Biology 2 Macroevolution & Systematics 1 Biology 2 Lecture Material For Macroevolution & Systematics
Biology 2 Macroevolution & Systematics 2 Microevolution: Biological Species: Two Patterns of Evolutionary Change Allopatric Speciation: Evidence of: Favorable Conditions:
Biology 2 Macroevolution & Systematics 3 Sympatric Speciation: Autopolyploidy: Allopolyploidy: Hybrid Zones: Reinforcement: Fusion: Stability: Adaptive Radiation: The emergence of numerous species from a common ancestor introduced into an environment, presenting a diversity of new opportunities and problems
Biology 2 Macroevolution & Systematics 4 Macroevolution: Gradualism: Three Types: : new traits become established in a population by increasing their frequency from a small fraction of the population to the majority : New traits, even those that are strikingly different from ancestral ones are produced in small increments : On a geological time scale, there are intermediate forms connecting the phenotypes of ancestors and descendents Punctuated Equilibrium:
Biology 2 Macroevolution & Systematics 5 Macroevolution through many Speciation Events Evolutionary Novelties Evolution of Genes that control development Changes in Spatial Pattern Changes in Rate and Timing Origin of Evolutionary Novelty Exaptation (preadaptation): Evolution of Genes that control development: (Julian Huxley) 1. Gradual evolution can be explained by small genetic changes that produce variation which is acted upon by natural selection 2. The evolution at higher taxonomic levels and of greater magnitude can be explained by long periods of time Evo-devo
Biology 2 Macroevolution & Systematics 6 Changes in Spatial Patterns: Homeotic Genes: Hox Genes: Homeobox:
Biology 2 Macroevolution & Systematics 7 Changes in Rate and Timing: Allometric Growth: Heterochrony: Paedeomorphosis: Paedeogenesis:
Biology 2 Macroevolution & Systematics 8 Evolutionary Trends: Species Selection (Steven Stanley): Size: Toe Reduction: Tooth shape/size: Fossil Records Sedimentary Rocks: Hard Parts: Minerals: Organic Material Casts: Trace Fossils: Entire Organisms:
Biology 2 Macroevolution & Systematics 9 Fossil Record Limitations Absolute Dating HALF-LIFE Use the concept of half-life to answer the following questions about the ages of fossils. 1. The half-life of carbon-14 is 5730 years. A fossil that is 22,920 years old would have what amount of the normal portion of C-14 to C-12? 2. The half-life of potassium-40 is 1.3 billion years. If a rock specimen contained 12 milligrams of potassium- 40 when it was formed and now contained 3 milligrams of potassium-40, How old is the rock? Relative Dating
Biology 2 Macroevolution & Systematics 10 ERA PERIOD EPOCH AGE EVENTS Now 0.01 0.01-2.6 2.6 5.3 5.3-23 23 33.9 33.9-55.8 55.8-65.5 65.5 145.5 145.5-199.6 199.6-251 251 299 299-359 359 416 416 444 444 488 488 542 635-542 2.1 2.7 3.5 3.8 4.6
Biology 2 Macroevolution & Systematics 11 Plate Tectonics and Continental Drift Plate Tectonics: Continental Drift: Pangaea: Laurasia: Gondwana: Mass Extinctions:
Biology 2 Macroevolution & Systematics 12 SYSTEMATICS: Comparing the genes or genomes of two species is the most direct measure of inheritance from shared ancestors. Comparisons can be made by using three methods: DNA-DNA hybridization, restriction maps, and DNA sequencing. Use the information to determine where species A through F belong in the phylogenetic tree. The information below is comparing the number of differences between an amino acid sequence from a blood protein found in rodents. (Assumption: The larger the number, the longer they have been separated from their common ancestor) A B C D E F A 0 10 4 9 14 10 B 10 0 11 5 16 2 C 4 11 0 10 15 10 D 9 5 10 0 15 6 E 14 16 15 15 0 16 F 10 2 10 6 16 0
Biology 2 Macroevolution & Systematics 13 PHYLOGENETIC GROUPINGS: Monophyletic: Paraphyletic: Polyphyletic: Use the diagram below to identify whether the grouping is monophyletic, paraphyletic or polyphyletic. A B C D E F G H 1. A and B 2. A, B and C 3. D, E, and F 4. E, F, G and H 5. F, G, and H 6. E, F, and G
Biology 2 Macroevolution & Systematics 14 SIMILARITIES Homology: Analogy: Molecular Homeoplasy: ONTOGENY RECAPITULATES PHYLOGENY (Ernst Haekel)
Biology 2 Macroevolution & Systematics 15 SYSTEMATICS: Classical Evolutionary (Linnaean) Systematics: Cladistics: Assumptions: Synapomorphies: Shared ancestral characters Plesiomorphies: Primitive characters Apomorphies: Shared derived characters
Biology 2 Macroevolution & Systematics 16 Phylograms: Ultrametric Trees: Parsimony: Maximum Likelyhood:
Biology 2 Macroevolution & Systematics 17
Biology 2 Macroevolution & Systematics 18 Cladistic taxonomy and classical evolutionary taxonomy are different methods of interpreting phylogenetic data and classifying organisms. Read each statement below and check whether it relates to the cladistic approach, the classical approach, or both. Cladistic Classical 1. Method of classifying organisms and reconstructing phylogeny 2. Concerned only with the order of branching lineages 3. Produces cladograms 4. Concerned with branching and degree of divergence 5. Differentiates between primitive and derived characters 6. Puts lizards and crocodiles in one class, birds in another 7. Becoming more popular with researchers 8. Says birds are closer to crocodiles than to other reptiles 9. Uses anatomy and molecular biology to determine relationship 10. Places humans in the same family as some other apes 11. Places humans in their own family, separate from apes 12. The approach used 15 years ago 13. Considered to be more objective approach 14. Involves subjective judgements about divergence Place the new species into their proper position on the classical evolutionary phylogenetic tree You are the first zoologist to penetrate the Timbasi Swamp and explore the Okongo Forest. You identify 7 new species of guenon monkeys. You collect blood sample and compare the new species blood proteins and facial markings to decide where on the current phylogenetic tree these new species belong. Match each of the new monkey species with one of the letters inserted into the revised phylogenetic tree. 1. Ann s: More closely related to Diana than any other species 2. Flat-topped: As close to Mona as Mona is to Campbell s 3. Gladstone s: Closer to redtail and moustached than any other new species 4. Bearded: Related to Diana but not as closely as Ann s 5. Liebaert s: A ground-dweller not closely related to any of the others 6. Perkins s: Related to Mona and Campbell s but it branched off earlier 7. Striped: Equally related to blue and redtail, but closer to ancestor
Biology 2 Macroevolution & Systematics 19 Cladogram Place the taxa (outgroup, A, B, C, and D) on the cladogram based on the presence or absence of the characters 1-4 as shown in this table. Indicate before each branch point, which shared derived character evolved in the ancestor of the clade. Primate Phylogeny Examine the three primate phylogenies shown. Do the three phylogenies show the same relationships and the same order of branching? Do they give different impressions of whether there was a goal of primate evolution or what the highest primate is? Explain.
Biology 2 Macroevolution & Systematics 20 Cladistic Analysis of a DNA Sequence The study group below is an example of three species of chameleons, two from Madagascar and one for Equatorial Guinea. The outgroup is a lizard that is a distant relative of chameleons. The question is are the two Madagascan species (genus: Brookesia) really more closely related to each other over one being more closely related to the Equatorial Guinea species (Chamaeleo). The information below is from a piece of mitochondrial DNA sequence which encodes an amino acid of a protein called NADH dehydrogenase subuit 2. Uromastyx B. theili B. brygooi C. feae AAACCTTAAAAGACACCACAACCATATGAACAACAACACCAACAATCAGCACACTAC AAACACTACAAAATATAACAACTGCATGAACAACATCAACCACAGCAAACATTTTAC AAACACTACAAGACATAACAACAGCATGAACTACTTCAACAACAGCAAATATTACAC AAACCCTACGAGACGCAACAACAATATGATCCACTTCCCCCACAACAAACACAATTT Possible Cladograms B. theili 1. B. brygooi Number of changes C. feae 2. B. brygooi C. feae Number of changes B. theili 3. B. theili C. feae Number of changes B. brygooi
Biology 2 Macroevolution & Systematics 21 ERA PERIOD EPOCH AGE EVENTS Now 0.01 0.01-2.6 2.6 5.3 5.3-23 23 33.9 33.9-55.8 55.8-65.5 65.5 145.5 145.5-199.6 199.6-251 251 299 299-359 359 416 416 444 444 488 488 542 542-635 2.1 2.7 3.5 3.8 4.6
Biology 2 Macroevolution & Systematics 22 ERA PERIOD EPOCH AGE EVENTS Now 0.01 0.01-2.6 2.6 5.3 5.3-23 23 33.9 33.9-55.8 55.8-65.5 65.5 145.5 145.5-199.6 199.6-251 251 299 299-359 359 416 416 444 444 488 488 542 542-635 2.1 2.7 3.5 3.8 4.6
Biology 2 Macroevolution & Systematics 23 ERA PERIOD EPOCH AGE EVENTS Now 0.01 0.01-2.6 2.6 5.3 5.3 23 23 33.9 33.9-55.8 55.8-65.5 65.5 145.5 145.5-199.6 199.6-251 251 299 299-359 359 416 416 444 444 488 488 542 542-635 2.1 2.7 3.5 3.8 4.6