Single-cell systems biology by super-resolution imaging and combinatorial labeling

Similar documents
High throughput near infrared screening discovers DNA-templated silver clusters with peak fluorescence beyond 950 nm

Practical Bioinformatics

SUPPORTING INFORMATION FOR. SEquence-Enabled Reassembly of β-lactamase (SEER-LAC): a Sensitive Method for the Detection of Double-Stranded DNA

Supplementary Information for

Supplemental data. Pommerrenig et al. (2011). Plant Cell /tpc

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

SEQUENCE ALIGNMENT BACKGROUND: BIOINFORMATICS. Prokaryotes and Eukaryotes. DNA and RNA

Number-controlled spatial arrangement of gold nanoparticles with

Advanced topics in bioinformatics

Supplementary Information

Crick s early Hypothesis Revisited

Electronic supplementary material

Supporting Information

SUPPLEMENTARY DATA - 1 -

SSR ( ) Vol. 48 No ( Microsatellite marker) ( Simple sequence repeat,ssr),

Clay Carter. Department of Biology. QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture.

Characterization of Pathogenic Genes through Condensed Matrix Method, Case Study through Bacterial Zeta Toxin

Regulatory Sequence Analysis. Sequence models (Bernoulli and Markov models)

Supplemental Figure 1.

NSCI Basic Properties of Life and The Biochemistry of Life on Earth

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008

Table S1. Primers and PCR conditions used in this paper Primers Sequence (5 3 ) Thermal conditions Reference Rhizobacteria 27F 1492R

Building a Multifunctional Aptamer-Based DNA Nanoassembly for Targeted Cancer Therapy

Supplemental Table 1. Primers used for cloning and PCR amplification in this study

SUPPLEMENTARY INFORMATION

TM1 TM2 TM3 TM4 TM5 TM6 TM bp

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Schematic of split-merger microfluidic device used to add transposase to template drops for fragmentation.

Supporting Information for. Initial Biochemical and Functional Evaluation of Murine Calprotectin Reveals Ca(II)-

Measuring Colocalization within Fluorescence Microscopy Images

Modelling and Analysis in Bioinformatics. Lecture 1: Genomic k-mer Statistics

Protein Threading. Combinatorial optimization approach. Stefan Balev.

Supplementary Figures Supplementary Figure 1: Estimation of the error of the number and brightness of molecules in a single cluster; Simulation

Evolvable Neural Networks for Time Series Prediction with Adaptive Learning Interval

Single-Molecule Methods I - in vitro

3. Evolution makes sense of homologies. 3. Evolution makes sense of homologies. 3. Evolution makes sense of homologies

Why do more divergent sequences produce smaller nonsynonymous/synonymous

evoglow - express N kit distributed by Cat.#: FP product information broad host range vectors - gram negative bacteria

ydci GTC TGT TTG AAC GCG GGC GAC TGG GCG CGC AAT TAA CGG TGT GTA GGC TGG AGC TGC TTC

evoglow - express N kit Cat. No.: product information broad host range vectors - gram negative bacteria

Timing molecular motion and production with a synthetic transcriptional clock

GS Analysis of Microarray Data

The role of the FliD C-terminal domain in pentamer formation and

SUPPLEMENTARY INFORMATION

Pathways and Controls of N 2 O Production in Nitritation Anammox Biomass

Supplementary information. Porphyrin-Assisted Docking of a Thermophage Portal Protein into Lipid Bilayers: Nanopore Engineering and Characterization.

Codon Distribution in Error-Detecting Circular Codes

GS Analysis of Microarray Data

The Trigram and other Fundamental Philosophies

Evolutionary dynamics of abundant stop codon readthrough in Anopheles and Drosophila

ChemiScreen CaS Calcium Sensor Receptor Stable Cell Line

Sex-Linked Inheritance in Macaque Monkeys: Implications for Effective Population Size and Dispersal to Sulawesi

The 3 Genomic Numbers Discovery: How Our Genome Single-Stranded DNA Sequence Is Self-Designed as a Numerical Whole

Administrative details:

Near-instant surface-selective fluorogenic protein quantification using sulfonated

part 3: analysis of natural selection pressure

AtTIL-P91V. AtTIL-P92V. AtTIL-P95V. AtTIL-P98V YFP-HPR

Modular scanning FCS quantifies receptor-ligand interactions in living multicellular organisms

Lecture 15: Programming Example: TASEP

Encoding of Amino Acids and Proteins from a Communications and Information Theoretic Perspective

Introduction to Molecular Phylogeny

Re- engineering cellular physiology by rewiring high- level global regulatory genes

Chain-like assembly of gold nanoparticles on artificial DNA templates via Click Chemistry

Supplementary Information

Using algebraic geometry for phylogenetic reconstruction

Supplemental Figure 1. Phenotype of ProRGA:RGAd17 plants under long day

Anti-Bunching from a Quantum Dot

LIST of SUPPLEMENTARY MATERIALS

part 4: phenomenological load and biological inference. phenomenological load review types of models. Gαβ = 8π Tαβ. Newton.

Lab 3-4 : Confocal Microscope Imaging of Single-Emitter Fluorescence and Hanbury-Brown and Twiss Set Up, Photon Antibunching

Supplemental Information. Inferring Cell-State Transition. Dynamics from Lineage Trees. and Endpoint Single-Cell Measurements

Insects act as vectors for a number of important diseases of

From DNA to protein, i.e. the central dogma

Supplementary Information

SPOTTED cdna MICROARRAYS

Co-localization, FRET

LAB 3: Confocal Microscope Imaging of single-emitter fluorescence. LAB 4: Hanbury Brown and Twiss setup. Photon antibunching. Roshita Ramkhalawon

Confocal Microscopy Imaging of Single Emitter Fluorescence and Hanbury Brown and Twiss Photon Antibunching Setup

Appendix B Protein-Signaling Networks from Single-cell Fluctuations and Information Theory Profiling B.1. Introduction

Nanoscale confinement of photon and electron

Dye Synthesis in the Pechmann Reaction: Catalytic Behaviour. of Samarium Oxide Nanoparticles Using Single Molecule. Fluorescence Microscopy

Supporting Information. An Electric Single-Molecule Hybridisation Detector for short DNA Fragments

Time-resolved Molecule Counting by Photon Statistics Across the Visible Spectrum

T H E J O U R N A L O F C E L L B I O L O G Y

FROM LOCALIZATION TO INTERACTION

Estimating Phred scores of Illumina base calls by logistic regression and sparse modeling

SUPPLEMENTARY INFORMATION

Supporting Information

Fuzzy Clustering of Gene Expression Data

DNA Barcoding Fishery Resources:

The photoluminescent graphene oxide serves as an acceptor rather. than a donor in the fluorescence resonance energy transfer pair of

Chem. 1C Final Practice Test 1

THE MATHEMATICAL STRUCTURE OF THE GENETIC CODE: A TOOL FOR INQUIRING ON THE ORIGIN OF LIFE

Super Resolution Microscopy Structured Illumination

FliZ Is a Posttranslational Activator of FlhD 4 C 2 -Dependent Flagellar Gene Expression

Supplemental Materials and Methods

types of codon models

Self-assembled Nanoscale DNA-porphyrin Complex for. Artificial Light-harvesting

Electronic Supplementary Information (ESI) for. biosensing platform through the coupling of nanometal surface

SUPPLEMENTARY INFORMATION

Transcription:

Nature Methods Single-cell systems biology by super-resolution imaging and combinatorial labeling Eric Lubeck & Long Cai Supplementary File Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Figure 6 Supplementary Figure 7 Supplementary Figure 8 Supplementary Figure 9 Supplementary Figure 1 Supplementary Figure 11 Supplementary Figure 12 Supplementary Figure 13 Supplementary Figure 14 Supplementary Figure 15 Supplementary Figure 16 Supplementary Figure 17 Supplementary Figure 18 Supplementary Figure 19 Supplementary Figure 2 Supplementary Figure 21 Supplementary Table 1 Supplementary Table 2 Supplementary Table 3 Supplementary Table 4 Supplementary Note Title Photobleaching and reconstruction with conventional fluorophores Gaussian fitting reconstructions of MDN1-GFP (14kb) mrna tagged with the barcode Cy5-A594-Cy3 Gaussian fitting reconstructions of MDN1-GFP (14kb) mrna tagged with the barcode A594-Cy5-Cy3 Gaussian fitting reconstructions of PUN1 (14kb) mrna tagged with the barcode A594-Cy5-Cy3 Median Photons per fluorophore STORM reconstructions of PUN1 (14kb) mrna Single cell STORM reconstructions of PMC1 3 position barcodes Cy5/A45-Cy5/Cy3-Cy5/A488 (Blue-Red-Green) Single cell STORM reconstructions of YPS1 3 position barcode with Cy3 paired with Cy5 (blue), A68 (purple) and A75 (pink) Reconstructions of 32 Spectrally barcoded mrnas in single cells Barcode crosstalk measurements Imaging Scheme Statistical analysis of barcode scramble experiment Distribution of expression levels for each Crz1 and Msn2 gene WT pairwise gene correlations Numeric reference for shaded WT correlations shown in Supplementary Figure 1 WT cell clustering with the aging genes included Heat maps of single cell gene expression levels under FK56 treatment Heat maps of single cell gene expression levels in Msn2 _ Msn4 _ deleted cells Msn2 _ Msn4 _ pairwise gene correlations FK56 pairwise gene correlations Barcodes density in the current 32gene multiplex Barcode Assignments for the 32 genes profiled Circularly permutated barcodes used in switched barcode experiment (Figure 3 and S5) Oligo probes for smfish qpcr Primers

Single cell systems biology by super resolution imaging and combinatorial labeling Eric Lubeck and Long Cai A. B. 35 9 Mean=8.2±1.1 probes Intensity (cts) 3 25 2 15 1 7 6 5 4 3 2 1 2 4 6 8 1 12 14 Frequency Binomial Distribution with p=.67 (8/12 probes bound) C Time (frames) Number of probes bound Cy5 A594 Cy3 Cy5 A594 Cy3 D

Supplementary Figure 1. Photobleaching and reconstruction with conventional fluorophores. (A) Sample photobleaching traces. CMK2 mrna was hybridized with twelve 27 mer probes labeled with Cy3. The sample was illuminated with a 532nm laser for 15 frames. No antibleaching buffer was used. Stepwise drops in fluorescence intensity correspond to photobleaching of single fluorophores. The intensities of fluorophores was not uniform, possibly due to micro environment and homo FRET quenching. On average each step corresponds to ~3 cts, with a background of ~9 cts. The initial intensities suggest, in both traces, 8 9 probes out of the 12 probes were bound to the mrna, corresponding to ~2/3 hybridization efficiency for each probe. (B) Distribution of hybridization efficiencies for the CMK2 probe set. The number of probes bound is determined from the initial intensities of dots observed prior to photobleaching divided by the average step size. The mean number of probes bound was 8.2 ± 1.1 probes. This distribution is overlayed with a binomial distribution with the probability of each probe bound at 67%, corresponding to 8 out 12 probes bound on average. (C) FIONA reconstructions of barcodes on PUN1 mrnas in a single cell in Fig1. 5 modified PUN1 probes were used. The intensity profiles of the dots in each channel are shown in the right panels, corresponding to Cy5, A594, and Cy3 channels. The reconstructions from Gaussian fitting of the intensity profiles are shown in the left. mrnas with intensities above thresholds in all three channels are selected in order to increase localization accuracy. (D) Spatial separation between terminal and center positions of the barcode. The distances between the A594 Cy5 and Cy3 Cy5 probe positions was both ~24bps, reflected in the symmetrical mean physical distances observed.

1 1 1 1 5 5 5 5-1 -5 5 1-1 -5 5 1-1 -5 5 1-1 -5 5 1-5 -5-5 -5-1 -1-1 -1 1 1 1 1 5 5 5 5-1 -5 5 1-1 -5 5 1-1 -5 5 1-1 -5 5 1-5 -5-5 -5-1 -1-1 -1 1 1 1 1 5 5 5 5-1 -5 5 1-1 -5 5 1-1 -5 5 1-1 -5 5 1-5 -5-5 -5-1 -1-1 -1 1 1 1 1 5 5 5-1 -5 5 1-1 -5 5-1 -5 5-1 -5 5 1-5 -5-5 -5-1 -1-1 -1 1 1 1 1 5 5 5 5-1 -5 5-1 -5 5-1 -5 5-1 -5 5 1-5 -5-5 -5-1 -1-1 -1 1 1 1 1 5 5 5 5-1 -5 5-1 -5 5-1 -5 5-1 -5 5 1-5 -5-5 -1-1 -1-1 Supplementary Figure 2. Gaussian fitting reconstructions of MDN1 GFP (14kb) mrna tagged with the barcode Cy5 A594 Cy3. Barcode represented as Red Green Blue. Axes are in nm. Reconstructions are taken from all of the dots from one image. The reconstruction rate is 92 ± 4.4%.

1 1 1 1 1 1 1 5 5 5 5 5 5 5-1 -5 1-1 -5 5 1-1 -5 1-5 -5-5 -1-1 -1 1 1 1 1-1 -5 5 1-1 -5 1-5 -5-1 -1 1 1-1 -5 5 1-1 -5-5 5 1-5 -1-1 1 1 5 5 5 5 5 5 5-1 -5-1 -5 5 15 1-1 -1-5 -5 5 51 1-5 -5-5 -5-1 -1-5 -5 5 5 1 1-5 -5-1 -1-5 -5 5 5 1-5 -5-1 -1-1 -1-1 -1-1 -1 1 1 1 1 5 1 5 1 5 1 5 5-1 -5 5 1-1 -5 5 1-1 -5 5 1-1 -5 5 1-5 -5-5 -5-1 5-5 5 1-1 -5 5 1-5 -5 5-1 -5 5 1-5 -1-1 -1-1 -1-1 -1 1 1 1 1 5 5 5 5-1 -5 5 1-5 -1-5 5-5 -1-5 5-5 -1-5 5 1-5 -1-1 -1-1 1 1 1 1 5 5 5 5-1 -5 5-1 -5 5-1 -5 5-1 -5 5 1-5 -5-5 -5-1 1-1 1-1 1-1 1 5 5 5 5-1 -5 5-1 -5 5-5 -1-5 5-5 -1-5 5 1-5 -1-1 -1-1 Supplementary Figure 3. Gaussian fitting reconstructions of MDN1 GFP (14kb) mrna tagged with the barcode A594 Cy5 Cy3. Barcode represented as Green Red Blue. Order switched from Supplementary Figure 2. Axes are in nm. Reconstructions are taken from all of the dots from one image. The reconstruction rate is 72 ± 7.5% of the time.

Supplementary Figure 4. Gaussian fitting reconstructions of PUN1 (14kb) mrna tagged with the barcode A594 Cy5 Cy3. Barcode represented as Green Red Blue Axes are in nm.

35 Median Photons Per Fluorophore 3 25 2 15 1 5 Cy5 Alexa 68 Alexa 75 Supplementary Figure 5. Median Photons per fluorophore. Error bars determined by the 1 replicates of the bootstrap standard deviation. In principle, Cy5, A68 and A75 should give a localization accuracy of 6.2, 11.3 and 15.1 nm. n = 197, 71 and 25 for Cy5, A68 and A75. In practice the localizaiton accuracy within a barcode cluster was significantly lower than this due to the additive error of aligning multiple fluorescent beads (SD ~ 5 15 nm). Localization accuracies within a single color position (4 probes) in a spatially labeled barcode as measured by SD were 23.5 ± 18.4 nm, 21.71 ± 15. nm and 21.5 ± 16 nm for cy5, A68 and A75. n=838, 552 and 13 barcodes respectively.

Supplementary Figure 6. STORM reconstructions of PUN1 (14kb) mrna. B. Each barcode color consists of an activator (Alexa 45, 488, and Cy3) labeled oligo adjacent to a 5 emitter (Cy5, A68 and A75) labeled oligo. Blue is A45 and Cy3, green is A488 and A68, red is Cy3 and A75. Green should be the center color. The axis for each figure goes from 15 nm to 15 nm in the X and Y dimensions.

15 1 5 15 1 5 nanometers -15-1 -5 5 1 15-5 -1-15 15 1 5-15 -1-5 5 1 15-5 -1-15 15 1 5-15 -1-5 5 1 15-5 -1-15 -15-1 -5 5 1 15-5 -1-15 nanometers Supplementary Figure 7. Single cell STORM reconstructions of PMC1 3 position barcodes Cy5/A45 Cy5/Cy3 Cy5/A488 (Blue Red Green). Axes are in nm.

1 5-1-5 5 1-5 -1 1 5-1-5 5 1-5 -1 1 5-1-5 5 1-5 -1 1 5-1-5 5 1-5 -1 1 5-1-5 5 1-5 -1 Supplementary Figure 8. Single cell STORM reconstructions of YPS1 3 position barcode with Cy3 paired with Cy5 (blue), A68 (purple) and A75 (pink). Barcode order should read Cy3/Cy5 Cy3/A68 Cy3/A75. Axes are in nm.

C 2 15 125 12 A45 Cy5 A488 Cy5 Cy3 Cy5 A45 Cy7 A488 Cy7 Cy3 Cy7 Cy3 Cy5.5 Pixels 1 115 5 11 5 1 15 2 15 11 115 12 125 13 Supplementary Figure 9. Reconstructions of 32 spectrally barcoded mrnas in single cells. Axes are in pixels, each corresponding to 13nm. The right panel shows a zoomed plot of a region in the cell. Individual mrnas are shown in boxes.

DA Total barcodes identified EB A45, A488, Cy3 Cy5 Cy3 Cy5,Cy5.5, Cy7 127 123 178 128 378 129 139 137 237 138 278 289 279 239 189 179 789 389 379 238 125 135 235 175 275 375 185 285 385 135 195 295 395 795 895 127 123 178 128 378 129 139 137 237 138 278 289 279 239 189 179 789 389 379 238 125 135 235 175 275 375 185 285 385 135 195 295 395 795 895 Total barcodes identified F C barcodes D G barcodes Supplementary Figure 1. Barcode crosstalk measurements. A 3 color barcode is hybridized and imaged. The leakage of that barcode into other barcodes is shown on the histogram, representing the errors in detection and analysis. A total of 2 cells are counted in each case. A) A barcode with Cy5 emitters and all 3 activators, hybridized against PUN1. B) The worst case scenario, with Cy3 activators and all emitters hybridized against YPS1 which is present at lower abundances than PUN1. Because Cy3 can be activated by 45 and 473nm lasers, there is more crosstalk into those channels. We observe that there is a relative low level but uniform background of barcodes observed due to autofluorescence in the cells and nonspecific blinking events. This background is additive to the barcode quantitation and does not scale with the copy number of the genes. C D. Single dye pair crosstalk ratios. 12 probe pairs are hybridized against PUN1 coupled with each combination of fluorophores. Then the false activation rate in different STORM channels are measured for Cy5 (C) and A75 (D) emitters. Crosstalk from Cy3 Cy5 into Cy3 A68 is 11.6% and negligible in the reverse direction.

Supplementary Figure 11. Imaging Scheme. For each activator we sequentially went through one cycle consisting of looping the pattern of imaging frames followed by blank frames 2 times. We followed this pattern by imaging just Cy5 for two blank frames every 5 frames until cy5 was completely exhausted after 3 additional frames.

Supplementary Figure 12. Statistical analysis of barcode scramble experiment. Two outliers are present with cooks distances greater than 1 that greatly skew the correlation. The first point was dropped for our regression as removing it placed point 4 back into a tight regression with the remaining data.

Supplementary Figure 13. Distribution of expression levels for each Crz1 and Msn2 gene. Expression levels are shown in log2 value Bean plots. For each gene, two distributions are shown. On the left are the single cell expression profiles in cell cluster 2: cells with only the combinatorial targets active. On the right are the distributions for that gene in cell cluster 1: cells with all Crz1 target genes on. Black lines indicate the mean values of the distribution. Blue lines mark the integer number of transcripts.

15 6 2 6 4 8 6 1 3 15 15 2 15 rcn2 uip2 15 doa1 8 hsp3 8 npt1 4 25 sit4 ylr414c 8 mep1 12 8 pgm2 cos1 6 sok2 8 yps1 15 6 ctt1 15 pmc1 cmk2 6 gyp7 4 put1 aro1 5 ylr194c 1 1 6 3 6 6 8 6 1 4 8 4 Supplementary Figure 14. WT pairwise gene correlations. Genes are organized in the same order as Fig 4. The gene name and a histogram of each genes copy # distribution is shown in the diagonal. The lower triangle displays the raw pairwise correlation data, while the darkness of the upper triangular quadrant corresponds to the correlation coefficient of each pair.

15 1 6 15 6 4 8 4 8 1 3 2 15 ylr194c.62 rcn2.61.64 uip2.61.63.6 doa1.54.45.46.55 hsp3 15 15 8 8.44.57.44.61.41 npt1.49.6.58.68.42.62 sit4 4 2.54.47.34.52.51.21.41 ylr414c.58.46.38.56.6.58.49.36 mep1 8 6.55.39.49.49.43.44.43.19.68 pgm2.44.4.38.54.41.58.4.23.68.65 cos1 1 6.33.47.44.5.22.51.54.2.53.43.6 sok2.44.32.27.2.89.35.34.89.43.58.34.39 yps1 8 6 15.62.5.43.51.4.3.42.45.59.58.46.37.58 ctt1.43.38.33.33.2.46.41.56.49.64.38.35.65.49 pmc1.39.27.41.29.76.46.29.11.43.58.6.58.68.52.63 cmk2 15.43.43.46.56.41.62.54.22.59.51.68.72.52.6.41.78 gyp7 6 3.34.25.26.36.43.36.32.91.69.62.59.43.46.45.45.54.59 put1.34.13.3.29.88.39.17.22.41.56.6.5.44.4.45.74.66.59 aro1 1 1 6 3 6 6 8 6 1 4 8 4 5 Supplementary Figure 15. Numeric reference for shaded WT correlations shown in Supplementary Figure 14.

Color Key 1 2 3 4 Value ylr194c rcn2 uip2 doa1 hsp3 npt1 sit4 ylr414c dpp1 esa1 pmc1 suc2 rck1 pck1 rad51 fth1 duh1 cmk2 gyp7 put1 aro1 cos1 cta1 fbp1 mep1 pgm2 sok2 yps1 ctt1 phr1 mls1 ino1 prb1 Supplementary Figure 16. WT cell clustering with the aging genes included. The same two clusters of pure and combinatorial Crz1 target genes are preserved. Aging and stress genes roughly fall into 2 separate clusters, apart from the Crz1 and Msn2 genes. Column numbers represent single cell

Color Key.5 1 1.5 2 2.5 3 Value ylr194c ylr414c pmc1 cmk2 rcn2 npt1 yps1 mep1 sok2 gyp7 put1 aro1 cos1 doa1 uip2 cta1 ctt1 pgm2 sit4 hsp3 dpp1 duh1 esa1 fbp1 mls1 prb1 fth1 pck1 rad51 ino1 phr1 rck1 Supplementary Figure 17. Heat maps of single cell gene expression levels under FK56 treatment. The cells are treated with 5mM CaCl 2 the combinatorial genes are plotted in the upper half of the figure. Cells are plotted in columns. Combinatorial targets are active while the pure Crz1 targets are inactive, indicating non Crz1 inputs can drive combinatorial target expression.

Color Key 1 2 3 4 Value ylr194c ylr414c pmc1 cmk2 rcn2 npt1 yps1 mep1 sok2 gyp7 put1 aro1 cos1 doa1 uip2 cta1 ctt1 pgm2 sit4 hsp3 dpp1 duh1 esa1 fbp1 mls1 prb1 fth1 pck1 rad51 ino1 phr1 rck1 Supplementary Figure 18. Heat maps of single cell gene expression levels in Msn2 _ Msn4 _ cells. The cells are treated with 5mM CaCl 2 the combinatorial genes are plotted in the upper half of the figure. Cells are plotted in columns. Most cells show coordinated expression among Crz1 and combinatorial target genes, suggesting Msn2/4 was the major factor in driving heterogeneous expression of combinatorial genes from the pure Crz1 genes.

3 3 3 6 3 6 3 2 6 15 6 8 rcn2 4 uip2 4 doa1 6 hsp3 4 npt1 5 sit4 4 ylr414c 6 mep1 6 pgm2 6 cos1 15 4 sok2 yps1 15 4 ctt1 25 pmc1 cmk2 8 gyp7 8 put1 aro1 1 3 4 8 4 6 6 1 1 6.. 3. ylr194c 2.5 Supplementary Figure 19. Msn2_ Msn4_ pairwise gene correlations. Genes are organized in the same order as Fig 4. The gene name and a histogram of each genes copy # distribution is shown in the diagonal. The lower triangle displays the raw pairwise correlation data, while the darkness of the upper triangular quadrant corresponds to the correlation coefficient of each pair. Note the overall smaller difference in correlations between clusters of genes compared to the WT plot.

. 2. 5 4. 2.. 3. 6 3 5 4 3 4 2 4 6. 2.5. 1.5 3 4. 1.5 ylr194c rcn2 uip2 doa1 hsp3 npt1 sit4 ylr414c mep1 pgm2 cos1 sok2 yps1 ctt1 pmc1 cmk2 gyp7 put1 aro1 2 4 6. 2.5 2 4. 1.5 4 8..8. 1.5. 2.5. 2.5 3 6. 3. 3. 2. 6. 1.. 2.. 3.. 3. Supplementary Figure 2. FK56 pairwise gene correlations. Genes are organized in the same order as Fig 4. The gene name and a histogram of each genes copy # distribution is shown in the diagonal. The lower triangle displays the raw pairwise correlation data, while the darkness of the upper triangular quadrant corresponds to the correlation coefficient of each pair. Note the overall low levels of expression.

Supplementary Figure 21. Barcodes density in the current 32 gene multiplex. A histogram of the number of barcodes found per 1um 2 region is shown. The overall distribution is approximately poissonian (sigma 2 / mean = 1.3), indicating a random configuration for the 32 profiled genes. On average, barcodes were relatively sparse at 1.9 barcodes per um 2. Nonetheless, certain regions had higher densities, necessitating the use of SRM barcoding. The low overall density of barcodes enables barcoding to be scaled to much higher numbers. Less than 2% of the cell was occupied by barcodes as determined from the average barcode size of (1 nm) 2 and the mean barcode density (this figure).

Crz1 Genes Aging and stress genes YLR414c 123 cta1 179 1 45 cy5 YLR194c 239 dpp1 125 2 488 Cy5 cmk2 789 duh1 795 3 Cy3 Cy5 pmc1 389 esa1 895 5 Cy3 Cy5 cos1 127 fbp1 157 7 45 Cy7 mep1 289 fth1 158 8 488 Cy7 npt1 189 ino1 159 9 Cy3 Cy7 put1 378 mls1 257 yps1 379 pck1 258 sok2 279 phr1 259 gyp7 278 prb1 785 aro1 178 rad51 358 doa1 128 rck1 359 rcn2 139 Msn2 genes ctt1 137 hsp3 238 pgm2 237 sit4 138 uip2 129 Supplementary Table 1. Barcode Assignments for the 32 genes profiled. Codes 135, 235, and 895 are left empty. In the barcode scramble experiments, the activators are permuted. 1 >2, 2 >3, 3 >1.

Gene Barcode pun1/ylr414c 123 YLR194c 137 cmk2 789 pmc1 179 cos1 238 mep1 379 npt1 279 put1 189 yps1 178 sok2 378 gyp7 389 ao1 289 doa1 239 rcn2 127 ctt1 128 hsp3 139 pgm2 138 sit4 129 uip2 237 cta1 278 Supplementary Table 2. Circularly permutated barcodes used in switched barcode experiment (Figure 3 and Supplementary Figure 12). Barcodes are permutated following the pattern: (45 >488, 488 >cy3, cy3 >45).

gatctcacgctacaccatagaatgaa ylr414c 1 catcaaaccctggtagttcctaccaa ylr414c 2 tatgctttaggatgtatttgatgtat ylr414c 3 actaatagggcggcaaaggcgaaaaa ylr414c 4 ccttatgtggatgatccagcgcaata ylr414c 5 caataccaataagaatggtaatgaac ylr414c 6 attttactttttagtttttcgggcaa ylr414c 7 cagagcctcattgttgttgatattgt ylr414c 8 ggataccgtgaggcgaagaacatgat ylr414c 9 tacgaccaaagccctatatttatata ylr414c 1 agaactcaaagaagggagcaccgtcg ylr414c 11 cacagtaaattttatttatgggactg ylr414c 12 acggacgctaccttaccgttgactg ylr194c 1 tgtagaacctgacgtagtggtataa ylr194c 2 ttgattccggttttgatgaggatcc ylr194c 3 tcagttgtggctgaggacggtagcc ylr194c 4 cgaattcgtggtagttactatagta ylr194c 5 aggaggatgcggagttggtgattcc ylr194c 6 gcagttgaagttgtgcttacggcag ylr194c 7 tgtcgtggttttgccttgtgcatcc ylr194c 8 cataggtgttgctgacgacgttgct ylr194c 9 acagttgatgcgctttcttgggctt ylr194c 1 gtttgagctttccttttgtgagcta ylr194c 11 agtctttttgagcagcggctagagt ylr194c 12 atgcagacttcaatttcatttgctc cmk2 1 tgcagacgtaaatcatccaacgaat cmk2 2 ggaattctcttctatatcgttatcg cmk2 3 acctcttaattctattattaagctt cmk2 4 cgcaaagaaaaccctttcttaacgt cmk2 5 tgaagtaatccatggatcgtccagc cmk2 6 tcaatctcaatgccttcaagatgaa cmk2 7 tatggcatatggaaggttaccgggt cmk2 8 ttcaacgctttcggcaataaaagga cmk2 9 caccaatggaccatatatcacaagg cmk2 1 ggtgccacataacccaacgatccgg cmk2 11 caattgtttagctataccgaagtcc cmk2 12 Supplementary Table 3. Oligo probes for smfish. 5 amine modified.

Cmk2 Cmk2 Pmc1 Pmc1 Ylr414c Ylr414c Ylr194c Ylr194c Npt1 Npt1 Gyp7 Gyp7 Put1 Put1 Yps1 Yps1 Actin Actin F TCG CCT CTG GTA ATT GCG GAC R TAA CCC AAC GAT CCG GCT GC F TTG TTG CGG TCA CTG GCG AT R AAG CCT CTC TGG CAA CCT CC F GCT ACG CTA TCT TCG TTG GGC R CTG GAT ACC GTG AGG CGA AGA F AGC AAC TCT GCC GTA AGC ACA R GTC GTT GAG GAG GAT GCG GA F GGG AGA TCC TGC CAC TGT GA R AGG TCC ATC TGT GCG CTT CG F ACG ATG GGA GGC TGA GGG TC R ACC CCA AAC TTT CCC TCG CA F GGCGATAAAACGGGCACTGA R AGGCGACAACCAAGTGACCAA F TTGACGGGAACGGGCAGTG R CCGAAGCAGGCACGGATTGA F ACG TTT CCA TCC AAG CCG T R GGA ACG ACG TGA GTA ACA CCA Supplementary Table 4. qpcr Primers

Supplementary Note Hybridization efficiency To determine the hybridization efficiency of the probes, we used photobleaching to measure the number of bound probes. Twelve 27mer probes targeting CMK2 were coupled to Cy3 and imaged with a 532 nm laser. Discrete photobleaching steps were observed corresponding to bleaching of single fluorophores (Supplementary Figure 1). The average step size was ~3 cts. Using this value as the average fluorophore intensity, we estimated the number of probes bound per mrna based on the dot intensities in the image before photobleaching. Some variations in intensity are likely due to unevenness in illumination and homo quenching effects of closely spaced fluorophores. We found that on average 8.1 probes are bound out of the total of 12 probes, suggesting a hybridization efficiency of 67.5 ± 9.1% (Supplementary Figure 1) per probe. The observed distribution is consistent with a binomial distribution with the probability of each probe binding at 67%. Less than perfect hybridization efficiency may be due to the tertiary structure of the mrna molecule and heterogeneities in bound ligands such as proteins on the mrna. We demonstrate a more robust spectral coding scheme in which single colored probes are distributed throughout the mrna. If occluding molecules are bound to a small region of mrna, they will only block a subset of the probes in every color, as opposed to removing a single color completely. This hybridization efficiency implies that mrnas tagged with 4 probes have a 99% chance of being detected with at least 1 probe bound. This is consistent with our observation that 96 ± 2 % (n=29) of molecules spatially overlapped in all three channels in the 3 color PUN1 probes. 3 color STORM spatial reconstructions. For the 3 color STORM PUN1 centroid reconstruction, we observed that 74 ± 8% (n=28) of codes reconstruct correctly. The photoswitching dye pairs improve background rejection, as both probes are required for the fluorophore to be re activated, therefore non specifically bound emitter probes in the cell cannot be reactivated. In comparison, directly labeling oligos with cyanine dye covalently linked pairs will have the same non specific background as standard FISH and have drastically increased blinking rate 1 due to the complex photophysical properties of the cyanine heterodimer. Indeed, we observed prior to inactivation, cells contained a hazy background of singly bound probes in addition to the hybridized FISH spots. After imaging for 4 5 frames, these non specifically bound molecules switched off and blinked at their respective non specific activation rate of cy5. Upon activation with 45,473 or 532nm lasers, these background probes did not reactivate. It is highly unlikely that probes with an activator would be bound close enough (<1 nm) to activate an emitter dye. The majority of spots that reactivated were specific mrna targets, although noise was observed from cellular autofluorescence and probe complexes. Some of this noise was due to x talk among specifically bound dyes. We observed x talk ratios of around 7% for the most egregious Cy5 dye pairs (Supplementary Figure 1). To ensure proper coding fidelity we only selected identified barcode colors that activated at least 3 standard deviations above the x talk ratios. It has been previously reported that 473nm laser can

activate cy3 cy5 pairs with 1 2% efficiency. We adjusted the 473nm laser power such that it is higher than the non specific blinking rate, but less than the power needed to consistently activate Cy3 Cy5 probe pairs. The cost of this background rejection of using probe pairs is reduced effective hybridization rate. As both probes are required for a functional dye pair, the effective hybridization efficiency is (67%) 2 =45%. Thus the probability of having at least 1 pair formed out of a redundant set of 4 probe pairs is 1 (.45) 4 =.9. With a 3 color barcode, the theoretical probability of having all three colors present is.9 3 =.72. We observed a 61±8% probability (5 out of 85 reconstructions) that 3 colors were present on a given mrna, and a 33±6% probability (28/85) of resolving only 2 colors. We observed no differences in hybridization efficiency between different mrnas, and the relative ratios between average expression level were recapitulated in our qpcr and smfish experiments (Figure 4a,b). This data suggests that our STORM results accurately capture the relative ratios of mrna expression, and can be much improved through increased probe redundancy. The effective hybridization efficiency can be improved by using more probe pairs. With 8 probe pairs per position, the 3 color spatial coincidence rate is increased to >95%. The long term solution is the development of super resolution fluorophores with improved contrast ratios. With reduced blinking, fluorophores can be directly labeled to oligos. As in the experiments, only 4 redundant probes are needed to co localize in 3 colors with 96% probability and 6 colors with 93% probability. Our use of physical compression allowed us to image most RNAs in a single focal plane. This simple physical treatment permitted us to forgo axial resolution of barcodes. Currently, 2 approaches are available to improve axial resolution. Some approaches, such as dumbbell shaped point spreadfunction 2, can improve axial resolution down to 5 nm. Such a resolution is sufficient to resolve overlapping molecules, but won't be high enough to resolve discrete barcode regions on a single RNA. Interferometric PALM 3 and dual objective astigmatic STORM 4 would allow us to reach axial resolutions below 2 nm. Such a high resolution would allow us to accurately capture the 3D structure of barcodes, dramatically improving the fidelity of spatial barcoding. Scaling up multiplexing capacity with spatial and spectral barcoding Spatial and spectral barcoding schemes have different strategies for scaling up their throughput. Spatial barcoding is efficient. In principle, five position barcodes allow 9 5 /2= 29525 genes to be tagged simultaneously in single cells. In practice, super resolution barcode readout accuracy and labeling density are constrained by the non specific blinking of the Cy5 dyes (i.e. contrast ratio), occurring at 1 in 2 frames per molecule 5. In addition, spatial barcoding requires mrnas to be stretched out to resolve the spatial sequence of colors. We experimented with different fixation conditions and methods to extend mrnas, but found compressing cells to be the best method for consistently stretching out transcripts. As thick sample are routinely squeezed to reduce optical sectioning for FISH imaging 6, spatial barcodes may be readily resolved in compact and compressible systems such as embryos. However, not all biological samples can be compressed, such as tissue samples or biofilms. Spectral coding provides an alternative labeling scheme suitable for such experiments. In this scheme, we note

that the multiplex capacity increases exponentially with the number of fluorophores available. In principle, cyanine dyes can be extended further into the infrared region to act as additional emitters. Recent works 7 suggest that 1 additional emitter is already available, allowing potentially close to a thousand ( 12 C 5 =792) genes to be multiplexed. Terminology used to describe STORM Imaging Throughout the paper we refer to three sources of STORM activation, specific, non specific and false. We have used this terminology as it provides a direct analogy to potential sources of error in our imaging routine. Specific activation refers to the desired activation of the intended dye by excitation of the activator dye. Non specific activation refers to excitation of the emitting dye due to absorption of the imaging light, often referred to as blinking. False activation refers to activation of the emitter due to absorption of the wrong wavelength by the activator dye. Crosstalk and accuracy of the barcode readout. The spectral coding approach is more robust because errors associated with identifying spatial positions can be avoided. However, crosstalk among different fluorophores can impede the identification of the proper barcode and result in leakage amongst the barcodes. To control for crosstalk, we performed several control experiments. First, we imaged individual dye pairs with the full imaging routine, going through all activators and emitters, to quantify the amount of leakage from each dye pair into the others. By examining all 7 dye pairs used in our study, we found the most leakage occurs from Cy3 activators, which can be activated by the 473 and 45 nm lasers. However, Alexa 488 and Alexa 45 cannot be activated with the 555 nm laser, so the crosstalk only appears in one direction. From the single dye pair experiments we quantified the idealized x talk with 12 of the target dye pairs, imaged in exactly the same routine as our barcode quantification. There is a small amount (~1%) of non specific activation in Alexa 45 and Alexa 488 with 556 nm activation, due to non specific blinking of the dye pair 6. The probe pairs that can be x talked to, A488 and Cy3, X talk at a higher rate than previously reported (6 6.5%) (Supplementary Figure 1). This may be due to the close proximity of the dyes to each other in our probe design. This x talk was still clearly separable from signal. For A68, we only used the cy3 A68 pair, thus no crosstalk between A68 dyes can occur. To reject the false activation of cy3 by the 473 nm laser, we discard activations in the 473 channel that are less than 3% of the activations observed in the 555 nm laser channel. Similarly, we set the threshold for rejection at 15% and 3% respectively for 45 nm activation of A488 and Cy3. In addition, there is crosstalk between the cy5 and A68 emitter channels. Since this crosstalk only occurs in the cy3 activation channel, we compare the activation intensity in cy3 cy5 vs cy3 A68 channels and found about 12% crosstalk between the 2 emitters. Thus, any activation in A68 that is less than 3% of the intensity in cy5 is rejected. All of these thresholds are more than 3 SDs from the measured cross talk values (Supplementary Figure 1). We confirmed that the tertiary structure of mrna did not result in any probe crosstalk. We observed no false activation from probe positions not directly proximal to the emitter probes, in agreement with the photoswitching distance of ~1 nm.

Second, to test the accuracy of the 3 color barcode readout, we used the barcode that is the most prone to crosstalk, which is the cy3 activator paired with all three emitters. This probe set against YPS1 is hybridized and the correct barcode is picked up, while several barcodes are also observed at a 2% crosstalk rate. However, this represents the worst case scenario for crosstalk, since Cy3 can be activated by both 45 and 473nm lasers. In addition, the gene targeted with this probe set is relatively low copy number, so false barcodes due to cellular background and nonspecific blinking appear at relatively higher frequency compared to the correct barcode (Supplementary Figure 1). A different 3 color barcode with 45, 488 and cy3 as activator and cy5 as the emitter, shows a much lower crosstalk ratio (Supplementary Figure 1). Most of the extraneous barcodes observed are due to background blinking in the cell and do not scale with the copy number of the genes probed. Thus, there is a constant background of barcodes that is additive but not multiplicative to the real barcodes. Third, when we analyzed data for the full dataset with 32 genes, we examined the frequency of observing the barcode position that was not coded. With a total of 35 possible coding positions in our current scheme, there were 3 empty code positions which should not show up. The mean false identification frequency was.67 ±.84 copies per cell, suggesting our entire barcode set imaged simultaneously is not significantly affected by false positives. In addition, we performed analysis on the full data set with a single gene barcode dropped out, and we observe that the empty position which is normally present at 4.9 ± 2.3 copies per cell is now present at.75 ±.84 copies per cell, indicating small amounts crosstalk into that position from other barcodes. Fourth, we took a 2 gene probe set containing cy5 and A75 emitters, and circularly permuted the activators (45 >488, 488 >cy3, cy3 >45). This effectively scrambled the barcode assignment since the emitters remained in the same position. We observed a strong correlation between genes measured amongst both probe sets, indicating no significant bias is introduced by a particular assignment of the barcode (Figure 3). One significant outlier existed in our analysis, YLR194C. This outlier was dropped based upon its high Cook s distance of 2.8226 (Supplementary Figure 1). A regression with an R 2 value of.88 was obtained following removal of the one outlier connoted in red. The other large outlier with a high copy number also has a high cook s distance of 3.5515. Despite its leverage, the point fits well on a regression where both of the aforementioned points are dropped, so it was retained in our analysis. Fifth, we performed single molecule FISH experiments measuring the expression of 11 genes, including 8 crz1, 1 Msn2 and 2 aging genes. We observed a R 2 of.95 between the mean levels measured by smfish and the barcode approach (Figure 4a). Sixth, we also performed q PCR experiments measuring the mean copy number of 8 crz1 target genes. We observed a correlation of.95 between the qpcr and the barcode data. The qpcr experiments were performed in triplicates and quantitated using 1x, 1x and 1x serial dilutions (Figure 4b). The PCR amplification efficiency for each gene was determined from linear fitting of serial dilutions. Spatial capacity of super resolution barcoding The size of mrnas that we reported is approximately 1 nm (Supplementary Figures 2 4 and 5 9). At this size, a typical cell of (1 μm)^3 can fit in about 1^6 of these (1nm)^3 volume elements, sufficient

to accommodate a significant fraction of the transcriptome simultaneously in the cell. In the reconstruction shown in Supplementary Figure 9 it is apparent that there is at least 2x more space left to accommodate additional barcodes. With the implementation of 3D storm, there will be 1x more room in the axial direction. In mammalian cells, the much larger available space, 2 5x larger than yeast, will compensate for the higher transcript levels (also 2 5 fold). These calculations do depend on the assumption that transcripts are homogenously distributed throughout the cell. In our observations, and in that of other authors using smfish in eukaryotes, a homogeneous spatial distribution of RNAs outside of the nucleus is usually observed (Supplementary Figure 21). If certain transcripts are found to cluster, they can be removed from the large dataset and analyzed separately. We imagine such a combination of techniques should cover the vast bulk of in situ transcriptional profiling experiments. In the case of the nucleus, we and other authors have found dense transcriptional sites to be rare in FISH experiments. In yeast, we found transcriptional sites to be in <5% of cells at any given time. Given the density of very highly expressed genes and the large size of the mammalian nucleus, we expect that most of these sites can still be identified and barcoded using our technology. In the cases where the nuclear density is too high to distinguish the transcripts of interest, we can still use the intensity ratio to infer the most likely barcode and assign its abundance to transcriptional active sites. In addition, a recent paper from the Tyagi group 8 showed that mrnas in neurons are packed singly into transport granules separated by at least 2nm, rather than compacted in dense granules as previously thought. While non uniform distribution of mrnas in cells could in principle pose a challenge to the barcode readout, few existing smfish experiments in eukaryotes suggest that the spatial distribution of transcripts will be a problem. In our current 32 gene multiplex experiment, we need super resolution imaging to spatially separate transcripts, as shown in Supplementary Figure 9. In this figure, the axis units are pixels, which on our setup correspond to 13nm. A diffraction limited spot would span 6 7 pixels end to end. One can see that the average RNA is confined within 1 pixel. Many mrnas reside within one diffraction limited region, making it impossible to resolve many neighboring barcodes without super resolution microscopy. Our single cell profiles cover a wide gamut of copy # s, demonstrating the wide dynamic range of SRM barcoding. Several of the 32 genes we profiled are highly expressed, on the level of major structural proteins. For example, CMK2 is expressed at 75 copies of proteins compared to 5 1k copies for tubulin, as measured using quantitative westers and GFP 9. Many other genes, such as PUN1 and YLR194c are expressed at similar levels (Supplementary Figure 13). The average mrna copy number might seem low because expression is bursty and heterogeneous among cells, but is often not low in individual cells. In our experiments CMK2, PUN1 and YLR194C were additionally induced by extracellular calcium, so we expected the protein copy # to be well above these reference measurements. The available space should be more than sufficient to accommodate ~1 genes at a time. We imagine the typical use case of single cell barcoding will follow up traditional high throughput techniques such as

RNA seq, so many uninteresting highly expressed housekeeping genes will not be probed in the barcoding experiment. By measuring highly multiplexed gene expression in situ with spatial information, our technique will make a significant contribution to systems biology not possible with existing technologies. Single Cell Profiling and Correlation We measured the copy number of probed genes by tabulating the barcode reconstructions in single cells (barcodes in Table S1). We did so for 62 cells. On average 2 3 cells were observed per field of view. Each set of STORM images took ~1 minutes to acquire; the imaging schematic is shown in Supplementary Figure 11. We manually found the positions of 1 15 cells and set up an automated stage to scan through the positions for STORM imaging. It takes approximately 5 6 hours to collect 6 cells. The field of view (FOV) was kept small to reduce auto fluorescent background from glass. In principle, quartz slides can decrease background and allow the FOV to expand, dramatically increasing throughput. Msn2 has a protein paralog, Msn4 that largely binds the same promoters and pulses synchronously with Msn2. Throughout the text, when we refer to Msn2 pulses, we are referring to the combined effect of both TFs Additional discussions of analysis protocol For this proof of principle we performed a simple analysis that gridded the data into a fixed width to initially find barcodes. After barcodes were found, the grid was removed and a local center of mass calculation was used to find the center of a barcode cluster. A fixed grid size of 184 nm was used for simplicity, since most barcodes fall within a 1 nm diameter. In the future, more intelligent clustering algorithms will be needed to identify barcode clusters. We note that this is a well studied problem in computational image analysis and a variety of tools are available to address this problem, but they are beyond the scope of the current paper. In our current analysis protocol, we do not exclude multiple activation events since they are infrequent in our movies and largely constitute emission from a single RNA. We are able to use more of the photons collected in the experiment to determine barcodes more accurately. However, for denser samples, a more stringent application of thresholding, or an application of the ideas in the photobleaching approach 1,11 and fluctuation imaging (SOFI) approach 12 can be implemented for more efficient reconstructions with minimum information loss. These approaches do not require single activations, but rather use intensity fluctuations for super resolution imaging. Incorporating them in our future analysis protocol will result in more efficient utilization of photons and better barcode reconstructions. Although these methods are not yet implemented, there is no fundamental limitation to incorporating them. Our current protocol was optimized to resolve a multiplex of 32 barcodes from each other, as demonstrated in Supplementary Figure 9. We anticipate this protocol will carry over for multiplexing <1 genes. We expect to incorporate the additional changes in the next iteration of barcoding when we go above 1 genes.

Sequences for probes used in the 32 gene multiplex are available upon request. References 1. Conley, N.R., Biteen, J.S. & Moerner, W. Cy3-Cy5 covalent heterodimers for single-molecule photoswitching. The Journal of Physical Chemistry B 112, 11878 1188 (28). 2. Lee, H.-lu D., Sahl, S.J., Lew, M.D. & Moerner, W.E. The double-helix microscope super-resolves extended biological structures by localizing single blinking molecules in three dimensions with nanoscale precision. Applied Physics Letters 1, 15371 (212). 3. Shtengel, G. et al. Interferometric fluorescent super-resolution microscopy resolves 3D cellular ultrastructure. Proceedings of the National Academy of Sciences of the United States of America 16, 3125-3 (29). 4. Xu, K., Babcock, H.P. & Zhuang, X. Dual-objective STORM reveals three-dimensional filament organization in the actin cytoskeleton. Nature Methods 9, 185-188 (212). 5. Bates, M., Huang, B., Dempsey, G.T. & Zhuang, X. Multicolor super-resolution imaging with photoswitchable fluorescent probes. Science 317, 1749-53 (27). 6. Raj, A., Rifkin, S.A., Andersen, E. & van Oudenaarden, A. Variability in gene expression underlies incomplete penetrance. Nature 463, 913-8 (21). 7. Dempsey, G., Vaughan, J., Chen, K. & Bates, M. Evaluation of fluorophores for optimal performance in localization-based super-resolution imaging. Nature Methods 8, 127-36 (211). 8. Batish, M., van den Bogaard, P., Kramer, F.R. & Tyagi, S. Neuronal mrnas travel singly into dendrites. Proceedings of the National Academy of Sciences of the United States of America 19, 4645-465 (212). 9. Huh, W.K. et al. Global analysis of protein localization in budding yeast. Nature 425, 686-91 (23). 1. Gordon, M.P. Single-molecule high-resolution imaging with photobleaching. Proceedings of the National Academy of Sciences 11, 6462-6465 (24). 11. Burnette, D.T., Sengupta, P., Dai, Y., Lippincott-Schwartz, J. & Kachar, B. Bleaching/blinking assisted localization microscopy for superresolution imaging using standard fluorescent molecules. Proceedings of the National Academy of Sciences of the United States of America 18, 2181-6 (211). 12. Dertinger, T., Colyer, R., Vogel, R., Enderlein, J. & Weiss, S. Achieving increased resolution and more pixels with Superresolution Optical Fluctuation Imaging (SOFI). Optics Express 18, 18875 (21).