Gene during Drosophila Oogenesis

MOLECULAR AND CELLULAR BIOLOGY, Sept. 1993, p. 5898-5906 0270-7306/93/095898-09$02.00/0 Copyright 1993, American Society for Microbiology Vol. 13, No. 9 Elements Controlling Follicular Expression of the s36 Chorion Gene during Drosophila Oogenesis PETER P. TOLIAS,1,2* MARY KONSOLAKI,3'4t MARC S. HALFON,3 NIKOLAOS D. STROUMBAKIS 1,2 AND FOTIS C. KAFATOS3'4 Public Health Research Institute, 455 First Avenue, New York, New York 100161; Department of Biology, New York University, New York, New York 100032; Department of Cellular and Developmental Biology, Harvard University, Cambridge, Massachusetts 021383; and Institute of Molecular Biology and Biotechnology, Herakdion 71110, and Department of Biology, University of Crete, Heraklion, Crete, Greece Received 12 March 1993/Returned for modification 17 May 1993/Accepted 8 June 1993 An 84-bp proximal regulatory region (PRR) of the DrosophUa melanogaster s36 chorion gene is sufficient for directing proper temporal and spatial expression of a reporter gene in three domains of the follicle: anterior, posterior, and main body. Here we show that the fidelity of PRR-directed s36 expression is dependent on the proper dorsal-ventral differentiation of the foilicular epithelium, which requires the Drosophila epidermal growth factor receptor homolog. Transgenic analysis of site-directed mutants of the PRR suggests that s36 expression is regulated by the concerted action of multiple positive activators. Several cis-acting transcriptional elements have been identified: some appear to function in a quantitative manner, while others either are essential or appear to regulate expression in particular spatial domains. The approximate locations of these regulatory elements have been defined; some map within sequences that are strongly conserved in widely divergent dipteran species. In fact, the PRR analog of the medfly Ceratitis capitata Ccs36 gene directs expression in a manner similar to the D. melanogaster s36 PRR. We propose a model for transcriptional regulation of s36 based on the prechoriogenic polarization of the follicular epithelium that surrounds the developing egg chamber. Spatially restricted gene expression is an important feature of development in higher eukaryotes. The expression patterns of genes in the developing Drosophila embryo have been studied extensively (reviewed in references 1, 12, and 45); less well understood is spatial control during postembryonic development. A useful system for studying later developmental gene expression are the Drosophila chorion (eggshell) genes, which are regulated in distinct temporal and spatial patterns, exclusively in the somatic follicular epithelium that surrounds each developing oocyte (for reviews, see references 13 and 27). Several mutations that cause aberrant chorion formation also lead to incorrect pattern formation in the embryo [e.g., fs(1)k10, (51-53), dicephalic (7, 20), and torpedo and gurken (36)]. Many of these chorion mutations are germ line dependent, suggesting that the pattern of chorion gene expression may depend on signals from the oocyte to the somatic follicular epithelium, where the chorion genes are actually expressed (4, 28, 36). Conversely, some somatic mutations affect both chorion and embryo (36), suggesting that regional specialization of the follicular epithelium may influence patterning in the oocyte and thus in the developing embryo. Therefore, elucidation of chorion gene regulatory mechanisms could contribute to our understanding of both embryonic and postembryonic developmental patterning. During the 5 to 6 h between stages 10b and 14 of late oogenesis (14), the approximately 1,000 cells of the follicular epithelium synthesize approximately 20 chorion proteins that are secreted and cross-linked around the surface of the * Corresponding author. t Present address: Department of Molecular Biology, Princeton University, Princeton, NJ 08540. 5898 developing oocyte (21, 22, 29, 50). The temporal and spatial regulation of chorion genes is reflected in morphological specializations of the eggshell along the anterior-posterior and dorsal-ventral axes (21, 22) and has been documented by molecular studies at both the protein and nucleic acid levels (9, 25, 28, 29, 49, 50). Detailed studies of the late-expressed sis gene suggest that its temporal control results from specific interactions between cis-regulatory DNA elements and respective positive and negative trans-acting factors, whose presence and/or activity varies during oogenesis (23). Spatial regulation is most obvious for the X-linked cluster of chorion genes and has been studied most extensively with regard to the s36 gene (28, 49). Although ultimately expressed throughout the follicular epithelium (with the exception of cell populations immediately surrounding the nurse cell remnants and at the tip of the developing micropyle), this gene is initially expressed during oogenic stage 10b solely in a subpopulation of anterior dorsal follicle cells. Our previous studies (49) localized important regulatory sequences to an 84-bp segment (nucleotides -132 to -49 with respect to the transcription initiation site), the proximal regulatory region (PRR). In transgenic flies, this minimal region directed expression of a reporter lacz construct with temporal and spatial specificity reminiscent of the endogenous s36 gene. The high resolution possible with the histochemical assay revealed that this lacz reporter is first activated at stage 10b in the anterior dorsal cells; this is followed by posterior-pole expression (stage 11) and then by expression throughout the follicle (beginning at stage 12). The proximal and distal halves of the PRR direct different spatial expression patterns: the proximal half (-93 to -49) favors anterior expression, while the distal half (-132 to -94) favors posterior expression (49). This finding suggests

VOL. 13, 1993 s36 FOLLICULAR EXPRESSION DURING DROSOPHILA OOGENESIS 5899 that the PRR consists of at least two distinct cis-regulatory elements, each favoring expression at a different pole. The failure of either half of the PRR to direct expression in the middle domain of the follicle and their severely reduced overall level of expression suggest either a synergistic effect between proximally and distally specific cis elements or the existence of additional cis elements spanning the -94 to -93 region. A redundant anterior-specific element, the distal regulatory region, was also localized further upstream at positions -1213 to -427 (the distal regulatory region is unrelated to the experiments reported here and will not be considered further). In the present study, we show that the precise expression pattern dictated by the s36 PRR is dependent on the establishment of proper dorsal-ventral polarity within the follicular epithelium, dependent on an epidermal growth factor receptor homolog encoded by the torpedo gene. In addition, by extensive site-directed mutagenesis of the PRR we show that transcription of s36 is regulated by a complex network of positive activators. We identify several individual cisacting elements apparently involved in positive s36 regulation, as well as sequences within the PRR that apparently play no important regulatory role. Several of the regulatory elements map to regions of the PRR that are conserved between dipteran species that have undergone over 120 million years of evolutionary divergence. We show that the partially conserved medfly (Ceratitis capitata) PRR is functional in Drosophila melanogaster, affirming the value of using sequence conservation as a guide for locating at least some regulatory regions. In their totality, our results suggest a model in which the activity of both ubiquitously expressed and spatially restricted activators within the polarized follicular epithelium may act in concert to spatially regulate s36 expression. MATERIALS AND METHODS Generation of topq-2; PRRlacZ females. A PRR-lacZcontaining stock (49) that harbored the transgene on the third chromosome was selected. The following series of crosses were performed to generate homozygous topqyi females, half of which contained the PRR-lacZ reporter gene: male cnlcn; ry", P[PRR-lacZ, ry+]iry" flies were crossed to virgin female topq-7, bwicyo; ry"06i'y" flies. Resulti virgin female progeny of the genotype cnitopq-1, bw; ry5 P[PRR-lacZ, ry+j/iy506 were crossed to male topqy', bwl CyO flies. Straight-wing, brown-eyed (homozygous topqy-) females (half of which contained the PRR-lacZ reporter gene, i.e., genotype topq0', bwltopq-', bw; ry56, P[PRRlacZ, ry+]/ry56) were selected for 0-galactosidase histochemical analysis. Plasmid constructions, site-specific mutagenesis, and germ line transformation. Oligonucleotide-directed substitution mutagenesis and vector construction were performed by standard techniques (16, 17). DNA was prepared from single-stranded PRR M13 recombinant phage grown in Escherichia coli CJ246 and was annealed with each of nine complementary oligonucleotides which varied between 36 and 59 nucleotides in length; each oligonucleotide contained a centered substitution mutation, 6 to 15 nucleotides in length, and yielded the corresponding mutation displayed in Fig. 2. The mutant sequences encompassed noncomplementary transversions at each position, i.e., A to C and G to T and vice versa. Following second-strand synthesis and selection of mutant phage, the PRR was sequenced for confirmation and subcloned upstream of the hsp70-lacz reporter gene of plasmid HZ5OPL (11) as done previously with the wild-type PRR (49). The resulting constructs were introduced into the Drosophila cn; ry5 genome by P-elementmediated germ line transformation (33, 40). One medfly construct was assembled from a genomic DNA fragment bearing sequences from -176 to -43 (15), blunt ended with the Klenow fragment of DNA polymerase I, ligated with NotI linkers, and cloned into the NotI site of HZ5OPL by standard techniques (34). The smaller medfly construct was assembled by annealing two complementary oligonucleotides that contained medfly sequences between -87 and -43 flanked with restriction sites for XbaI and KpnI and cloned into the respective sites of HZ5OPL. Alkaline Southern blot analysis of male fly genomic DNA (3) permitted selection of transformant lines containing single, unique inserts. Generation of additional transformant lines by genetic means. In those cases in which injection produced a limited number of individual transformants, additional lines were generated by variations of the jump start procedure (2). The P-element inserts of transformant flies were mapped with balancer stocks and mobilized by crossing with transposaseproducing stocks (as described in reference 32 for the second chromosome or with line hopl.1 [35] for the third chromosome). Histological assays of lcz fusion gene expression and in situ hybridization. Transformant females were conditioned (2 x 24 h at 25 C in fresh media) and dissected in Drosophila Ringer's solution (111 mm NaCl, 2 mm KCl, 2 mm NaHCO3, 1 mm CaC12, 0.08 mm NaH2PO4). Whole ovaries and individual follicles were fixed for 5 min in 200,ul of 4% paraformaldehyde, washed twice in 400 pl of Ringer's solution, stained for,3-galactosidase activity (31), and viewed 15 to 24 h later. Whole-mount in situ hybridization of conditioned wildtype Canton-S female ovaries was performed as described in reference 48 with modifications for ovaries as proposed in reference 46. The probe, a 1.8-kb XbaI-EcoRI genomic fragment encompassing the s36 gene, was gel purified and further digested with RsaI prior to digoxigenin labelling with a Genius kit (Boehringer Mannheim). RESULTS The spatial pattern of s36 expression controlled by an 84-bp PRR is affected by the torpedo gene. Expression of the endogenous s36 gene is spatially regulated, beginning first in the anterior region of the follicle (28). In transgenic flies, a similar pattern of expression is seen when the PRR (-132 to -49 with respect to the s36 transcription start site) is used to drive a reporter lacz gene in the context of the HZ5OPL transformation vector (49). To examine these patterns in more detail, we compared the spatial distribution of endogenous s36 RNA, as revealed by whole-mount in situ hybridization, with the spatial distribution of reporter P-galactosidase activity in follicles of previously described transgenic lines (49). As shown in Fig. 1, the patterns are quite similar both for the endogenous gene and for the transgene (the line shown in Fig. 1 was chosen in preference to other transformants, even though it showed unusually pronounced mottling in the main body of the follicle, because it was the only transformant that we had mapped to the third chromosome, as required for generating the proper top genetic background; see below and Materials and Methods). Both endogenous s36 expression and transgene expression begin at stage lob anteriorly and become very strong in the anterior

5900 TOLIAS ET AL. MOL. CELL. BIOL. b s36 RNA C / s36 f3 -galactosidase (+1+ ) s36 1 -galactosidase (top/top)

VOL. 13, 1993 s36 FOLLICULAR EXPRESSION DURING DROSOPHILA OOGENESIS 5901 FIG. 1. Patterns of endogenous and transgenic s36 expression. (a to c) Expression pattern of the endogenous s36 RNA as detected by in situ hybridization with a digoxigenin-labelled probe. Histochemical analysis of s36 PRR-directed transgene expression in wild-type (d to f) versus topq0' (g to i) follicles is also presented. Each follicle is oriented with the anterior end uppermost and the dorsal side to the right. The three columns (from left to right) show follicles from stages 11, 12, and 13 of oogenesis. dorsal region at stage 11 (stages as described in reference 14). This is followed by moderately strong but highly localized expression at the posterior pole, and then the expression spreads to the main body of the follicle at stages 12 and 13. Main-body expression is decidely weaker than at the poles and is frequently nonuniform. By stage 14 the endogenous s36 RNA disappears, while strong,b-galactosidase activity is evident throughout the follicle, presumably because of accumulation and perdurance of the enzyme. The torpedo mutations of the gene encoding the epidermal growth factor receptor homolog alter follicular polarity (36): they ventralize both the follicular epithelium (as revealed by stunting of anterior-dorsal chorionic structure, such as the respiratory appendages and the operculum) and the underlying oocyte (as revealed by subsequent expansion of embryonic ventral structures). The 84-bp PRR is able to sense the torpedo-induced ventralization of the follicular epithelium (Fig. 1). In the background of a weak torpedo allele (topq ), activation of the reporter gene is delayed to stage 11, when the anterior end of the epithelium stains weakly as a uniform ring rather than predominantly on its dorsal aspect. Subsequently the ring increases in intensity but without evident dorsal polarity. Site-directed mutagenesis of the PRR. In order to identify and characterize the cis-regulatory elements present within the PRR, nine site-directed, clustered substitution mutations (a to i, Fig. 2) covering a contiguous segment of 77 bp were constructed and cloned into the HZ5OPL transformation vector. In addition to the individual a to i mutations, the composite mutations a and h, b and h, and b and e were constructed. The mutations were designed partly by reference to sequences that are conserved between D. melanogaster, Drosophila virilis, and the medfly, C. capitata (15). For example, mutation h alters a hexameric sequence (TCACGT) that is perfectly conserved in the s36 gene of all three species and is also found in approximately the same position in all known fly (6, 15, 18, 24, 47, 54) and most moth (38) chorion gene promoters. Figure 2 includes a comparison of the D. melanogaster PRR and the corresponding, shorter (45-bp) medfly sequence; conserved DNA motifs are boxed. Transposons bearing the mutated D. melanogaster PRRs or the wild-type medfly sequence were introduced into the D. melanogaster germ line via standard P-element-mediated germ line transformation techniques (33, 40). For each transposon, a minimum of 5 (range, 5 to 20) independent transformant lines with unique chromosomal inserts were selected for analysis (see Materials and Methods). The use of multiple transformant lines per construct is essential to reduce potential error resulting from possible enhancer trap (26) and chromosomal position (see, e.g., reference 41) effects. The 3-galactosidase activity was assayed by histochemical staining, in both whole ovaries and individual staged follicles, after fixation in paraformaldehyde (see Materials and Methods). A summary of the results is given in Table 1 and Fig. 2, and representative staining patterns are presented in Fig. 3. As done previously (49), lines are Activators General General Sites -87 I II C. C ACGAGTGATG Ati.... GACCC.. Anterior Anterior MI Main Body III IV V -43. ~LIA~GAACTCAG reduced D.m iz 1-49 GAGAGATCACGTAGCCG CATGGCGG _1,1 v; So A ^ CTCTAG3ACGCACGATGGCGAGACAAAGATGCC GCAAAATCC ~ wild type TCGAGTTTACA TCTCACCCTCG TACCCCGATTCCCGT TCGTTC CTAATTAACGTTATT TCGTTATCT TA w TTCCCGTTC GACATQ a b c d' e f g h reduced wild reduced wild' wild posterior polar ttype ype posterior type terminal terminal A weak--r-.-r polar vosterior terminal FIG. 2. Expression of s36 PRR sequences. The DNA region shown corresponds to the plus strand of D. melanogaster s36 PRR (-132 to -49) (D.m). Bars indicate locations and sequences of nine clustered substitution mutations (a to i). Deletion mutations (A) are also indicated (49). The 5'-flanking region of s36 from C. capitata (C.c.) is also shown, with boxed sequences (adapted from reference 15, Fig. 4) representing conserved elements. The [3-galactosidase staining patterns displayed by the different wild-type, substitution, or deletion PRR-lacZ transgenic constructs are indicated at the bottom of the figure. I to V refer to the cis-activating sites which have been identified in this study. A

5902 TOLIAS ET AL. MOL. CELL. BIOL. PRR mutationb TABLE 1. Spatial expression patterns of s36 constructsa Canonical spatial patternc No. of linesd Relative intensity A M P C N V -132 to -49 a ++ (2) + Moderate 3 2 1 b* +++ + (9) ++ Strong 11 1 0 c ++ (3) + Moderate 4 2 0 d* +++ + (11) ++ Strong 12 0 0 e (2) - + Veryweak 5 4 1 f - - + Very weak 3 5 2 g* +++ + (10) ++ Strong 12 0 0 h (3) - + Very weak 7 6 1 i + + + (1) + + Strong 9 1 0 a and h (3) - + Veryweak 8 5 1 b and h (4) - + Weak 11 1 0 b and e - - + Veryweak 2 3 0 C. capitata 5'-flanking DNA -176 to -43 ++ (1) + Weak-moderate 11 5 0-87 to -43 ++ (3) + Weak-moderate 12 8 0 a A summary of reporter lacz expression patterns resulting from mutated D. melanogaster PRR and wild-type C. capitata 5'-flanking DNA introduced into transgenic D. melanogaster. b For a description of the mutations, see Fig. 2. Mutants designated with an asterisk stain in a pattern identical to that of wild-type PRR (49). ca, anterior end of the follicle; M, main body; P, posterior end of the follicle; -, absence of staining; +, + +, and + + +, staining, depending on relative intensity. Numbers in parentheses indicate the number of lines showing staining in that particular area; if the parentheses are unaccompanied by +, the staining is very weak. d C, staining in the canonical pattern; N, not staining; V, staining in a clearly variant pattern (presumably due to enhancer trap effects). classified in Table 1 as showing canonical staining (repeatable for several independent lines), no staining (inserts at chromosomal sites unfavorable for expression), or variant staining (inserts subject to enhancer trap effects). Mutations b, d, and g give wild-type expression patterns. As exemplified by Fig. 3A, mutations b, d, and g show similar staining patterns, comparable to that of the wild-type PRR construct (Fig. 2) (49). As in the wild type, intense staining first appears in the anterior dorsal region, beginning at stage lob, and is followed by moderately strong but more localized posterior-pole staining in stage 11. By stage 12 staining spreads to the main body, where it increases gradually but remains lighter than in the anterior and posterior poles. Main-body staining varies in different lines, from barely detectable or absent (14% of the canonical lines; Table 1) to a mottled pattern or to full and heavy staining. Such variation, which is roughly correlated with the overall intensity of P-galactosidase activity in the follicle, has been observed previously and is presumably caused by chromosomal position effects (49). Mutations a and c give qualitatively correct but quantitatively reduced expression. a and c mutants also stain in a qualitatively wild-type pattern: anterior dorsal staining beginning at stage lob, posterior-pole staining beginning at stage 11, and main-body staining in subsequent stages. However, within the limits of variability among independent lines, expression is quantitatively reduced, as is most apparent in the main body (Fig. 3B and Table 1): while small patches of the main body exhibit staining, full main-body expression is never observed. Mutation i suppresses expression in the follicular main body. A different expression pattern is encountered with mutation i (Fig. 3C). In this case, expression at the anterior and posterior poles appears as intense as in the wild type or with mutations b, d, and g and is stronger than with mutations a and c. However, expression in the main body is dramatically affected: it is barely detectable in one line and absent from the remaining eight expressing lines. In blind comparisons between mutations b, c, and i, the phenotypes were accurately identified (data not shown). Thus, the i mutation seems to have no significant effect at the poles but suppresses the main-body expression more extremely than do mutations a and c, resulting in a polar staining pattern. For mutations e, f, and h, expression is limited to the posterior terminus. The expression pattern of mutations e, f, and h is radically different. Staining is very weak and punctate, being essentially confined to the extreme posterior terminus (Fig. 3E) as opposed to the broader posterior pole that stains in the wild type and in other mutants. There is no staining in the main body and only occasional very minor staining in the anterior dorsal region (Fig. 3F). This pattern cannot be explained as resulting simply from reduced expression, because in the wild type the anterior end invariably stains more strongly than the posterior terminus. Approximately 44% of the lines show no detectable staining, compared with 10% for all the previous mutations combined. Any staining, however, is temporally correct, beginning at stage 11. The sharply punctate posterior terminal staining that is characteristic of these mutants cannot be explained as an artifact of the hs-lacz reporter, because it has never been observed in control lines bearing the vector alone. Evidently, the wild-type e, f, and h sequences are needed for PRR promoter activity in most of the follicular epithelium but are dispensable at the posterior terminus. The occasional very minor anterior staining of these mutants, observed after 15 to 24 h of exposure to 5-bromo-4-chloro-3-indolyl-p-Dgalactopyranoside (X-Gal), varies from a discrete point at the tip of the operculum to diffuse staining along and between the dorsal appendages. Although such staining is not evident after 15 to 24 h in control lines bearing only the HZ50PL vector (49), weak anterior staining has been observed more recently in the same controls after approximately 48 h (5).

VOL. 13, 1993 s36 FOLLICULAR EXPRESSION DURING DROSOPHILA OOGENESIS 5903 FIG. 3. Canonical 0-galactosidase staining patterns of staged follicles from transgenic flies (see Table 1 and the text). In each panel, follicles are oriented with the anterior end at the top and younger stages to the left. (A) A representative line bearing mutation b. The observed staining pattern is identical to that of the wild-type pattern (see Fig. 2B and C of reference 49). Lines bearing mutations d and g stained in an identical manner. (B) A representative line bearing mutation c. Main-body staining is reduced compared with that in the wild-type pattern (A), and polar staining is reduced relative to that in both the wild type and the i mutant (C). In short, the pattern is qualitatively wild type but quantitatively reduced. The a mutant stained in an identical manner. (C) A representative line bearing mutation i; while polar expression is at wild-type levels (A), there is no staining observed within the main body. (E) A line bearing mutation h (and also e and f) stains solely at the tip of the posterior pole, in the canonical pattern; half of the lines did not stain at all. In a few cases very weak anterior staining was detectable (F); this may be a vector-induced artifact. Note that the posterior terminal staining is punctate, unlike the more diffuse wild-type staining. (D) A representative line bearing the medfly -87/-43 construct. The staining pattern is comparable to that of the D. melanogaster PRR a and c mutants (which are themselves quantitatively reduced compared with the wild type). Lines from the medfly -176/-43 construct stained in an identical manner. Lines carrying the composite mutations a and h, b and h, and b and e show posterior terminal staining, like lines carrying the individual h or e mutation alone. The only minor difference is that staining appears to be slightly stronger in composite b and h mutants, of which only 8% of the lines fail to stain altogether, compared with 43% in h mutants alone. Reduced but qualitatively normal expression is directed by a 45-bp medfly PRR sequence in transgenic Drosophila flies. Numerous lines bearing medfly s36 sequences were tested for their ability to direct follicular expression in transgenic Drosophila flies. Both -176/-43 and -87/-43 constructs gave the same results: moderate staining at the two poles and weaker but widespread main-body staining (Fig. 3D). This staining pattern can be classified as qualitatively normal but quantitatively reduced; it is similar to the staining pattern of a and c mutants and clearly distinguishable from both polar staining (i mutant) and posterior terminal staining (e, f, and h mutants). It should be noted that the spatial expression pattern of the endogenous s36 gene in the medfly is not known.

5904 TOLIAS ET AL. DISCUSSION A model of s36 cis-regulatory elements. A consistent model of s36 spatial regulation, based on multiple cis-activating elements in the PRR (Fig. 2), can be derived from the transgenic functional analysis of clustered substitutions (this report) and deletions (49). Alternative models might also explain the data, but the one presented here seems simplest. The medfly PRR can direct a qualitatively normal expression in transgenic Drosophila flies, indicating that at least some of the postulated cis-activating elements are functionally conserved in evolution. In the wild type the anterior dorsal region stains earliest and strongest, followed by the posterior pole; the staining of the main body is last and weakest. The upstream half of the D. melanogaster PRR appears to contain two distinct general activator elements, which enhance expression throughout the follicular epithelium: either one of the nonoverlapping a and c mutations reduces expression moderately, in contrast to the alternating mutations b and d, which have no significant effect. One of the putative activator elements may be delimited to ACAAAGAT, the sequence that is unique to mutation c (site II in Fig. 2). The sequence comparison of the Drosophila and medfly PRRs suggests that the other activator, which is disrupted by mutation a, may correspond to the conserved motif GATCTGG (site I in Fig. 2). The medfly PRR encompasses site I but not site II and expresses in a manner similar to that of the Drosophila mutation c, in which site II is eliminated. Consistent with these results, deletion of the Drosophila -132 to -94 DNA (eliminating both sites I and II) results in weak staining, most evident in the anterior pole, which stains most strongly even in the wild type (49). Taken together, these observations suggest that the two postulated activating elements may function throughout the follicular epithelium, interchangeably and cumulatively. In the downstream half of the PRR, the results suggest the existence of three distinct activating sites. One of these (site III) is defined as a minimum by the overlap of mutations e and f; e and f mutants both show weak staining largely limited to the posterior terminus. Site III encompasses a GAAAT motif that is partially conserved in the medfly. A functionally similar activating site, IV, is disrupted when the ubiquitous chorion hexamer TCACGT is mutated. This hexamer is embedded in a longer sequence which is conserved in the medfly. The beginning of that conserved sequence, GGA, can be changed without affecting expression (mutation g), but the downstream end overlaps with mutation i, which preferentially abolishes main-body expression, resulting in a strongly polar staining pattern. The latter mutation identifies a fifth activating site, V, which is only broadly localized and may be conserved in function but not in sequence. Unlike the upstream sites I and II, which act as general activators, the downstream sites appear to control expression in specific regions of the follicular epithelium: site V appears to be important for expression in the main body but irrelevant to expression at the poles, while sites III and IV are both dispensable for staining at the posterior terminus but important for anterior (and probably for main-body and nonterminal posterior) expression. Unlike the upstream general activators which appear to be additive, sites III and IV may act cooperatively, since disruption of either one results in the same posterior terminal pattern of expression. Sites III and IV may bind a heterodimeric protein complex that is very important for transcriptional activation in much of the follicular epithelium, but not at the posterior terminus. MOL. CELL. BIOL. Consistent with these results, deletion of the downstream half of PRR gives a posterior terminal staining pattern, comparable to that of e, f, and h mutants (49). trans factors and their temporal and spatial distribution. Each of the five sites defined by these experiments may correspond to a positive trans-acting factor. For brevity and at the risk of oversimplification, we will designate these putative factors general (sites I and II), anterior (sites III and IV), and main-body (site V) activators. An additional factor binding to multiple sites within the PRR may be postulated to explain posterior terminal expression, which we have not eliminated by any mutation or deletion. None of the mutations interfere with the correct onset of s36 expression at the beginning of choriogenesis. In contrast, late-specific chorion promoters can be mutated to begin expression earlier (23, 39). A parsimonious explanation of the temporal specificity of s36 is that at least one of the anterior factors and the posterior terminal regulator are temporally specific, appearing in an active form at the appropriate early time. What might be the spatial distributions of the putative trans factors, to explain the observed spatial patterns of expression? The active form of one or both of the anterior activators may be enriched in the anterior pole, thus accounting for the generally higher and earlier expression of s36 in this spatial domain. Conversely, the putative posterior activator is expected to be most enriched in the posterior terminus. There is no reason to postulate that the general activators of sites I and II are spatially restricted. Similarly, the site V factor may be ubiquitously distributed but functionally important only in the main body: for example, it may be important for stabilizing the binding of an anterior activator when the concentration of this activator is low, as in the main body. Identification of s36 trans-acting factors awaits screening of an expression library with oligonucleotides designed on the basis of our new knowledge of the cis-regulatory s36 elements, followed by biochemical and genetic analysis of these factors. Expression of s36 in spatial domains of the follicle. The major conclusions of this study are that s36 is indeed differentially expressed in distinct spatial domains of the follicular epithelium, as reported earlier (49); that this spatial pattern is mediated by multiple cis-regulatory elements within the PRR; and that these elements are capable of responding to changes in the epithelial differentiation of these domains, as shown by their response to the torpedo mutation. The most likely explanation of the altered staining pattern in the topq0l background is that top affects the differentiation of the follicular epithelium, giving some of the cells an incorrect ventralized identity and thereby indirectly causing them to reduce expression of the chorion promoter. We cannot eliminate the theoretical possibility that top affects cell position rather than dorso-ventral differentiation of the follicular epithelium, although the latter is the favored interpretation (36). The initial evidence for spatial domains in the follicular epithelium was morphological: Margaritis et al. (22) identified distinct follicular cell populations responsible for constructing diverse chorionic structures, including the anterior micropyle, the anterior dorsal operculum and respiratory appendages, the dorsal and ventral regions of the main chorion, and the posterior aeropyle. Localized differences in the expression of some chorion genes were then described (25, 28). Strong support for the concept that specific domains of the follicular epithelial are specialized came from enhancer trap studies, which inferred the existence of enhancers that are preferentially active in anterior or posterior

VOL. 13, 1993 s36 FOLLICULAR EXPRESSION DURING DROSOPHILA OOGENESIS 5905 follicular cells, at both ends, or in a double gradient with maximal activity at the anterior dorsal region (4, 10), and from studies defining cis-regulatory sequences controlling the follicular transcriptional specificity of yolk protein genes (19). The best evidence came from genetic studies on asymmetry, which now is known to develop interactively in both the oocyte and the follicular epithelial cells. The torso-like (tsl) gene must be expressed in the follicular epithelium in order to specify the anterior acron and posterior telson in the embryo that will develop from the underlying oocyte. Clonal analysis has demonstrated that the requirement for tsl is local: homozygous Tsl- clones limited to 6 to 30 follicular epithelial cells at the posterior pole are sufficient to prevent posterior telson formation in the embryo (43, 44). While tsl mutants do not show chorion defects, mutations in some genes upstream of tsl result in choriogenic as well as embryonic phenotypes (42). Similarly, expression of the torpedo gene in the follicular epithelium is necessary for development of dorso-ventral asymmetry in both the follicular cells and the embryo (30, 36). This gene, which encodes an epidermal growth factor receptor homolog, has a central place in a continuing dialogue between the somatic follicular cells and the germ line, which involves numerous other genes (reviewed in reference 37). As we have seen, localized expression of the s36 promoter is affected by torpedo gene activity. It is not unreasonable to speculate that the follicular cell domains are defined by cell-to-cell communication, while the epithelial cells undergo their extensive migrations over the germ line (14). As groups of follicle cells (e.g., the anteriodorsal cells responsible for the operculum and the respiratory appendages) migrate over the oocyte, they may receive signals that direct them to differentiate by activating a set of transcription factors appropriate for domain-specific gene expression, including expression of the chorion genes. In turn, these transcription factors may be implicated in the generation of new signals, both to the oocyte and to other follicular cell populations-leading, respectively, to further polarization of the oocyte and to the spread of choriogenesis throughout the epithelium (28). ACKNOWLEDGMENTS We thank H. Kashevsky for technical assistance, M. Fenerjian and L. Stevens for sharing of results, M. Sanicola for supplying CyO (hopl.1) flies, T. Schupbach for providing a fly stock containing top0y' and for advice in crossing a PRR-lacZ-containing stock into a homozygous topq0' background, and S. Pedreira for secretarial assistance. This work was initiated at Harvard, where it was supported by a National Science Foundation grant (IBN-8819117) to F.C.K. and a Medical Research Council of Canada Centennial Fellowship to P.P.T. The work was completed at PHRI with support from an NSF grant (DCB-9117180) to P.P.T. REFERENCES 1. Akam, M. 1987. The molecular basis for metameric pattern in the Drosophila embryo. Development 101:1-22. 2. Cooley, L., R. Kelley, and A. Spradling. 1988. Insertional mutagenesis of the Drosophila genome with single P elements. Science 239:1121-1128. 3. Delidakis, C., and F. C. Kafatos. 1987. Amplification of a chorion gene cluster in Drosophila is subject to multiple cisregulatory elements and to long-range position effects. J. Mol. Biol. 197:11-26. 4. Fasano, L., and S. Kerndge. 1988. Monitoring positional information during oogenesis in adult Drosophila. Development 104:245-253. 5. Fenerjian, M. Personal communication. 6. Fenerjian, M. G., J. C. Martinez-Cruzado, C. Swimmer, D. King, and F. C. Kafatos. 1989. Evolution of the autosomal chorion cluster in Drosophila. Chorion expression and sequence comparisons of the s16 and s19 genes in evolutionarily distinct species. J. Mol. Evol. 29:108-125. 7. Frey, A., and H. Gutzeit. 1986. Follicle cells and germ line cells both affect polarity in dicephalic chimeric follicles in Drosophila. Roux's Arch. Dev. Biol. 195:527-531. 8. Galanopoulos, V. K., W. Orr, J. Szabad, and F. C. Kafatos. 1989. Genetic analysis of chorion formation in Drosophila melanogaster. I. The effects of one somatic-specific and seven germ-line-specific mutations. Dev. Genet. 10:87-97. 9. Griffin-Shea, R., G. C. Thireos, and F. C. Kafatos. 1982. Organization of a cluster of four chorion genes in Drosophila and its relationship to developmental expression and amplification. Dev. Biol. 91:325-336. 10. Grossniklaus, U., H. J. Bellen, C. Wilson, and W. J. Gehring. 1989. P-element-mediated enhancer detection applied to the study of oogenesis in Drosophila. Development 107:189-200. 11. Hiromi, Y., and W. J. Gehring. 1987. Regulation and function of the Drosophila segmentation genefiushi tarazu. Cell 50:963-974. 12. Ingham, P. W. 1988. The molecular genetics of embryonic pattern formation in Drosophila. Nature (London) 335:25-34. 13. Kafatos, F. C., N. Spoerel, S. A. Mitsialis, H. T. Nguyen, C. Romano, J. R. Linpppa, B. D. Mariani, G. C. Rodakis, R. Lecanidou, and S. G. Tsitilou. 1987. Developmental control and evolution in the chorion gene families of insects. Adv. Genet. 24:223-242. 14. King, R. C. 1970. Ovarian development in Drosophila melanogaster. Academic Press, Inc., New York. 15. Konsolaki, M., K. Komitopoulou, P. P. Tolias, D. L. King, C. Swimmer, and F. C. Kafatos. 1990. The chorion genes of the medfly, Ceratitis capitata. I. Structural and regulatory conservation of the s36 gene relative to two Drosophila species. Nucleic Acids Res. 18:1731-1737. 16. Kunkel, T. A. 1985. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82:488-492. 17. Kunkel, T. A., J. D. Roberts, and R. A. Zakour. 1987. Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154:367-382. 18. Levine, J., and A. C. Spradling. 1985. DNA sequence of a 3.8 kilobase pair region controlling Drosophila chorion gene amplification. Chromosoma 92:136-142. 19. Logan, S. K., M. J. Garabedian, and P. C. WensinL 1989. DNA regions that regulate the ovarian transcriptional specificity of Drosophila yolk protein genes. Genes Dev. 3:1453-1461. 20. Lohs-Schardin, M. 1982. Dicephalic-Drosophila mutant affecting polarity in follicle organization and embryonic patterning. Wilhelm Roux's Arch. Dev. Biol. 191:28-36. 21. Margaritis, L. H. 1985. Structure and physiology of the eggshell, p. 153-230. In G. A. Kerkut and L. F. Gilbert (ed.), Comprehensive insect physiology, biochemistry and pharmacology, vol. 1. Pergamon, Oxford. 22. Margaritis, L. H., F. C. Kafatos, and W. H. Petri. 1980. The eggshell of Drosophila melanogaster. I. Fine structure of the layers and regions of the wild-type eggshell. J. Cell Sci. 43:1-35. 23. Mariani, B. D., J. R. Lingappa, and F. C. Kafatos. 1988. Temporal regulation in development: negative and positive cis-regulators dictate and precise timing of expression of a Drosophila chorion gene. Proc. Natl. Acad. Sci. USA 85:3029-3033. 24. Martinez-Cruzado, J. C., C. Swimmer, M. G. Fenerijian, and F. C. Kafatos. 1988. Evolution of the autosomal chorion locus in Drosophila. I. General organization of the locus and sequence comparisons of genes sis and s19 in evolutionarily distant species. Genetics 119:663-667. 25. Mindrinos, M. N., W. H. Petri, V. K. Galanopoulos, M. F. Lombard, and L. H. Margaritis. 1980. Crosslinking of the Drosophila chorion involves a peroxidase. Wilhelm Roux's Arch. Dev. Biol. 189:187-196. 26. O'Kane, C. J., and W. J. Gehring. 1987. Detection in situ of genomic regulatory elements in Drosophila. Proc. Natl. Acad.

5906 TOLIAS ET AL. Sci. USA 84:9123-9127. 27. Orr-Weaver, T. 1991. Drosophila chorion genes: cracking the eggshell's secrets. Bioessays 13:97-105. 28. Parks, S., and A. Spradling. 1987. Spatially regulated expression of the chorion genes during Drosophila oogenesis. Genes Dev. 1:497-509. 29. Petri, W. H., A. R. Wyman, and F. C. Kafatos. 1976. Specific protein synthesis in cellular differentiation. III. The eggshell proteins of Drosophila melanogaster and their program of synthesis. Dev. Biol. 49:185-199. 30. Price, J. V., R. J. Clifford, and T. Schiipbach. 1989. The maternal vetralizing locus torpedo is allelic to faint little ball, an embryonic lethal, and encodes the Drosophila EGF receptor homolog. Cell 56:1085-1092. 31. Raghavan, K. V., M. A. Crosby, P. H. Mathers, and E. M. Meyerowitz. 1986. Sequences sufficient for correct regulation of Sgs-3 lie close to or within the gene. EMBO J. 5:3321-3326. 32. Robertson, H. M., C. R. Preston, R. W. Phillis, D. M. Johnson- Schlitz, W. K. Benz, and W. R. Engels. 1988. A stable genomic source of P element transposase in Drosophila melanogaster. Genetics 118:461-470. 33. Rubin, G. M., and A. C. Spradling. 1982. Genetic transformation of Drosophila with transposable element vectors. Science 218:348-353. 34. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 35. Sanicola, M. Personal communication. 36. Schuipbach, T. 1987. Germ line and soma cooperate during oogenesis to establish the dorsoventral pattern of egg shell and embryo in Drosophila melanogaster. Cell 49:699-707. 37. Schupbach, T., R. J. Clifford, L. J. Manseau, and J. V. Price. 1991. Dorsoventral signaling processes in Drosophila oogenesis, p. 163-174. In J. Gerhart (ed.), Cell-cell interactions in early development. Wiley-Liss, Inc., New York. 38. Spoerel, N., H. T. Nguyen, and F. C. Kafatos. 1986. Gene regulation and evolution in the chorion locus of B. mori: structural and developmental characterization of four eggshell genes and their flanking DNA regions. J. Mol. Biol. 190:23-35. 39. Spoerel, N. A., H. T. Nguyen, S. Towne, and F. C. Kafatos. 1993. Negative and positive regulators modulate the activity of a silkmoth chorion gene during choriogenesis. J. Mol. Biol. 230: 151-160. 40. Spradling, A. C., and G. M. Rubin. 1982. Transposition of cloned P elements into Drosophila germ line chromosomes. Science 218:341-347. 41. Spradling, A. C., and G. M. Rubin. 1983. The effect of chromosomal position on the expression of the Drosophila xanthine dehydrogenase gene. Cell 34:47-57. MOL. CELL. BIOL. 42. Stevens, L. Personal communication. 43. Stevens, L. M., H. G. Frohnhofer, M. Klinger, and C. Nusslein- Volhard. 1990. Localized requirement for torso-like expression in follicle cells for development of terminal anlagen of the Drosophila embryo. Nature (London) 346:660-663. 44. Stevens, L. M., and C. Nusslein-Volhard. 1991. Development of the terminal anlagen of the Drosophila embryo depends upon interactions between the germline and the somatic follicle cells, p. 145-162. In J. Gerhart (ed.), Cell-cell interactions in early development. Wiley-Liss, Inc., New York. 45. St. Johnston, D., and C. Nusslein-Volhard. 1992. The origin of pattern and polarity in the Drosophila embryo. Cell 68:201-219. 46. Suter, B., and R. Steward. 1991. Requirement for phosphorylation and localization of the bicaudal-d protein in Drosophila oocyte differentiation. Cell 67:917-926. 47. Swimmer, C., M. G. Fenerjian, J. C. Martinez-Cruzado, and F. C. Kafatos. 1990. Evolution of the autosomal chorion cluster in Drosophila. III. Comparison of the s18 gene in evolutionarily distant species and interspecific control of chorion gene amplification. J. Mol. Biol. 215:225-235. 48. Tautz, D., and C. Pfeifle. 1989. A non-radioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback. Chromosoma 98:81-85. 49. Tolias, P. P., and F. C. Kafatos. 1990. Functional dissection of an early Drosophila chorion gene promoter: expression throughout the follicular epithelium is under spatially composite regulation. EMBO J. 9:1457-1464. 50. Waring, G. L., and A. P. Mahowald. 1979. Identification and time synthesis of chorion proteins in Drosophila melanogaster. Cell 16:599-607. 51. Wieschaus, E. 1979. fs(l)k10, a female sterile mutation altering the pattern of both the egg coverings and the resultant embryos in Drosophila, p. 291-302. In N. L. Douarin (ed.), Cell lineage, stem cells, and the cell determination. INSERM symposium no. 10. Elsevier, Amsterdam. 52. Wieschaus, E. 1980. A combined genetic and mosaic approach to the study of oogenesis in Drosophila, p. 75-85. In 0. Siddiqi, P. Babu, L. M. Hall, and J. C. Hall (ed.), Development and neurobiology of Drosophila. Plenum Press, New York. 53. Wieschaus, E., J. L. Marsh, and W. J. Gehring. 1978. fs(l)k1o, a female sterile mutation causing abnormal chorion morphology in Drosophila melanogaster. Wilhelm Roux's Arch. Dev. Biol. 184:75-82. 54. Wong, Y.-C., J. Pustell, N. Spoerel, and F. C. Kafatos. 1985. Coding and potential regulatory sequences of a cluster of chorion genes in Drosophila melanogaster. Chromosoma 92: 124-135.