Time-course responses of ileal and fecal microbiota and metabolite profiles to. antibiotics in cannulated pigs

Applied Microbiology and Biotechnology Time-course responses of ileal and fecal microbiota and metabolite profiles to antibiotics in cannulated pigs Kan Gao 1, Yu Pi 1, Yu Peng, Chun-Long Mu, Wei-Yun Zhu * Laboratory of Gastrointestinal Microbiology, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing, Jiangsu 210095, P. R. China 1 First Author: Kan Gao Email Address: kevingogh911@hotmail.com Yu Pi Email Address: 2015205024@njau.edu.cn These authors contributed equally to this work. *Corresponding Author: Professor: Weiyun Zhu Telephone/Max: 86-25-84395523 Email Address: zhuweiyun@njau.edu.cn

Fig. S1. Sample collection timeline during the experiment.

Fig. S2. The average daily feed intake (A) and daily body weight gain (B) of piglets during the entire experiment.

Fig. S3. Summary of rarefaction results of microbiota in ileal digesta (A) and feces (B) based on operational taxonomic unit (OTUs) (3% divergence).

Fig. S4. The co-occurrence analysis of some important commensal genera in the ileal digesta and in the feces. The size of each dot was in accordance with its relative abundance. Blue line means significantly positive correlation (P <0.05, coefficient r >0.8).

Table S1. Dietary composition and nutrient levels (air dry basis). Items Composition, % Corn 67.70 Soybean meal 20.00 Fish meal 1.00 Limestone 0.72 Calcium hydrophosphate 1.10 Soy protein concentrate 2.00 Soybean oil 2.00 Salt 0.30 Choline chloride 0.10 Fine rice bran 2.32 L-Lys, 98.5% 0.54 DL-Met, 99% 0.23 L-Thr, 98.5% 0.21 L-Trp, 98% 0.05 L-Val, 98.5% 0.10 L-Ile, 99% 0.06 L-Leu, 99% 0.13 L-Phe, 99% 0.09 L-His, 99% 0.07 Chromium oxide 0.30 Premix a 1.00 Nutrient levels, % Net energy b, kcal/kg 2370.20 CP 17.42 EE 4.81 ADF 4.60 NDF 14.20 Ash 4.83 Ca 0.63 P 0.53 AA composition, % (DM basis) TLys 1.25 TMet 0.49 TThr 0.82 TTrp 0.24 TVal 0.89 TIle 0.71 TLeu 1.58 TPhe 0.92 THis 0.49 TArg 1.12 TTyr 0.58

TCys 0.26 Met+Cys 0.74 a Supplied the following per kg of diet: 8,000 IU, vitamin A; 2400 IU, vitamin D3; 20 mg, vitamin E; 15 mg, pantothenic acid; 5 mg, vitamin B6; 0.3 mg, biotin; 3 mg, folic acid; 0.03 mg, vitamin B12; 40 mg, ascorbic acid; 120 mg, Fe; 25 mg, Cu; 20 mg, Mn; 150 mg, Zn; 0.5 mg, I; 0.30 mg, Se. b Values for net energy were calculated, the contents of ether extract, crude protein, acid-detergent fibre, neutral-detergent fiber, ash, Ca, and P were analyzed. DM, dry matter; T, Total; AA, amino acid.

Table S2. List of primers used in this study. qpcr bacterial group Forward primer (5'-3') Reverse primer (5'-3') Reference Annealing temp.( C) Total bacteria GTGSTGCAYGGYYGTCGTCA ACGTCRTCCMCNCCTTCCTC [1] 60 Firmicutes GGAGYATGTGGTTTAATTCGAAGCA AGCTGACGACAACCATGCAC [2] 60 Bifidobacterium TCGCGTCYGGTGTGAAAG GGTGTTCTTCCCGATATCTACA [3] 60 Escherichia coli CATGCCGCGTGTATGAAGAA CGGGTAACGTCAATGAGCAAA [4] 60 Lactobacillus AGCAGTAGGGAATCTTCCA ATTCCACCGCTACACATG [5] 60 Ruminococcus GAAAGCGTGGGGAGCAAACAGG GACGACAACCATGCACCACCTG [6] 60 Roseburia GCGGTRCGGCAAGTCTGA CCTCCGACACTCTAGTMCGAC [7] 60 [1] Suzuki MT, Taylor LT, DeLong EF. Quantitative analysis of small-subunit rrna genes in mixed microbial populations via 5'-nuclease assays[j]. Appl Environ Microbiol, 2000, 66: 4605-4614. [2] Guo X, Xia X, Tang R, Zhou J, Zhao H, Wang K. Development of a real-time PCR method for Firmicutes and Bacteroidetes in faeces and its application to quantify intestinal population of obese and lean pigs[j]. Lett Appl Microbiol, 2008, 47: 367-373. [3] Walker AW, Ince J, Duncan SH. Dominant and diet-responsive groups of bacteria within the human colonic microbiota[j]. ISME J, 2011, 5: 220-230. [4] Huijsdens XW, Linskens RK, Mak M, Meuwissen SG, Vandenbroucke-Grauls CM, Savelkoul PH. Quantification of bacteria adherent to gastrointestinal mucosa by real-time PCR[J]. J Clin Microbiol, 2002, 40: 4423-4427. [5] Lan Y, Xun S, Tamminga S, et al. Real-time PCR detection of lactic acid bacteria in cecal contents of eimeria tenella-lnfected broilers fed soybean oligosaccharides and soluble soybean polysaccharides.[j]. Poultry Science, 2004, 83(10):1696-702. [6] Verma R, Verma A K, Ahuja V, et al. Real-time analysis of mucosal flora in patients with inflammatory bowel disease in India.[J]. Journal of Clinical Microbiology, 2010, 48(11):4279-82. [7] Walker A W, Duncan S H, Leitch E C M W, et al. ph and peptide supply can radically alter bacterial populations and short-chain fatty acid ratios within microbial communities from the human colon[j]. Applied and Environmental Microbiology, 2005, 71(7): 3692-3700.

Table S3. α diversity analysis of the time course responses of ileal and fecal microbiota toward the antibiotics. Items 1 day -4 day 2 day 7 day 13 P value 2 Control Antibiotics Control Antibiotics Control Antibiotics Control Antibiotics day -4 day 2 day 7 day 13 Ileal digesta Coverage 99.96 99.96 99.95 99.95 99.94 99.95 99.94 99.94 0.589 0.818 0.394 0.699 Ace 3 92.41 79.71 84.54 90.65 113.40 80.68 111.52 119.90 0.589 0.589 0.132 0.589 Shannon 1.66 1.48 1.65 0.80 1.99 1.03 1.84 0.62 0.093 0.015 0.002 0.002 Shannoneven 0.45 0.41 0.40 0.20 0.43 0.27 0.41 0.16 0.180 0.093 0.002 0.002 Chao 91.50 79.50 70.88 52.50 95.12 72.90 105.25 106.99 0.548 0.030 0.009 0.476 Inverse Simpson 3.91 3.47 3.51 1.82 4.72 2.28 4.32 1.38 0.180 0.041 0.002 0.002 Feces Coverage 99.87 99.85 99.73 99.70 99.72 99.93 99.69 99.86 0.180 0.310 0.002 0.002 Ace 314.58 346.85 574.85 577.20 627.34 175.08 580.76 331.39 0.082 0.818 0.002 0.004 Shannon 3.44 3.35 4.22 4.13 4.42 2.83 4.35 3.22 0.699 0.937 0.002 0.190 Shannoneven 0.62 0.59 0.68 0.67 0.70 0.57 0.70 0.60 0.485 0.937 0.015 0.190 Chao 321.16 373.12 579.09 582.12 637.32 169.11 603.18 282.56 0.065 1.000 0.002 0.004 Inverse Simpson 14.92 12.82 26.73 24.32 31.36 9.65 44.15 13.43 0.589 0.937 0.004 0.003 1 Data was presented as medians, with 6 replicates per group. 2 Statistical difference between groups at each day was calculated by the Mann Whitney U test. A P value <0.05 was regarded as statistically significant. 3 Ace, abundance-based coverage estimator.

Bacteria 1 at genus level Table S4. Significantly changed ileal and fecal bacteria at genus level induced by the antibiotics. day -4 day 2 day 7 day 13 actual P value 2 adjusted P value 3 C A C A C A C A day -4 day 2 day 7 day 13 day -4 day 2 day 7 day 13 Ileal digesta Lactobacillus 96.28 93.67 87.86 27.73 75.12 55.70 73.91 4.91 0.818 0.003 0.041 0.015 1.000 0.009 0.050 0.021 Bifidobacterium 0.00 0.00 1.12 0.01 9.64 0.02 4.49 0.00 0.091 0.006 0.005 0.013 0.119 0.014 0.010 0.020 Clostridium 0.00 0.00 0.01 0.00 0.10 0.00 0.07 0.00 0.656 0.011 0.015 0.010 0.902 0.021 0.024 0.018 Megasphaera 0.00 0.00 1.08 0.00 3.94 0.00 2.43 0.00 0.521 0.022 0.012 0.018 0.818 0.034 0.022 0.022 Peptostreptococcus 0.06 0.05 0.10 0.00 0.27 0.00 0.32 0.00 0.172 <0.001 <0.001 0.002 0.631 0.005 0.002 0.006 Escherichia/Shigella 0.12 0.09 0.08 37.40 0.26 10.24 0.14 79.78 0.251 0.001 0.001 0.001 0.690 0.006 0.004 0.004 Enterococcus 0.03 0.02 0.06 0.19 0.02 0.24 0.03 0.33 0.100 0.037 0.001 0.002 0.171 0.045 0.004 0.006 Klebsiella 0.00 0.00 0.00 0.02 0.00 0.20 0.00 0.38 0.381 0.002 <0.001 <0.001 0.699 0.007 0.003 0.002 Proteus 0.00 0.00 0.00 0.01 0.00 0.01 0.00 0.03 0.381 0.030 0.025 0.003 0.699 0.041 0.035 0.006 Feces Lactobacillus 2.20 2.79 1.68 1.35 2.45 0.10 2.96 0.02 0.627 0.135 0.042 0.006 0.855 0.337 0.045 0.011 Bifidobacterium 0.00 0.00 0.01 0.01 0.92 0.02 0.51 0.00 0.259 0.163 0.003 <0.001 0.647 0.349 0.008 0.004 Blautia 0.13 0.19 0.09 0.09 1.23 0.22 0.67 0.26 0.112 0.248 0.016 0.009 0.462 0.465 0.020 0.014 Clostridium 0.02 0.04 0.25 0.32 0.58 0.00 0.51 0.00 0.124 0.279 <0.001 0.002 0.465 0.465 0.003 0.006 Coprococcus 0.08 0.09 0.51 0.44 1.06 0.00 1.50 0.08 0.757 0.103 0.001 0.001 0.873 0.200 0.004 0.004 Lachnospira 0.03 0.04 0.21 0.19 0.30 0.00 0.78 0.01 0.553 0.104 <0.001 0.022 0.829 0.121 0.002 0.025 Megasphaera 0.06 0.06 0.01 0.00 0.31 0.00 0.28 0.00 0.496 0.194 0.011 0.008 0.827 0.281 0.015 0.013 Roseburia 0.17 0.18 0.22 0.21 0.31 0.00 1.31 0.00 0.933 0.524 0.007 0.002 1.000 0.715 0.013 0.006 Ruminococcus 0.74 0.56 4.04 1.78 3.14 0.01 1.83 0.55 0.119 0.002 0.001 0.017 0.289 0.025 0.004 0.021

Escherichia/Shigella 0.71 0.65 0.02 0.02 0.20 3.86 0.03 4.58 0.399 0.645 0.022 0.001 0.749 0.806 0.025 0.004 Klebsiella 0.00 0.00 0.00 0.00 0.00 0.23 0.00 0.04 0.342 0.933 0.002 0.001 0.732 1.000 0.006 0.004 Sutterella 0.02 0.02 0.00 0.01 0.01 1.88 0.00 0.36 0.210 0.074 0.005 0.010 0.631 0.107 0.011 0.014 Bacteroides 0.38 0.40 0.16 0.14 0.13 13.96 0.04 4.87 0.684 0.421 0.009 0.003 0.855 0.631 0.014 0.006 Prevotella 19.56 25.95 4.56 6.01 4.73 48.20 4.22 47.63 0.251 0.741 0.009 0.023 0.386 0.855 0.014 0.025 1 Data was presented as medians, with 6 replicates per group. C, control group; A, antibiotic group. 2 Statistical difference between groups at each day was calculated by the Mann Whitney U test. 3 Actual P value was adjusted with false discovery rate correction. An adjusted P value <0.05 was regarded as statistically significant.

OTUs 1 Ileal Digesta OTU21 OTU257 OTU70 OTU108 Nearest neighboring bacteria Table S5. Significantly changed ileal and fecal bacteria at OTU level induced by the antibiotics. day -4 day 2 day 7 day 13 actual P value 2 adjusted P value 3 (similarity) C A C A C A C A day -4 day 2 day 7 day 13 day -4 day 2 day 7 day 13 Lactobacillus salivarius 0.03 0.02 2.37 0.00 0.28 0.00 0.10 0.00 0.109 0.006 0.003 0.003 0.132 0.010 0.006 0.006 Lactobacillus reuteri 8.63 7.38 2.35 0.01 5.34 0.00 1.43 0.00 0.643 0.002 0.014 0.014 0.818 0.006 0.020 0.018 Lactobacillus mucosae 4.63 5.45 2.69 0.11 5.17 0.11 3.98 0.01 0.929 0.002 0.005 0.003 1.000 0.006 0.009 0.006 Lactobacillus delbrueckii 15.67 12.61 31.86 0.15 20.09 0.04 16.83 0.05 0.399 0.002 0.001 0.001 0.699 0.006 0.004 0.004 OTU136 Megasphaera sp.(96%) 0.00 0.00 0.74 0.00 3.93 0.00 2.42 0.00 0.643 0.024 0.017 0.020 0.818 0.034 0.022 0.022 OTU126 Clostridiaceae sp.(96%) 0.28 0.13 0.30 0.00 15.75 0.00 2.90 0. 00 0.124 0.001 0.046 0.017 0.171 0.004 0.050 0.020 OTU135 OTU205 OTU161 Peptostreptococcus stomatis Mitsuokella multacida Bifidobacterium thermacidophilum 0.06 0.05 0.08 0.00 0.15 0.00 0.32 0.00 0.399 0.001 0.002 0.001 0.699 0.005 0.005 0.005 0.00 0.00 0.00 0.00 0.05 0.00 0.07 0.00 0.929 0.929 0.012 0.008 1.000 1.000 0.018 0.011 0.00 0.00 1.09 0.01 9.49 0.02 4.46 0.00 0.169 <0.001 0.007 0.002 0.485 0.002 0.012 0.005 OTU25 Escherichia coli 0.12 0.09 0.08 37.40 0.26 10.24 0.14 79.78 0.246 0.002 0.001 0.001 0.690 0.006 0.004 0.004 OTU238 OTU204 Enterococcus faecium Klebsiella pneumoniae 0.03 0.02 0.06 0.19 0.02 0.24 0.03 0.33 0.124 0.039 0.001 0.003 0.171 0.045 0.004 0.006 0.00 0.00 0.00 0.02 0.00 0.20 0.00 0.38 0.399 0.004 <0.001 <0.001 0.699 0.007 0.003 0.002

OTU151 Proteus mirabilis 0.00 0.00 0.00 0.01 0.00 0.01 0.00 0.03 0.399 0.032 0.030 0.003 0.699 0.041 0.035 0.006 Feces Lactobacillus delbrueckii OTU415 0.02 0.02 0.05 0.04 0.10 0.00 0.07 0.00 0.551 0.390 0.006 0.030 0.643 0.461 0.010 0.032 OTU30 Lactobacillus agilis 0. 00 0.00 0.01 0.01 0.05 0.00 0.03 0.00 0.941 0.472 0.001 0.003 1.000 0.564 0.004 0.007 OTU128 Lactobacillus amylovorus 1.90 1.89 0.79 0.50 2.19 0.03 2.18 0.01 0.765 0.079 0.005 0.014 0.873 0.109 0.009 0.020 OTU207 Clostridium sp. (96%) 0.00 0.00 0.05 0.02 0.11 0. 00 0.04 0.00 0.941 0.162 <0.001 <0.001 1.000 0.262 0.002 0.003 OTU706 Coprococcus catus 0.02 0.02 0.06 0.05 0.03 0.00 0.54 0.00 0.941 0.882 0.017 0.001 1.000 1.000 0.022 0.005 OTU107 0 OTU713 OTU107 9 Lachnospira pectinoschiza (98%) Ruminococcus gnavus Ruminococcus bromii 0.01 0.02 0.04 0.03 0.24 0.00 0.61 0.01 0.096 0.070 0.001 0.002 0.103 0.085 0.004 0.006 0.45 0.46 0.19 0.25 0.14 0.00 0.15 0.00 0.125 0.528 <0.001 0.021 0.211 0.748 0.002 0.024 0.05 0.05 2.26 0.06 0.45 0.00 0.43 0.00 0.586 <0.001 0.001 0.008 0.827 0.006 0.004 0.014 OTU802 Blautia producta 0.02 0.02 0.01 0.01 0.11 0.00 0.21 0.02 0.352 0.163 0.011 0.017 0.715 0.281 0.015 0.021 OTU991 Roseburia faecis 0.17 0.18 0.22 0.21 0.31 0.00 1.31 0.00 0.941 0.563 0.008 0.002 1.000 0.715 0.013 0.006 OTU592 Bifidobacterium thermacidophilum 0.00 0.00 0.01 0.01 0.92 0.02 0.51 0.00 0.390 0.223 0.004 0.001 0.647 0.349 0.008 0.004 OTU407 Escherichia coli 0.71 0.65 0.02 0.02 0.20 3.86 0.03 4.58 0.552 0.616 0.021 0.001 0.749 0.806 0.025 0.004 OTU118 6 OTU106 3 Sutterella stercoricanis Klebsiella pneumoniae 0.00 0.00 0.00 0.00 0.00 1.22 0.00 0.03 0.552 0.719 0.032 0.006 0.749 0.873 0.034 0.011 0.00 0.00 0.00 0.00 0.00 0.23 0.00 0.04 0.501 0.941 0.002 0.001 0.732 1.000 0.006 0.004 OTU826 Prevotella copri 0.98 1.00 0.21 0.19 0.15 9.82 0.49 5.66 0.256 0.440 0.026 0.010 0.317 0.528 0.029 0.016

OTU664 Bacteroides xylanisolvens 0.00 0.00 0.00 0.00 0.00 4.17 0.00 0.56 0.941 0.941 0.003 0.015 1.000 0.493 0.007 0.020 1 Data was presented as medians, with 6 replicates per group. C, control group; A, antibiotic group. 2 Statistical difference between groups at each day was calculated by the Mann Whitney U test. 3 Actual P value was adjusted with false discovery rate correction. An adjusted P value <0.05 was regarded as statistically significant.

Table S6. Time-course responses of key bacterial groups of pigs (n=8) toward the oral antibiotics. Items (log 10 ) 1 day -4 day 2 day 7 day 13 P value 2 SEM Control Antibiotics Control Antibiotics Control Antibiotics Control Antibiotics A T A T Ileal digesta Total bacteria 10.06 a 9.99 a 9.94 a 8.94 b 10.04 a 8.82 b 9.76 a 8.64 b 0.14 0.019 0.110 0.297 Firmicutes 9.43 a 9.52 a 9.13 a 7.83 b 9.28 a 8.04 b 8.99 a 7.60 b 0.18 0.008 0.018 0.079 Bifidobacterium 5.49 a 5.25 a 5.71 a 4.28 b 5.61 a 4.90 b 5.75 a 4.47 b 0.14 <0.001 0.096 0.100 Lactobacillus 8.24 a 8.26 a 8.46 a 7.50 b 8.35 a 5.59 b 8.32 a 7.40 b 0.22 <0.001 0.004 0.001 Escherichia coli 6.17 a 5.98 a 6.36 b 7.70 a 6.82 b 7.45 a 5.98 b 7.68 a 0.19 0.007 0.067 0.069 Feces Total bacteria 11.03 a 10.91 a 10.94 a 10.90 a 11.00 a 10.55 b 11.36 a 10.71 b 0.07 0.036 0.653 0.323 Firmicutes 9.39 a 9.39 a 9.75 a 9.56 a 9.66 a 8.72 b 9.06 a 8.11 b 0.13 0.016 0.015 0.166 Ruminococcus 7.04 a 7.20 a 7.69 a 6.82 b 7.33 a 5.90 b 7.81 a 6.19 b 0.17 0.007 0.338 0.493 Bifidobacterium 5.44 a 5.45 a 4.88 a 5.02 a 5.25 a 4.32 b 5.25 a 4.51 b 0.09 0.038 0.019 0.029 Roseburia 5.06 a 5.13 a 5.15 a 5.27 a 5.31 a 4.65 b 5.29 a 4.60 b 0.06 0.001 0.046 0.001 Lactobacillus 7.93 a 8.20 a 8.73 a 8.56 a 8.02 a 5.33 b 8.00 a 6.13 b 0.26 0.001 0.003 0.003 Escherichia coli 7.71 a 7.62 a 5.96 a 5.31 a 7.51 b 8.03 a 5.75 b 7.45 a 0.26 0.041 0.002 0.039 1 The data followed a normal distribution examined by the Kolmogorov Smirnov test, and presented as means with standard error of the mean (SEM). 2 The data were analyzed using repeated measures analysis with baseline data as covariates. The Student s t test was used to compare difference between groups at a given time point. A P value <0.05 was regarded as statistically significant. A, Antibiotics; T, Time. a, b Means at each day with different superscripts differ (P <0.05).

Table S7. Concentrations of metabolic profiles in ileal digesta and feces during the experiment. Items 1 day -4 day 2 day 7 day 13 P value 2 SEM Control Antibiotics Control Antibiotics Control Antibiotics Control Antibiotics A T A T SCFAs μmol/g Ileal Digesta Acetate 7.21 a 6.50 a 11.19 a 4.32 b 20.53 a 6.44 b 20.41 a 7.34 b 0.98 <0.001 <0.001 <0.001 Propionate 1.71 a 1.63 a 1.34 a 1.11 a 2.01 a 0.71 b 2.33 a 0.93 b 0.67 <0.001 0.191 0.010 Butyrate 0.46 a 0.38 a 0.31 a 0.37 a 1.17 a 0.36 b 0.90 a 0.42 b 0.05 <0.001 0.001 <0.001 Total SCFA 10.04 a 9.32 a 13.57 a 6.47 b 26.37 a 8.33 b 25.18 a 9.54 b 1.36 <0.001 0.012 0.014 Feces Acetate 23.42 a 27.30 a 78.79 a 76.66 a 80.67 a 44.09 b 55.41 a 60.59 a 3.92 0.035 <0.001 0.017 Propionate 11.78 a 13.69 a 26.99 a 20.72 a 20.95 a 21.76 a 24.11 a 28.44 a 1.32 0.853 0.001 0.294 Butyrate 4.24 a 3.76 a 15.83 a 7.49 b 12.35 a 4.42 b 12.39 a 8.14 b 0.83 <0.001 <0.001 0.021 Total SCFA 45.26 a 48.11 a 135.31 a 87.15 b 125.60 a 77.93 b 99.24 a 104.53 a 5.99 0.005 0.001 0.152 Amines μmol/g Ileal Digesta Putrescine 1.99 a 1.60 a 2.25 b 3.41 a 2.72 a 2.70 a 1.23 a 1.25 a 0.15 0.434 <0.001 0.217 Cadaverine 4.71 a 5.13 a 4.20 b 40.96 a 3.15 b 15.03 a 4.71 b 28.74 a 2.40 <0.001 <0.001 <0.001 Spermidine 2.15 a 2.79 a 1.48 b 3.16 a 0.47 a 0.42 a 0.39 a 0.39 a 0.19 0.020 <0.001 0.010 Total amines 9.96 a 10.46 a 8.12 b 47.46 a 6.48 b 18.62 a 6.54 b 31.41 a 2.58 <0.001 <0.001 <0.001 Feces Putrescine 3.18 a 3.95 a 4.72 a 3.84 a 3.66 b 39.77 a 2.77 b 47.95 a 3.21 <0.001 0.019 <0.001 Cadaverine 8.00 a 6.67 a 5.34 a 5.94 a 2.84 b 72.20 a 9.30 b 48.75 a 4.66 <0.001 0.217 0.006

Spermidine 4.12 a 4.65 a 6.41 a 6.99 a 2.99 b 8.12 a 2.96 b 10.16 a 0.54 <0.001 0.184 0.003 Total amines 15.14 a 17.54 a 18.41 a 15.76 a 12.60 b 123.68 a 17.30 b 122.10 a 8.70 <0.001 <0.001 <0.001 Lactate μmol/g Ileal lactate 33.75 a 33.12 a 33.27 a 24.59 b 37.50 a 3.50 b 24.36 a 2.59 b 2.02 <0.001 <0.001 <0.001 Fecal lactate 0.40 a 0.32 a 0.57 a 0.44 a 0.57 b 3.68 a 1.28 b 3.59 a 0.27 <0.001 <0.001 <0.001 Indole μg/g Fecal indole 4.36 a 4.17 a 8.61 a 7.09 a 6.97 b 15.72 a 7.42 b 20.43 a 1.23 0.004 0.018 0.044 1 Data followed a normal distribution examined by the Kolmogorov Smirnov test, and presented as means with SEM (n=8). 2 The data were analyzed using repeated measures analysis with baseline data as covariates. The Student s t test was applied to compare difference between groups at a given time point. A P value <0.05 was regarded as statistically significant. A, Antibiotics; T, Time. a, b Means at each day with different superscripts differ (P <0.05).