Characteristics Section 4 Professor Donald McFarlane Lecture 11 Animals: Origins and Bauplans Multicellular heterotroph Cells lack cell walls Most have nerves, muscles, capacity to move at some point in the life cycle Ability to reproduce sexually Specialized sensory structures and nervous system 2 Traditional classifications Most biologists agree kingdom is monophyletic About 35 recognized animal phyla Most likely ancestor a colonial flagellated protist similar to choanoflagellates Some are colonial Some cells my have taken on specialized functions Choanoflagellate cell Sponge cell (choanocyte) 3 (a) Colonial choanoflagellate (b) Sponge 4 1
Traditional classification based on body plans 4 main morphological and developmental features used 1. Presence or absence of different tissue types 2. Type of body symmetry 3. Presence or absence of a true body cavity 4. Patterns of embryonic development 1. Tissues Metazoa - all animals Divided into Parazoa (no specialized tissues or organs) Porifera sponges Eumetazoa (more than one type of tissue and organs) 5 6 2. Symmetry Eumetazoa are radially symmetrical (Radiata) or bilaterally symmetrical (Bilateria) Bilateral animals have cephalization and dorsal and ventral ends 3 germ layers Radial animals have oral and aboral sides 2 germ layers 7 8 2
Number of cell layers Bilateria are triplobalstic 3 layers Radiata are diploblastic 2 layers Cell layers develop during gastrulation Inner layer endoderm Outer layer ectoderm Mesoderm - 3 rd layer in bilateral animals Forms muscles and most other organs 9 10 Blastula (hollow ball) 8-cell stage 8-cell stage 11 12 3
Endoderm Archenteron Blastula (hollow ball) Blastula (hollow ball) Ectoderm 8-cell stage Gastrulation Gastrula Mesoderm Blastopore 8-cell stage Gastrulation 13 14 3. Body cavity True coelom body cavity is completely lined with mesoderm (coelomates) Pseudocoelom coelom is not completely lined by tissue derived from mesoderm (pseudocoelomates) Acoelomates lack a body cavity entirely Fluid-filled body cavity can protect internal organs or be used as hydrostatic skeleton 15 16 4
4. Embryonic development Protostome Spiral cleavage determinate Blastopore becomes mouth Deuterostome Radial cleavage is indeterminate- pluripotent stem cells Blastopore becomes anus 17 18 Other methods of classification Possession of exoskeleton Development of notochord Presence or absence of segmentation Traced to changes in homeotic or Hox genes 19 20 5
Changes in Hox Gene Expression Control Body Segment Specialization Hox genes involved in pattern formation in early embryos. Relatively simple changes in the expression patterns of these genes can account for the large variation in arthropod appendage types Hox genes designated 1-13 Shifts in patterns of gene expression in the embryo along the anteroposterior axis govern transition from one type of vertebra to another and short or long necks Mice, chicken, goose, and snake Illustrates descent with modification GAGGTTCGAAGACGATCAGATACCGTCGTAGTTCCGACCATAAACGATG Sponge GAGGTTCGAAGACGATCAGAT ACCGTCGTAGTTCCAACCATAAACGATG Flatworm GAGGTTCGAAGACGATCAGAT ACCGTCGTAGT TCTGACCATAAACGATG Seagull GGGGATCAAAGACGATCAGAT ACCGTCGTAGTCTTAACTATAAACT ATA Paramecium KEY Identical in all four species Identical in two or three species Dissimilar in one animal species Dissimilar in the protist Fig 32.8 23 24 6
Similarities between traditional and molecular phylogeny 1. The clade called Metazoa is monophyletic, meaning all animals came from a single common ancestor. 2. At the earliest stages of evolution, molecular phylogeny supports the traditional view of the split between Parazoa and Eumetazoa. 3. There is also agreement about an early split between Radiata and Bilateria, with most animal phyla belonging to the Bilateria. 4. Molecular phylogeny also agrees that the echinoderms and chordates belong to a clade called the Deuterostomia. 2 additional key differences between traditional and molecular phylogeny 1. Relationships among Bilateria 2. Presence or absence of a body cavity 25 26 27 7