Evidence of Evolution
Biogeography
The Age of Earth and Fossils Ancient artiodactyl Modern whale
Ancestors of Whales Ambulocetus could both swim in shallow water and walk on land. Rodhocetus probably spent most of its time in water. Ancient artiodactyl Pakicetus Ambulocetus Rodhocetus
Evolution of Whales Modern whales have ancient structures Odontocetes Basilosaurus only swims. Mysticetes Modern whales Dorudon Basilosaurus
Gaps in the Fossil Record
Homology What does the word Homologous mean? Homology is the study of similarity between organisms There are three major branches of homology: Anatomical Homology Embryological Homology Molecular Homology
Homologous Structures Frog Alligator Chicken Horse Ancient lobed-finned fish
Vestigial Structures
Evidence of Evolution Analogous Structures: structures similar in function, but not inherited from a common ancestor. Same function, different structure
Development
Embryological Homology The diagram below shows embryos of five different species: pig, chicken, fish, turtle, and human. Can you tell which is which?
Figured it out yet?
How about now?
Did you guess correctly?
Embryological Homology Did you know that when you were inside your mother s womb, for a while you looked almost exactly like a fish? Vertebrate embryos all share a similar pattern of development, suggesting that they may share common ancestry
Chicken 2 ½ days Human 31 days Pig 21 days
Genetics and Molecular Biology
Molecular Homology All living things contain DNA and RNA. Changes in Proteins, DNA and RNA can be traced from ancestors to their descendents. The fewer Amino Acid differences between organisms, the closer their inferred evolutionary relationship. Hemoglobin and Cytochrome C are a group of proteins that are commonly found in many different organisms
Our ancient DNA GTGCCAGCAGCCGCGGTAATTCCAGCTCCAAT AGCGTATATTAAAGTTGCTGCAGTTAAAAAG Codes for an RNA enzyme that plays a crucial role in protein synthesis Present in EVERY cell in the world (and some viruses ) Evolved in the common ancestor of ALL life
Our modern DNA There are around 100 mutations in your genome that are NOT present in your mother or father
Testing Natural Selection Platyspiza strips bark with a beak designed to grip and hold tightly, like a pair of pliers. Pinaroloxias probes for insects, fruit, and nectar with a curved beak, like needle-nose pliers. Certhidea picks insects off surfaces with a straight, narrow beak, like needle-nose pliers. Geospiza breaks large, thick seeds with a beak that is thick, strong, and sharp, like heavy-duty wire cutters.
Bird Survival Based on Beak Size
Genes and Variation
Genotype and Phenotype Genotype: particular combination of alleles Phenotype: physical, physiological, and behavioral characteristics
Genetics and Evolutionary Theory Natural selection acts on an organism s characteristics, not on its alleles.
Allele Frequency Number of times an allele occurs in a gene pool, as a percentage of the total occurrence of all alleles In 50 alleles: In 100 alleles: 20 alleles are B (black) 40 are B (black) 30 alleles are b (brown) 60 are b (brown)
Alleles in a Population Evolution involves any change in the frequency of alleles in a population over time. In a population of 25 mice, how many mice are in each genotype? 12 9 4
Genetic Variation Three evolutionary mechanisms that generate genetic variation: mutation genetic recombination lateral gene transfer Possible chromosome combinations is 2 n. In humans, n = 23. 2 23 = 8,388,608
Single-Gene Traits Traits controlled by only one gene Without bands With bands
Single-Gene Traits Phenotypic ratios are determined by the frequency of alleles and by whether the alleles are dominant or recessive. 77% 23%
Polygenic Traits Traits controlled by two or more genes
Polygenic Traits Height in humans is an example of a polygenic trait.
Evolution as Genetic Change in Populations
How Natural Selection Works An evolutionary adaptation is any genetically controlled trait that increases an individual s fitness.
Natural Selection on Single-Gene Traits Natural selection on single-gene traits can produce changes in allele frequencies that may be reflected by simple changes in phenotype frequencies.
Natural Selection on Polygenic Traits Natural selection on polygenic traits can produce three types of selection: directional selection stabilizing selection disruptive selection
Directional Selection Individuals at one end of the curve have higher fitness than individuals in the middle or at the other end.
Stabilizing Selection Individuals near the center of the curve have higher fitness than individuals at either end.
Disruptive Selection Phenotypes at the upper and lower ends of the curve have higher fitness than individuals near the middle.
Genetic Drift Genetic drift is a random change in allele frequency. Genetic bottlenecks The founder effect Founding populations Descendants
Evolution Versus Genetic Equilibrium If a population is not evolving, the population is in genetic equilibrium. Sexual reproduction Hardy Weinberg principle
Hardy Weinberg Principle and In words, this is stated: (frequency of AA) + (frequency of Aa) + (frequency of aa) = 100% and (frequency of A) + (frequency of a) = 100% If p = 0.40 and q = 0.60: Probability of genotype Aa: AA: aa: 16% 36% 48%
Hardy Weinberg Principle To maintain genetic equilibrium there must be: Random mating Large population size No immigration or emigration No mutations No natural selection The H-W Principle predicts that: If any of these conditions occur it can disturb genetic equilibrium, causing evolution.