Alanine Dehydrogenase (ald) Is Required for Normal Sporulation in Bacillus subtilis

JOURNAL OF BACrERIOLOGY, Nov. 1993, p. 6789-6796 0021-9193/93/216789-08$02.00/0 Copyright 1993, American Society for Microbiology Vol. 175, No. 21 Alanine Dehydrogenase (ald) Is Required for Normal Sporulation in Bacillus subtilis KATHRYN JAACKS SIRANOSIAN, KEITH IRETON, AND ALAN D. GROSSMAN* Department of Biology, Building 56-510, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 Received 16 June 1993/Accepted 17 August 1993 The ski22::tn917lac insertion mutation in Bacillus subtilis was isolated in a screen for mutations that cause a defect in sporulation but are suppressed by the presence or overexpression of the histidine protein kinase encoded by kina (spoiij). The ski22::tn9171ac insertion mutation was in ald, the gene encoding alanine dehydrogenase. Alanine dehydrogenase catalyzes the deamination of alanine to pyruvate and ammonia and is needed for growth when alanine is the sole carbon or nitrogen source. The sporulation defect caused by null mutations in ald was partly relieved by the addition of pyruvate at a high concentration, indicating that the normal role of alanine dehydrogenase in sporulation might be to generate pyruvate to provide an energy source for sporulation. The spovn::tn9l7 mutation was also found to be an allele of aid. Transcription of ald was induced very early during sporulation and by the addition of exogenous alanine during growth. Expression of ald was normal in all of the regulatory mutants tested, including spooa, spooh, spook, coma, sigb, and sigd mutants. The only gene in which mutations affected expression of ald was ald itself. This regulation is probably related to the metabolism of alanine. Cells of Bacillus subtilis can differentiate into dormant heat-resistant endospores under appropriate environmental conditions. Regulatory events during the initiation of sporulation lead to the formation of an asymmetric cell division septum, generating two distinct cell types. The smaller cell, or forespore, develops into the mature spore after being engulfed by the larger cell, the mother cell (reviewed in reference 10). Eventually, the mother cell lyses, releasing the mature heatresistant endospore. Dramatic changes in gene expression, physiology, and metabolism underlie the morphological changes associated with spore formation. A variety of regulatory circuits and genes required for sporulation have been characterized. In addition, many genes that are expressed during sporulation are not essential for development (10). While much work has focused on gene expression and regulation, relatively little is known about metabolism and the generation of energy for synthesis of new products required for the morphological development that occurs during sporulation. The tricarboxylic acid cycle seems to play a role in the generation of energy during sporulation, as mutants that are defective in tricarboxylic acid cycle enzymes are defective in sporulation (13, 18, 56). Protein turnover is known to increase during sporulation (30, 47) and probably plays a role in generating substrates (peptides and amino acids) for further metabolism and new macromolecular synthesis. Previously, we described the isolation and characterization of mutations that caused a defect in sporulation but could be partially suppressed by the presence or overproduction of the histidine protein kinase encoded by kina (19, 20, 37). These mutations were called ski (pronounced "sky," for suppressed by kinase) and include spook (37) and bofa (20, 36). KinA is one of the histidine protein kinases involved in regulating the initiation of sporulation. The C-terminal region of KinA is homologous to the conserved region of known histidine protein kinases (2, 33), and KinA has been shown to autophos- * Corresponding author. 6789 phorylate and lead to the phosphorylation of SpoOA in vitro (5, 33). SpoOA is a response regulator that is required for the initiation of sporulation (12, 22) and functions as both an activator and a repressor of transcription (42, 43, 49, 53). KinA and SpoOA are members of the large family of two-component regulatory systems involved in signal transduction in prokaryotes (reviewed in references 1, 32, and 48). In this paper we provide evidence indicating that metabolism of alanine is required for normal sporulation. We found that one of the ski::tn9j7lac insertion mutations (ski22:: Tn9171ac) was in ald, the gene encoding alanine dehydrogenase, and that null mutations in ald cause a defect in sporulation. Alanine dehydrogenase catalyzes the reversible conversion of alanine to pyruvate and ammonia and is required for B. subtilis to utilize alanine as a sole carbon or nitrogen source (4, 17). Alanine dehydrogenase from several different species of Bacillus has been purified and characterized (23, 29, 31, 35), and ald from Bacillus sphaericus and Bacillus stearothermophilus has been cloned and sequenced (23). Alanine dehydrogenase activity can be induced during growth in the presence of D- or L-alanine and a variety of other amino acids and is induced at the end of exponential growth (during sporulation) if it was not induced during growth (4, 15, 16, 26). We describe the isolation, characterization, and regulation of ald from B. subtilis. In addition, we found that spovn::tn917 (41) is an allele of ald. MATERUILS AND METHODS Strains. The B. subtilis strains used are listed in Table 1 and were all derived from strain 168. The ski22::tn9171ac insertion mutation was isolated as previously described for other ski mutations (20, 37). Standard Escherichia coli strains were used for cloning and maintaining plasmids as we described previously (20, 37). Plasmids and cloning. Plasmids are listed and described in Table 2, and some are illustrated in Fig. 1. We cloned DNA adjacent to the ski22::tn9171ac insertion by the methods described by Youngman et al. (54, 55). A strain containing the

6790 SIRANOSIAN ET AL. J. BAC-FERIOL. TABLE 1. Bacillus subtilis strains used Strain Genotype Comment(s), source, and/or reference" JH642 trpc2 pheai J. Hoch AG785 JH642 kina::tn9j7::ptv2l\2 37 K1220 (AG1294) JH642 ski22::tn9i71ac (a1d::tn9j71ac) KI228 JH642 ski22::tn9j 71ac amye::(psp,ac-kina +) Psp.c-kinA + from K195 (37) K1236 JH642 ski22::tn917iac kina::tn9i7::ptv21a2 KI568 JH642 ski22::tn9j7iac::ptv21a2 K1220 converted to Cmr MLSS with ptv21a2; used to clone DNA adjacent to the transposon KS297 spovn::tn917fqhu297 41 AG1157 JH642 amye::(ald-lacz cat) ald-lacz fusion from pdr50 crossed into the chromosome at amye AG1216 JH642 amye::(aid-1acz neo) AG1157 converted to Neor Cm' by using pik105 as previously described (20) AG1310 JH642 amye::(a1d-1acz neo) spovn::tn9i7 AG1216 transformed to MLSr with spovn::tn9i7 DNA " Cmr and Cm', chloramphenicol resistant and sensitive, respectively; MLS' and MLS', macrolide-lincosamide-streptogramin, resistant and-sensitive, respectively; Neo', neomycin resistant. ski22::tn9171ac insertion appeared blue on sporulation plates containing the chromogenic substrate X-Gal (5-bromo-4- chloro-3-indolyl-3-d-galactopyranoside), indicating that the transposon had inserted so that lacz was placed downstream from the promoter in the direction of transcription. Clones upstream and downstream of the ski22::tn9j171ac insertion were obtained with several restriction enzymes. Various DNA fragments from pdr40 (Hindlll clone) and pdr42 (PvuII clone) were subcloned (Fig. 1) and used for DNA sequencing, promoter mapping, and promoter fusion experiments. DNA upstream of the spovn::tn917 insertion (41) was cloned similarly to that for ski22::tn9171ac. Vectors used for subcloning included pgemcat (54), pbluescript II KS+ and SK+ (Stratagene), and pjh101 (11). pdg268 (2) was used to construct an ald-lacz fusion to be crossed into the chromosome at the amye locus. Media. LB medium (6) was used for routine maintenance and growth of E. coli and B. subtilis. DS medium (44) was used as the nutrient sporulation medium. Minimal medium contained the S7 minimal salts described by Vasantha and Freese (51), except that MOPS (morpholinepropanesulfonic acid) buffer was used at a concentration of 50 rather than 100 mm (21). Minimal medium was supplemented with 1% glucose and 0.1% glutamate. Required amino acids were added at 40 jig/ml. Media were solidified for plates with 15 g of agar (Difco Laboratories) per liter. Sporulation proficiency was visualized on DS or 2 x SG (24) plates. Ampicillin was used at 50 to 100,ug/ml, chloramphenicol was used at 5,ug/ml, and erythromycin and lincomycin were used at 0.5 and 12.5,ug/ml respectively. The combination of erythromycin and lincomycin was used to select for resistance to macrolide-lincosamide-streptogramin B antibiotics encoded by Tn917 and Tn9171ac. Spore assays. Cells were grown in nutrient sporulation medium at 37 C (unless otherwise indicated), and spores were assayed at least 12 h after the end of exponential growth. The number of spores per milliliter of culture was determined as the number of heat-resistant (80 C for 20 min) CFU on LB plates. Viable cells were measured as the total number of CFU under similar plating conditions. Transformations. E. coli cells were made competent and transformed by standard procedures (39). Cells of B. subtilis were made competent as described previously (37). I-Galactosidase assays. Cells were grown in either DS medium or S7 minimal medium supplemented with glucose, glutamate, and required amino acids essentially as described previously (21). For cultures grown in minimal medium, sporulation was initiated at an optical density at 600 nm of between 0.5 and 0.8 by the addition of decoyinine (U-7984; Upjohn Co.) to a final concentration of 1 mg/ml. Samples were taken at the indicated times for determination of,b-galactosidase specific activity. For cultures grown in DS medium, cells were removed by centrifugation and resuspended in Z buffer or Spizizen salts (46) for the enzyme assay. f-galactosidase specific activity is presented as (AA420 per minute per milliliter of culture per unit of optical density at 600 nm) x 1,000 (27). DNA sequencing. DNA sequencing was done with the Sequenase kit (U.S. Biochemical Corp.), using either doubleor single-stranded DNA and cx-35s-datp (Dupont, NEN Research Products). Sequencing reaction mixtures were electrophoresed on 6% polyacrylamide gels containing 8 M urea Plasmid TABLE 2. Plasmids used Comment(s) pdr40... Initial HindIll clone (upstream) from K1568 (ski22::tn9171ac::ptv21a2) pdr42... Initial PvuII clone (downstream) from K1568 (ski22::tn9171ac::ptv21a2) pdr49... HindIII-BamHI fragment from pdr40 (the BamHI site is in the end of Tn9171ac) subcloned into pjh101 (HindIII-BamHI) pdr50...hindiii-bamhi fragment from pdr40 (the BamHI site is in the end of Tn9171ac) subcloned into pdg268 (HindIII-BamHI) to generate amye::(a1d-1acz) pdr51... CiaI-PvuII fragment from pdr42 (the ClaI site is in the end of Tn917) cloned into pjh101 (ClaI-EcoRV) pks36... Made by deleting HindIII-EcoRV in pdr49 pks39... Made by deleting HindIII-SphI in pdr51; the SphI site is in the vector pks65... Made by deleting PvuII-SalI in pks36; the Sall site is in the vector pks72... SalI-PstI fragment from pdr51 subcloned into pbluescript II KS+ (SalI-PstI) pks74... Made by deleting SmaI-ClaI in pks65 pks89... SalI-BamHI fragment pks72 (essentially SalI-PstI from the ald region, as the BamHI site is in the multiple cloning site of the vector) subcloned into pjh101 (SalI-BamHI)

VOL. 175, 1993 ALANINE DEHYDROGENASE AND SPORULATION IN B. SUBTILIS 6791 RV Sma Pvu H +1 H) pdr40; pdr49; pdr50 pks65 pks36 pks74.spovn ski22 200 bp c IHald Sal BlHEPst Pvu._Ia ~ pdr42; pdr51 pks39 pks72; pks89 FIG. 1. Map and clones of the ald region. Locations of the ski22::tn9171ac and spovn::tn917 insertions are indicated by ski22 and spaovn, respectively. + I indicatcs the location of the 5' end of the ald mrna. Restriction sites are indicated as follows: H, HindIll; RV, EcoRV; Pvu, PvuII; Bgl, BglII; Sal, Sall; Pst, PstI. All of these sites that are between the EcoRV site and the Pstl site are indicated, and the map is drawn approximately to scale between EcoRV and PstI. according to standard procedures (39). Gels were fixed, dried, and exposed to Kodak X-OMAT AR film. DNA sequence analysis, manipulations, and comparisons were done by using the package of programs provided by the Genetics Computer Group, University of Wisconsin (8). The DNA sequence was determined from both strands, except for nucleotides 425 to 460, which were determined multiple times on only one strand. The DNA sequence upstream of the site of the spovn:: Tn917 insertion was determined by using primer KI-3 (5'- AGAGAGATGTCACCGTC-3'). This primer was made to correspond to a region -80 bp in from the left end of Tn917 and can be used to determine the sequence of cloned DNA adjacent to the left end of any Tn917 insertion, as previously described (20). Isolation of RNA and primer extension analysis. RNA was isolated from cells grown at 37 C in DS medium, minimal medium, minimal medium plus L-alanine, and minimal medium plus decoyinine (to induce sporulation). RNA was isolated from approximately 20 ml of cells (at the times indicated in Fig. 5), essentially as described previously (20). The oligonucleotide KS-2 (5'-AGCACCCGGTGGCCGTT TGAAATGAGCTGA-3') was used for primer extensions to map the 5' end of the ald transcript. This primer was made to correspond to a sequence internal to the ald coding region, complementary to nucleotides 205 to 234 in Fig. 2. The primer was end labeled with [-y-32p]atp (Dupont, NEN Research Products) and hybridized to 50 pg of RNA in each reaction. Extensions were performed with avian myeloblastosis virus reverse transcriptase MP (Life Sciences Inc.). All reactions were carried out essentially as described previously (3, 20). The extension products were electrophoresed next to DNA sequencing reactions done with tx-35s-datp and KS-2 as the primer. Nucleotide sequence accession number. The nucleotide sequence reported here has been assigned GenBank accession number L20916. RESULTS AND DISCUSSION Sporulation phenotypes caused by ski22::tn91 7lac and kina. The ski22::tn9171ac mutation caused a defect in sporulation that was partly suppressed by overexpression of KinA from a Ps,,.-kinA + fusion (Table 3). In contrast, the sporulation defect caused by the ski22 mutation was more severe in TABLE 3. Effects of ski22 and kiwia on sporulation" Strain Relevant genlotype IPTG" cl Sporulation JH642 Wild type - 91 K1220 ski22-1.6 AG785 kina - 13.6 K1236 ski22 kinia - 0.03 K1228 ski22 Psp.i-kinA+ - 4.7 + 24 Cells were grown in DS medium, anld sporulation was imieasured as described in Materials and Methods. Similar results were obtained when cells were grown in minimal medium containing glucose and glutamate aind sporulationi was induced with decoyinine. " IPTG (isopropyl-3-d-thiogalactopyranoside) was added to cells in mid- to late exponential phase to a concentration of I mm. combination with a loss-of-function mutation in kina (Table 3). Null mutations in kina cause a partial defect in sporulation (oligosporogenous), typically resulting in 1 to 30% of the wild-type level, depending on the particular strain background and precise sporulation conditions (2, 20, 33, 37, 41, 52). As described below, ski22 is an allele of ald, encoding alanine dehydrogenase. The mechanisms by which overexpression of kina suppresses mutations in ald and by which kina and ald mutations have greater-than-additive effects when combined (synergistic, or synthetic, phenotypes) are obscure. The sporulation experiments described above and in Table 3 were all done with cells grown in nutrient sporulation medium (DS medium). When cells were grown in minimal medium and sporulation was induced by the addition of decoyinine, the ski22::tn9i7iac mutation caused essentially the same phenotypes as in DS medium, including the decreased frequency of sporulation, the partial suppression by overexpression of KinA, and the synergistic effect when combined with a kina mutation (data not shown). DNA sequence and phenotypic characterization of ski22, an allele of ald. We cloned and sequenced DNA upstream and downstream of the site of the ski22::tn9i71ac transposon insertion by using plasmids and primers described in Materials and Methods and Fig. 1. The DNA sequence and predicted amino acid sequence of an open reading frame are shown in Fig. 2. The predicted amino acid sequence was found to be homologous to those of alanine dehydrogenases from B. sphaericus and B. stearothermophilus. The B. subtilis enzyme was 65 and 66% identical to the enzymes from B. sphaericus and B. stearothermophilus, respectively. Descriptions of the B. sphaericus and B. stearothermophilus enzymes, comparisons with other NAD(P)+-dependent dehydrogenases, and comparisons of putative active sites and cofactor-binding sites have been presented previously (23). While constructing strains carrying ski22 and various other mutations, we serendipitously found that ski22::tn9i71ac is approximately 10% linked to comp by transformation. The spovn::tn9j7 mutation (41) is also in this region and causes sporulation phenotypes similar to those caused by ski22::tn9l71ac. We therefore cloned and sequenced DNA adjacent to and upstream of the spovn::tn9i7 insertion. Approximately 200 nucleotides of sequence were determined, and this sequence matched a region of sequence in ald. The spovn::tn917 insertion was between bp 453 and 454, 134 bp upstream of the ski22::tn9171ac insertion (Fig. 1 and 2). Both the ski22::tn917iac and the spovn::tn9l7 mutations caused phenotypes expected of an ald mutant. Alanine dehydrogenase catalyzes the reversible deamination of alanine to pyruvate and is required for growth on alanine as a sole carbon

6792 SIRANOSIAN ET AL. J. BACFIERIOL. 1 GATATCAAACCTTCCGGCACATGGATTTGTGAAATTTCACAAATCCATGTTTTTTTATCTTAATCAAACAAAGAATTTTCCAAAATATCAAGCTACA 101 QJAAAAAT&TCACATATACAQQACQAGCAGATATGATCATAGGGGTTCCTAAAGAGATAAAAAACAATGAAAACCGTGTCGCATTAACACCCGGGGGCG M I I G V P K E I K N N E N R V A L T P G G V 2 01 TTTCTCAGCTCATTTCAAACGGCCACCGGGTGCTGGTTGAAACAGGCGCGGGCCTTGGAAGCGGATTTGAAAATGAAGCCTATGAGTCAGCAGGAGCGGA S Q L I S N G H R V L V E T G A G L G S G F E N E A Y E S A G A E 301 AATCATTGCTGATCCGAAGCAGGTCTGGGACGCCGAAATGGTCATGAAAGTAAAAGAACCGCTGCCGGAAGAATATGTTTATTTTCGCAAAGGACTTGTG I I A D P K Q V W D A E M V M K V K E P L P E E Y V Y F R K G L V 401 CTGTTTACGTACCTTCATTTAGCAGCTGAGCCTGAGCTTGCACAGGCCTTGAQGATAAAGGAGTAACTGCCATCGCATATGAAACGGTCAGTGAAGGCC L F T Y L H L A A E P E L A Q A L K D K G V T A I A Y E T V S E G R 501 GGACATTGCCTCTTCTGACGCCAATGTCAGAGGITGCGGGCAGAATGGCAGCGCAAATCGGCGCTCAATTCTTAGAAAAGCCTAAAQQCGGAAAAGGCAT T L P L L T P M S E V A G R M A A Q I G A Q F L E K P K G G K G I 601 TCTGCTTGCCGGGGTGCCTGGCGTTTCCCGCGGAAAAGTAACAATTATCGGAGGAGGCGTTGTCGGGACAAACGCGGCGAAAATGGCTGTCGGCCTCGGT L L A G V P G V S R G K V T I I G G G V V G T N A A K M A V G L G 701 GCAGATGTGACGATCATTGACTTAAACGCAGACCGCTTGCGCCAGCTTGATGACATCTTCGGCCATCAGATTAAAACGTTAATTTCTAATCCGGTCAATA A D V T I I D L N A D R L R Q L D D I F G H Q I K T L I S N P V N I 801 TTGCTGATGCTGTGGCGGAAGCGGATCTCCTCATGCGCGGTATTAATTCCGGGTGCTAAAGCTCCGACTCTTGTCACTGAGGAAATGGTAAAACAAAT A D A V A E A D L L I C A V L I P G A K A P T L V T EE M V K Q M 901 GAAACCCGGTTCAGTTATTGTTGATGTAGCGATCGACCAAGGCGGCATCGTCGAAACTGTCGACCATATCACAACACATGATCAGCCAACATATGAAAAA K P G S V I V D V A I D Q G G I V E T V D H I T T H D Q P T Y E K 1001 CACGGGGTTGTGCATTATGCTGTAGCGAACATGCCAGGCGCAGTCCCTCGTACATCAACAATCGCCCTGACTAACGTTACTGTTCCATACGCGCTGCAAA H G V V H Y A V A N M P G A V P R T S T I A L T N V T V P Y A L Q I 1101 TCGCGAACAAAGGGGCAGTAAAAGCGCTCGCAGACAATACGGCACTGAGAGCGGGTTTAAACACCGCAAACGGACACGTGACCTATGAAGCTGTAGCAAG A N K G A V K A L A D N T A L R A G L N T A N G H V T Y E A V A R 1201 AGATCTAGGCTATGAGTATGTTCCTGCCGAGAAAGC TTACAGGATGAATCATC7Y3TGGCGGGTGCTTAATTCACAATAAGCTaCAGQAAGA2IC2GC D L G Y E Y V P A E K A L Q D E S V A G A 1301 -AGGACTTTTTTATCTTTAAA FIG. 2. DNA sequence and predicted amino acid sequence of ald. The DNA sequence begins at the EcoRV site shown in Fig. 1. The 5' end of the mrna (nucleotide 109; indicated as +1 in Fig. 1) is outlined and underlined. The sequence upstream of +1 that resembles the - 10 region of promoters recognized by RNA polymerase containing sigma-a is underlined (nucleotides 97 to 102). The sequences in the - 35 region do not resemble the consensus for recognition by sigma-a and are not underlined. Bases in the putative ribosome-binding site (nucleotides 120 to 128) that are complementary to the 3' end of 16S rrna are underlined. The spovn::tn9j7 insertion is between nucleotides 453 and 454, and ski22::tn9171ac is between nucleotides 587 and 588; these positions are underlined. Both the upstream and downstream junctions of the ski22::tn9171ac insertion were sequenced. As expected, there was a precise 5-bp duplication at the junctions, indicating that there was no rearrangement associated with the transposon insertion. A possible stem-loop structure (beginning at nucleotide 1284) within a sequence resembling a "factor-independent" terminator is underlined. In addition, there is a large inverted repeat beginning at nucleotide 19, centered around nucleotides 34 and 35 and followed by a run of Ts. This might be a terminator for a possible upstream transcription unit. source (4, 17). Neither the ski22::tn917lac nor the spovn::tn9j7 mutant could use L-alanine as the sole carbon source, as judged by an inability to form colonies on minimal agar plates containing L-alanine. Isogenic wild-type strains (ski22+ and spovn+) formed colonies under identical conditions. The ald-i mutation present in strain QB936 (7, 17) is not known to cause a defect in sporulation. In our hands, the phenotype caused by this mutation appears to be leaky and is not as strong as that caused by the insertion mutations. ald-i caused a defect in the ability of cells to utilize L-alanine, but that defect was leaky as judged by the ability to form very small colonies on minimal agar plates containing L-alanine as the sole carbon source. In addition, ald-i caused a very small defect (if any) in sporulation. The stage at which sporulation is blocked in the spovn::tn9j7 mutant was determined by Sandman et al. (41). As indicated by the name, the block is relatively late, most likely at stage V. The mutant produces approximately normal levels of glucose dehydrogenase (a stage IV-to-V marker) but greatly decreased levels of dipicolinic acid (41). In addition, expression of cota is normal in the spovn mutant (40), consistent with a stage V block. The sporulation defect caused by the absence of alanine dehydrogenase could be due to a need for pyruvate to generate energy during development. Consistent with this possibility, we found that addition of pyruvate (2 to 3 mg/ml) during growth in DS medium stimulated sporulation of the ski22::tn9171ac mutant approximately 20-fold. The frequency of sporulation was not restored to wild-type levels but was approximately 20 to 30% of wild-type levels. Concentrations of pyruvate of less than I mg/ml had little or no effect. We did not detect any effect of added pyruvate (at any concentration tested, up to 10 mg/ml) on the ability of wild-type cells to sporulate. Integrational mapping of the ald transcription unit. It was possible that ald is in an operon, with other genes upstream and/or downstream. If there was another gene downstream from and cotranscribed with ald, then one or more of the phenotypes caused by the transposon insertions could be due to polarity on the downstream gene(s). We used integrational mapping (34) to determine the approximate endpoints of the transcription unit needed for Ald' and Spo+ phenotypes. In particular, we wanted to be sure that the sporulation defect caused by the two different transposon insertions was not due to polarity on a downstream gene. The sporulation defect was caused by a disruption of ald and was not due to polarity on a downstream gene. Integration of pks39, which contains a fragment of ald ending at the Hindlll site 29 bp upstream from the 3' end of the structural gene, caused Ald- and Spo- phenotypes. In marked contrast, integration of pks89, which extends only 35 bp past the end of the ald open reading frame, did not cause any detectable phenotype. If a downstream gene were cotranscribed with ald and did not have its own promoter, then integration of pks89 would have disrupted that transcription unit. These results indicate that both the Ald - and Spo - phenotypes were due to disruption of ald and not to polarity on a downstream gene. We also used integrational mapping to determine the approximate location of the 5' end of the ald transcription unit. Integration of pks74, which contains a DNA fragment that is internal to the ald structural gene, resulted in Ald - and Spo - phenotypes. Integration of pks36 and pks65, which extend to the EcoRV site 133 bp upstream of the presumed start codon, resulted in no detectable phenotype. These results indicate

VOL. 175, 1993 ALANINE DEHYDROGENASE AND SPORULATION IN B. SUBTILIS 6793 that the 5' end of the transcription unit is downstream of the EcoRV site (Fig. I and 2). Regulation of expression of ald. To measure regulation of ald, we constructed an ald-lacz transcriptional fusion (contained in pdr50) and recombined it into the B. subtilis chromosome (Tables I and 2; Fig. 1; see Materials and Methods). This lacz fusion was constructed in the vector pdg268 (2). The upstream end of the cloned fragment is the HindlIl site that is approximately 700 bp upstream of the EcoRV site (Fig. 1). The 5' end of the transcription unit and the regulatory sequences needed for expression of ald appear to be downstream of the EcoRV site as assessed by integrational mapping (see above). The downstream end of the cloned fragment is the BamHI site that is located in the left end of the transposon from ski22::tn9j 71ac. Thus, the 3' end of the fusion extended approximately 450 bp into the ald structural gene. The HindIII-to-BamHI fragment was cloned from pdr40 into pdg268 to give pdr50. The fusion was then recombined into the B. subtilis chromosome by double crossover at the nonessential amye locus [amye::(a1d-1acz)]. Expression of ald was induced by alanine. Addition of L-alanine to cells growing in minimal medium caused a rapid increase in expression of the amye::(ald-1acz) fusion as indicated by an increase in 3-galactosidase specific activity (Fig. 3A). Previous work had established that alanine dehydrogenase enzyme activity increases in cells upon the addition of D- or L-alanine or a variety of other amino acids (4, 15, 16, 26). Our results indicate that at least part of the regulation of ald is transcriptional. Expression of ald also increased during sporulation. When cells were grown in minimal medium and sporulation was induced by the addition of decoyinine, expression of the amye::(a1d-1acz) fusion increased (Fig. 3B). This induction during sporulation, and the induction by L-alanine during growth as measured with the amye::(a1d-1acz) fusion, occurred in all of the regulatory mutants tested, including spooa, spooh (sigh), spook, coma, sigb, and sigd mutants (data not shown). Expression of ald during growth and sporulation in rich medium was different from that in minimal medium. When cells were grown in nutrient sporulation medium (DS medium), expression from the amye::(a1d-1acz) fusion was high during growth and decreased during sporulation (Fig. 4A, triangles). Mutations in spooa and spooh had little or no effect on this regulation (data not shown). Primer extension experiments (see below) with RNA from wild-type cells grown in DS medium indicated that the level of ald mrna was high during growth and decreased during sporulation (data not shown), consistent with the more quantitative experiments with the amye::(a1d-1acz) fusion. The relatively high level of ald expression during growth in DS medium probably results from induction by alanine and other amino acids in the medium. Since alanine dehydrogenase is needed for sporulation (Table 3), it appears that in wild-type cells, enough enzyme is made during growth in nutrient sporulation medium and there is no further induction of transcription during sporulation. ald affects it own expression. The results obtained with the amye::(a1d-1acz) fusion in DS medium were different from those obtained with the ald-lacz fusion created by the ald::tn9171ac (ski22::tn9171ac) insertion mutation. Expression from the ald::tn9i7zac fusion increased during sporulation in DS medium (Fig. 4B), in contrast to the decreased expression observed with the amye::(a1d-1acz) fusion (Fig. 4A). One of the variables in these two experiments is whether the cells are Ald+ or Ald -. Cells containing the amye::(aid-1acz) fusion are Ald+, while those containing the ald::tn9171ac fusion are Ald -. U- U. a)# a1) CL4 Cl) 0.4-J U 60' 50' 40' 30-20 10 30-20' 10 A. B. +alanine -1 0 1 2 3-2 -1 0 1 2 3 4 Time FIG. 3. Expression of ald from an amye::(ald-lacz) transcriptional fusion. Strain AG1216 was grown in minimal medium, and samples were taken at various times for determination of 1-galactosidase specific activity as described in Materials and Methods. (A) Expression of an amye::(ald-iacz) fusion is induced during growth by addition of L-alanine. At time zero the culture was split, and L-alanine was added to one part to a concentration of 1 mm (triangles). Samples without alanine are shown for comparison (circles). (B) Expression of amye::(ald-1acz) is induced by decoyinine in minimal medium. At time zero the culture was split, and decoyinine was added to one part to induce sporulation (squares). Samples without decoyinine are shown for comparison (circles). The difference in the patterns of ald expression observed with the two different fusions was due to the ald allele. In an ald mutant, expression from the amye::(a1d-1acz) fusion increased during sporulation in DS medium (Fig. 4A). This pattern of expression was similar if not identical to that observed with the a1d::tn9171ac fusion (compare Fig. 4A and B) and is in marked contrast to expression in isogenic ald+ cells (Fig. 4A). In all ways tested, the amye::(a1d-1acz) fusion in the ald mutant was regulated the same as the a1d::tn9171ac fusion, including expression in DS medium and in minimal medium with decoyinine or L-alanine (data not shown). Primer extension mapping of the 5' end of the aid transcript. The 5' end of the ald mrna was mapped by primer extension analysis of RNA made from cells during sporulation

6794 SIRANOSIAN ET AL. J. BAC-FRIOL. 400 A. 1 2 G A T C 300-200 - 4-b 100 -._ -4-b cn1._- U v) cn a) l:1 200 100 0 B. 6 i 3. - Time FIG. 4. Mutations in ald affect expression of ald. Strains were grown in nutrient sporulation medium (DS medium), and samples were taken at various times during growth and sporulation for determination of f3-galactosidase specific activity. Time zero indicates the end of exponential growth and the initiation of sporulation. (A) Expression of amye::(a1d-1acz) in nutrient sporulation medium is controlled by ald. Results for strains AG1216 (ald+; triangles) and AG1310 (ald::tn9j7; circles) are shown. (B) Expression of the a1d::tn9171ac fusion (strain K1220). in minimal medium with decoyinine (Fig. 5) and is indicated in Fig. 1 and 2. The 5' end of the mrna was the same during growth in nutrient sporulation medium and upon induction with L-alanine (data not shown), indicating that the same promoter is probably used in all cases. Upstream of the 5' end are sequences that resemble the - 10 region of promoters recognized by RNA polymerase containing sigma-a. However, there is no obvious -35 sequence positioned appropriately. Despite the absence of a consensus -35 sequence, we expect that transcription will prove to be controlled by EUA because expression of ald was normal in spooh (sigma-h), sigb (sigma- B), and sigd (sigma-d) null mutants. Regulation and role of alanine dehydrogenase during sporulation. We speculate that the role of alanine dehydrogenase during sporulation is to generate pyruvate from alanine and that the pyruvate is used to generate energy by metabolism 2 0 FIG. 5. Primer extension analysis of the ald mrna. RNA was made from strain JH642 grown in minimal medium as described in Materials and Methods. Primer extensions were done with the oligonucleotide KS-2, which is complementary to nucleotides 205 to 234 in Fig. 2. Extension reactions were done with 50 p.g of RNA as described in Materials and Methods. Lanes G, A, T, and C refer to DNA sequencing reactions done with the same primer. Lane 1, RNA from cells h after the addition of decoyinine; lane 2, RNA from cells 2 h after the addition of decoyinine. We do not know the significance, if any, of the decreased amount of transcript at 2 h. The arrow indicates the position of the major transcript. The minor band below has a 5' end internal to the structural gene and is probably an extension artifact or a degradation product. through the tricarboxylic acid cycle. This notion is consistent with the partial rescue of the ald mutant by addition of exogenous pyruvate. Intracellular alanine is probably generated during sporulation through the turnover of proteins. It has long been known that bulk protein turnover increases during sporulation (30, 47, 51). In addition, turnover of specific proteins is known to increase during sporulation (25, 28, 38, 45). It seems likely that one role of the increased protein turnover is to generate free amino acids that can be metabolized to provide energy for continued macromolecular synthesis during development. It would not be surprising if a variety of enzymes involved in amino acid metabolism were found to play a role in sporulation. Expression of aid is induced very early during sporulation in minimal medium with decoyinine, yet expression does not depend on any of the known spoo loci. There are other genes required for sporulation and induced during sporulation independent of the spoo loci (9, 14, 50). citb is one of the better-studied examples. citb encodes aconitase of the tricarboxylic acid cycle and is required for normal sporulation, and its expression also increases during sporulation (9, 14, 50). Regulatory factors involved in expression of these genes have not been identified. We postulate that the unidentified regulatory factor(s) involved in expression of aid during sporulation might also be involved in expression during growth in the presence of alanine, since the transcription start sites are the same under these different conditions. It seems likely that the regulatory factor might respond to levels of alanine, or of a metabolite related to alanine, on the basis of the effect of mutations in ald on its own expression.

VOL. 175, 1993 ALANINE DEHYDROGENASE AND SPORULATION IN B. SUBTILIS 6795 ACKNOWLEDGMENTS We thank D. Rudner and E. Hoff for contributing to some of these experiments; J. LeDeaux for help with the DNA sequence analysis; members of our laboratory for helpful discussions, comments, and suggestions on the manuscript; and C. Price and A. L. Sonenshein for helpful discussions. Decoyinine was a gift from the Upjohn Company. K.I. was supported in part by an NIH predoctoral training grant. A.D.G. is a Lucille P. Markey Scholar in Biomedical Sciences, and this work was supported in part by a grant from the Lucille P. Markey Charitable Trust and by Public Health Services grant GM41934 to A.D.G. from the NIH. REFERENCES 1. Albright, L. M., E. Huala, and F. M. Ausubel. 1989. Prokaryotic signal transduction mediated by sensor and regulator protein pairs. Annu. Rev. Genet. 23:311-336. 2. Antoniewski, C., B. Savelli, and P. Stragier. 1990. The spoiij gene, which regulates early developmental steps in Bacillus subtilis, belongs to a class of environmentally responsive genes. J. Bacteriol. 172:86-93. 3. Ausubel, F., R. Brent, R. Kingston, D. Moore, J. Seidman, J. Smith, and K. Struhl. 1990. Current protocols in molecular biology. John Wiley & Sons, New York. 4. Berberich, R., M. Kaback, and E. Freese. 1968. D-Amino acids as inducers of L-alanine dehydrogenase in Bacillus subtilis. J. Biol. Chem. 243:10)0)6-1t1 1. 5. Burbulys, D., K. A. Trach, and J. A. Hoch. 1991. Initiation of sporulation in B. subtilis is controlled by a multicomponent phosphorelay. Cell 64:545-552. 6. Davis, R. W., D. Botstein, and J. R. Roth. 1980. Advanced bacterial genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 7. Dedonder, R. A., J. A. Lepesant, J. Lepesant-Kejzlarova, A. Billault, M. Steinmetz, and F. Kunst. 1977. Construction of a kit of reference strains for rapid genetic mapping in Bacillus subtilis 168. Appl. Environ. Microbiol. 33:989-993. 8. Devereux, J., P. Haeberli, and 0. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395. 9. Dingman, D. W., M. S. Rosenkrantz, and A. L. Sonenshein. 1987. Relationship between aconitase gene expression and sporulation in Bacilluts subtilis. J. Bacteriol. 169:30)68-3075. 10. Errington, J. 1993. Bacillus subtilis sporulation: regulation of gene expression and control of morphogenesis. Microbiol. Rev. 57:1-33. 11. Ferrari, F. A., A. Nguyen, D. Lang, and J. A. Hoch. 1983. Construction and properties of an integrable plasmid for Bacillus subtilis. J. Bacteriol. 154:1513-1515. 12. Ferrari, F. A., K. Trach, D. LeCoq, J. Spence, E. Ferrari, and J. A. Hoch. 1985. Characterization of the spo(a locus and its deduced product. Proc. Natl. Acad. Sci. USA 82:2647-2651. 13. Fortnagel, P., and E. Freese. 1968. Analysis of sporulation mutants: mutants blocked in the citric acid cycle. J. Bacteriol. 95:1431-1438. 14. Fouet, A., and A. L. Sonenshein. 1990). Target for carbon sourcedependent negative regulation of the citb promoter of Bacillu.s subtilis. J. Bacteriol. 172:835-844. 15. Freese, E., and Y. Fujita. 1976. Control of enzyme synthesis during growth and sporulation, p. 164-184. In D. Schlessinger (ed.), Microbiology-1976. American Society for Microbiology, Washington, D.C. 16. Freese, E., and J. Oosterwyk. 1963. The induction of alanine dehydrogenase. Biochemistry 2:1212-1216. 17. Freese, E., S. W. Park, and M. Cashel. 1964. The developmental significance of alanine dehydrogenase in Bacillius subtilis. Proc. Natl. Acad. Sci. USA 51:1164-1172. 18. Freese, E. B., N. Vasantha, and E. Freese. 1979. Induction of sporulation in developmental mutants of Bacillus subtilis. Mol. Gen. Genet. 170:67-74. 19. Grossman, A. D., K. Ireton, E. F. Hoff, J. R. LeDeaux, D. Z. Rudner, R. Magnuson, and K. A. Hicks. 1991. Signal transduction and the initiation of sporulation in Bacillus subtilis. Semin. Dev. Biol. 2:31-36. 20. Ireton, K., and A. D. Grossman. 1992. Interactions among mutations that cause altered timing of gene expression during sporulation in Bacillus subtilis. J. Bacteriol. 174:3185-3195. 21. Jaacks, K. J., J. Healy, R. Losick, and A. D. Grossman. 1989. Identification and characterization of genes controlled by the sporulation regulatory gene spooh in Bacillus subtilis. J. Bacteriol. 171:4121-4129. 22. Kudoh, J., R. Ikeuchi, and K. Kurahashi. 1985. Nucleotide sequences of the sporulation gene spooa and its mutant genes of Bacillus subtilis. Proc. Natl. Acad. Sci. USA 82:2665-2668. 23. Kuroda, S., K. Tanizawa, Y. Sakamoto, H. Tanaka, and K. Soda. 199t). Alanine dehydrogenases from two Bacilluis species with distinct thermostabilities: molecular cloning, DNA and protein sequence determination, and structural comparison with other NAD(P)+-dependent dehydrogenases. Biochemistry 29:1009-1015. 24. Leighton, T. J., and R. H. Doi. 1971. The stability of messenger ribonucleic acid during sporulation in Bacilllus sulbtilis. J. Biol. Chem. 252:268-272. 25. Maurizi, M. R., J. S. Brabson, and R. L. Switzer. 1978. Immunochemical studies of the inactivation of aspartate transcarbamylase by stationary-phase Bacillus subtilis cells. Evidence of selective energy-dependent degradation. J. Biol. Chem. 253:5585-5593. 26. McCowen, S. M., and P. V. Phibbs, Jr. 1974. Regulation of alanine dehydrogenase in Bacillus licheniformis. J. Bacteriol. 118:590)-597. 27. Miller, J. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 28. Neway, J. O., and R. L. Switzer. 1983. Degradation of ornithine transcarbamylase in sporulating Bacilluls slubtilis cells. J. Bacteriol. 155:522-530. 29. Nitta, Y., Y. Yasuda, K. Tochikubo, and Y. Hachisuka. 1974. L-Amino acid dehydrogenases in Bacillius slubtilis spores. J. Bacteriol. 117:588-592. 30. O'Hara, M. B., and J. H. Hageman. 199t). Energy and calcium ion dependence of proteolysis during sporulation of Bacilluts slibtilis cells. J. Bacteriol. 172:4161-4170. 31. Ohashima, T., and K. Soda. 1979. Purification and properties of alanine dehydrogenasce from Bacillus sphaericus. Eur. J. Biochem. 100:29-39. 32. Parkinson, J. S., and E. C. Kofoid. 1992. Communication modules in bacterial signaling proteins. Annu. Rev. Genet. 26:71-112. 33. Perego, M., S. P. Cole, D. Burbulys, K. Trach, and J. A. Hoch. 1989. Characterization of the gene for a protein kinase which phosphorylates the sporulation-regulatory proteins SpoOA and SpoOF of Bacilllus slibtilis. J. Bacteriol. 171:6187-6196. 34. Piggot, P. J., C. A. Curtis, and H. DeLancastre. 1984. Use of integrational plasmid vectors to demonstrate the polycistronic nature of a transcription unit (spoiia) required for sporulation. J. Gen. Microbiol. 130:2123-2126. 35. Porumb, H., D. Vancea, L. Muresan, E. Presecan, I. Lascu, I. Pertescu, T. Porumb, R. Pop, and 0. Barzu. 1987. Structural and catalytic properties of L-alanine dehydrogenase from Bacillus cerceus. J. Biol. Chem. 262:4610-4615. 36. Ricca, E., S. Cutting, and R. Losick. 1992. Characterization of bofa, a gene involved in intercompartmental regulation of prosigma-k processing during sporulation in Bacillus suibtilis. J. Bacteriol. 174:3177-3184. 37. Rudner, D. Z., J. R. LeDeaux, K. Ireton, and A. D. Grossman. 1991. The spook locus of Bacilllus slubtilis is homologous to the oligopeptide permease locus and is required for sporulation and competence. J. Bacteriol. 173:1388-1398. 38. Ruppen, M. E., and R. L. Switzer. 1983. Degradation of Bacillus subtilis glutamine phosphoribosylpyrophosphate amidotransferase in vivo. J. Biol. Chem. 258:2843-2851. 39. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 40. Sandman, K., L. Kroos, S. Cutting, P. Youngman, and R. Losick. 1988. Identification of the promoter for a spore coat protein gene in Bacillus stubtilis and studies on the regulation of its induction at a late stage of sporulation. J. Mol. Biol. 200:461-473. 41. Sandman, K., R. Losick, and P. Youngman. 1987. Genetic analysis of Bacillus subtilis spal mutations generatcd by Tn917-mediated insertional mutagenesis. Genetics 117:603-617.

6796 SIRANOSIAN ET AL. 42. Satola, S., P. A. Kirchman, and C. P. Moran, Jr. 1991. SpoOA binds to a promoter used by sigma-a RNA polymerase during sporulation in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 88: 4533-4537. 43. Satola, S. W., J. M. Baldus, and C. P. Moran, Jr. 1992. Binding of SpoOA stimulates spoiig promoter activity in Bacillus subtilis. J. Bacteriol. 174:1448-1453. 44. Schaeffer, P., J. Millet, and J. Aubert. 1965. Catabolite repression of bacterial sporulation. Proc. Natl. Acad. Sci. USA 54:704-711. 45. Solomon, J., and A. D. Grossman. 1993. Unpublished results. 46. Spizizen, J. 1958. Transformation of biochemically deficient strains of Bacillus subtilis by deoxyribonucleate. Proc. Natl. Acad. Sci. USA 44:1072-1078. 47. Spudich, J. A., and A. Kornberg. 1968. Biochemical studies of bacterial sporulation and germination: protein turnover during sporulation of Bacillus subtilis. J. Biol. Chem. 243:4600-4605. 48. Stock, J. B., A. J. Ninfa, and A. M. Stock. 1989. Protein phosphorylation and regulation of adaptive responses in bacteria. Microbiol. Rev. 53:450-490. 49. Strauch, M. A., V. Webb, G. Spiegelman, and J. A. Hoch. 1990. The SpoOA protein of Bacillus subtilis is a repressor of the abrb gene. Proc. Natl. Acad. Sci. USA 87:1801-1805. 50. Uratani-Wong, B., J. M. Lopez, and E. Freese. 1981. Induction of citric acid cycle enzymes during initiation of sporulation by guanine nucleotide deprivation. J. Bacteriol. 146:337-344. J. BAC-TERIOL. 51. Vasantha, N., and E. Freese. 1980. Enzyme changes during Bacillus subtilis sporulation caused by deprivation of guanine nucleotides. J. Bacteriol. 144:1119-1125. 52. Weinrauch, Y., R. Penchev, E. Dubnau, I. Smith, and D. Dubnau. 1990. A Bacillus subtilis regulatory gene product for genetic competence and sporulation resembles sensor protein members of the bacterial two-component signal-transduction systems. Genes Dev. 4:860-872. 53. York, K., T. J. Kenney, S. Satola, C. P. Moran, Jr., H. Poth, and P. Youngman. 1992. SpoOA controls the sigma-a-dependent activation of Bacillus subtilis sporulation-specific transcription unit spolie. J. Bacteriol. 174:2648-2658. 54. Youngman, P., H. Poth, B. Green, K. York, G. Olmedo, and K. Smith. 1989. Methods for genetic manipulation, cloning, and functional analysis of sporulation genes in Bacillus subtilis, p. 65-87. In I. Smith, R. Slepecky, and P. Setlow (ed.), Regulation of procaryotic development. American Society for Microbiology, Washington, D.C. 55. Youngman, P. J., J. B. Perkins, and R. Losick. 1984. A novel method for rapid cloning in Escherichia coli of Bacillus subtilis chromosomal DNA adjacent to Tn917 insertions. Mol. Gen. Genet. 195:424-433. 56. Yousten, A. A., and R. S. Hanson. 1972. Sporulation of tricarboxylic acid cycle mutants of Bacillus subtilis. J. Bacteriol. 109:886-894. Downloaded from http://jb.asm.org/ on March 27, 2019 by guest