet) ectopic integration vector N. Campo and DZR, unpublished pdr77 amye::pspoivf (spec) Rudner and Losick, 2002 pdr95 amye::pspoiid-gfp-(27)bofa (spec) Rudner and Losick, 2002 pdr104 amye::pspoivf-gfp-spoivfa (spec) Rudner and Losick, 2002 pdr124 amye::pxyla-gfp-spoivfa (cat) This work pdr183 laca (erm) ectopic integration vector DZR, unpublished pdt7 saca::pspoiiia (phleo) This work pdt9 saca::pspoiiia-cfp(bs)-spoiiiah (phleo) This work pdt28 amye::pspoiiq-cfp(bs) (cat) This work pdt29 saca::pspoiiq-cfp(bs) (tet) This work pdt34 amye::pspoiiq-cfp(bs)-spoiiq (cat) This work pdt36 saca::pspoiiq-cfp(bs)-spoiiq (tet) This work pkm1 amye::pspoiiq (spec) This work pkm8 amye::pspoiiq-cfp(bs) (spec) This work pkm20 pelb (cat) ectopic integration vector KM and DZR, unpublished pkm23 pelb::pspoivf-gfp-spoivfa (cat) This work pkm26 amye::pspoivf-yfp(jf)-spoivfa (spec) This work pkm30 laca::pspoivf-yfp(jf)-spoivfa (erm) This work pkm32 saca::pspoivf-yfp(jf)-spoivfa (phleo) This work pet24b vector for C-terminal His-tagged protein expression in E. coli Invitrogen pgex-6p-2 vector for N-terminal GST-tagged protein expression in E. coli Amersham pdr171 GST-SpoIVFA (extracytoplasmic domain) This work pdt58 SpoIIQ (extracytoplasmic domain) This work pdt60 GST-SpoIIIAH (extracytoplasmic domain) This work Bs: Bacillus subtilis JF: Jelly Fish
Supplemental Table 3. Oligonucleotides used in this study primer odr107 odr108 odr202 odr203 odr234 odr235 odr348 odr349 otd1 otd2 otd4 otd5 otd10 otd11 otd29 otd30 otd50 otd51 sequence ggcaagcttacataaggaggaactactatgagtaaaggagaagaac cggctcgagtttgtatagttcatccatgc gccggatccaaaacaaacattggacccgtcag cggctcgagttattcaaatgaaatcacctgaatcg gccgaattccatgcttcgtcaatgtatatgctg cggaagcttagcaacattctgaacacttttctg cgcggatcctcgccggaaagcaaaaacgcc cggctcgagttatttagagggttcaaatgtgac gccgaattctgacggcagcaattgtcatgc gccggatccatactcgagtctaagcttggcttctttaaaatgtatgatgtg gcgctcgagcttataaagttcgtccatgcc gttgctaagcttacataaggagg ccgctcgagatgcttaaaaaacaaaccgtttgg cgcggatccttatttagagggttcaaatgtgac gcgctcgagatgagagaggaagaaaagaaaact gccggatccttaagactgttcagtgtcttctgt gccgctagctatcaatcagtatcaaatgatgag cggctcgagttaagactgttcagtgtcttctg Restriction endonuclease sites are in capital letters.