Apoptosis in Mammalian Cells 7.16 2-10-05
Apoptosis is an important factor in many human diseases Cancer malignant cells evade death by suppressing apoptosis (too little apoptosis) Stroke damaged neurons commit apoptosis, leading to more extensive damage (too much apoptosis) Autoimmune disorders immune cells survive for too long, leading to over-reactive immune response (too little apoptosis)
The death receptor pathway In mammals, there is a family of death ligands that bind to receptors on the cell surface, sending a pro-apoptotic signal to the cell Y Y Y Y Die!
Death ligand family members FasL very important in the immune system TNF (Tumor necrosis factor) controls inflammatory responses TRAIL selectively kills tumor cells; currently in clinical trials as an anti-cancer agent
FasL FADD FADD Bid casp8 Bax Bax IAP IAP casp3 casp3 casp9 cyto c Smac Smac
Tools for observing apoptosis Immunofluorescence mircroscopy Flow cytometry Live cell microscopy
Principles of Fluorescence Two diagrams removed for copyright reasons.
Immunofluorescence can detect specific proteins in cells
Immunofluorescence can detect specific proteins in cells Fix with formaldehyde
Immunofluorescence can detect specific proteins in cells Fix with formaldehyde Permeablize with detergent
Immunofluorescence can detect specific proteins in cells Antibodies bind to specific proteins. We can generate antibodies to nearly any protein we re interested in. We can label antibodies with fluorescent molecules. Fluorescently labeled antibodies can reveal the location of specific proteins in the cell.
Detecting apoptosis with immunofluorescence microscopy DNA Cleaved cytokeratin Cleaved caspase-3 Blue: DNA Green: cleaved cytok Red: cleaved casp3
Determining the order of apoptotic events Blue: H33342 Green: cytochromec Red: cleaved casp3
Quantitating apoptosis using flow cytometry Cytokeratin cleavage Green fluorescence Healthy cells Late apoptotic cells Early apoptotic cells Red fluorescence Caspase 3 cleavage
Combining flow cytometry with RNAi +TNF Cytokeratin cleavage No RNAi Caspase 8 RNAi Bid RNAi Caspase 3 cleavage
Green Fluorescent Protein a genetically encoded fluorescent tag Diagram removed for copyright reasons.
The fluorescent protein family Jellyfish Aequoria victoria Reef coral Green fluorescent protein Red fluorescent protein Engineered mutations Blue fluorescent protein Cyan fluorescent protein Yellow fluorescent protein
GFP has been engineered to make blue and yellow variants; red fluorescent proteins have been isolated from other sea creatures Two photos removed for copyright reasons.
GFP can be spliced into any gene DNA sequence atgactgacagtccattaccggactttga atgttcagggatcccataattagtga Unfolded protein Folded protein atgactgacagtccattaccggacttatgttcagggatcccataattagtga
FRET a phenomenon that occurs when 2 fluorescent molecules are very close FRET! No FRET cfp yfp cfp yfp < 6 nm > 6 nm FRET: Forster Resonance Energy Transfer
A FRET-based caspase activity reporter FRET! cfp DEVD yfp cfp DEVD casp3 yfp Excitation with UV light. Energy transfer from CFP to YFP. Emission of yellow light. Cleavage of substrate by caspase-3. cfp DEVD yfp Excitation with UV light. Emission of cyan light.
Monitoring caspase activity over time in living cells 1.5 1.4 healthy cell dying cell FRET ratio 1.3 1.2 1.1 1 0.9 0 50 100 150
FRET reporters can be modified to detect different caspase activities cfp DEVD yfp Caspase-3 cfp yfp Caspase-8 IETD cfp LEHD yfp Caspase-9
Much of the apoptotic pathway is conserved Mammals Fas Death signals Flies Eiger Death signals FADD ciap FADD casp8 Bid Dredd Bax Bcl2 Debcl Buffy cytoc cytoc casp3 casp9 Smac Dcp Drice Dronc Rpr Grim Hid XIAP DIAP
But the importance of certain pathways changes Mammals Flies Fas Eiger FADD ciap FADD casp8 Bid Dredd Bax Debcl Buffy Bcl2 cytoc cytoc Rpr Grim Hid casp3 casp9 Smac Dcp Drice Dronc XIAP DIAP
Recent development XIAP is important in human cancer cells See Li, L. et al. A Small Molecule Smac Mimic Potentiates TRAIL- and TNF-α Mediated Cell Death. Science 305 no. 5689 (2004 Sep 3): 1411-3.
Even within a species, differences are observed Fas Human Cancer cell 1 Fas Human Cancer cell 2 FADD ciap FADD ciap casp8 Bid casp8 Bid Bax Bcl2 Bax Bcl2 cytoc cytoc casp3 casp9 Smac casp3 casp9 Smac XIAP XIAP
A computational model of caspase activation
Studying apoptosis to learn how cells make decisions Internal state Death signals Survival signals Diagram removed for copyright reasons. Die?
Quantitating apoptosis using flow cytometry Effector Caspase Activity (cytokeratin cleavage) Untreated TNF treated TNF treated, Bax -/- Initiator Caspase Activity (caspase 3 cleavage)
The order of apoptotic events varies between human cancer cells Hct-116 HeLa Blue: H33342 Green: cleaved cytok Red: cleaved casp3