1 2 Title: A novel mechanism of protein thermostability: a unique N-terminal domain confers heat resistance to Fe/Mn-SODs 3 4 Running Title: Thermostability-improving peptide for SODs 5 6 7 8 Authors Wei Wang a,c,1,#, Ting Ma a,d,1, Baoliang Zhang a, Nana Yao a, Mingchang Li a, Lianlei Cui a, Guoqiang Li a,d, Zhenping Ma b, Jiansong Cheng b,# 9 10 11 12 13 14 15 16 17 18 Affiliations a Key Laboratory of Molecular Microbiology and Technology, Ministry of Education, TEDA Institute of Biological Sciences and Biotechnology, Nankai University, 23 Hongda Street, TEDA, Tianjin 300457, PR China b State Key Laboratory of Medicinal Chemical Biology and College of Pharmacy, Nankai University, Tianjin 300071, PR China c Tianjin Key Laboratory of Microbial Functional Genomics, TEDA, Tianjin 300457, PR China d College of Life Sciences, Nankai University, Tianjin 300071, PR China 19 20 21 22 # Correspondence and requests for materials should be addressed to W.W. (nkweiwang@nankai.edu.cn), or J.C. (jiansongcheng@nankai.edu.cn) 1 W.W. and T.M. contributed equally to this work. 1
23 Supplementary Figures and Tables 24 25 26 Figure S1. Alignment of N-terminal fragments of SOD NG2215 -like proteins from 13 Geobacillus strains. 2
27 28 29 30 31 32 33 34 35 36 37 38 Figure S2. Phylogenetic neighbor-joining tree of identified thermophilic Mn-, Fe- or Mn/Fe- SODs derived from various microorganisms. Three putative SODs from G. thermodenitrificans NG80-2 were included in the dataset, among which the distantly related Cu/Zn-SOD from NG80-2 was used as an outgroup. Sequences are labeled with species, ion preference and the protein size. Accession numbers for SODs used in this analysis are: WP_010865944.1, AAD34161.1, ADM87596.1, AAP41921.1, P00449.2, YP_003670819.1, NP_275303.1, NP_558493.1, ABB88856.1, Q08713.3, NP_341862.1, ABO09802.1, NP_682309.1, AGI52413.1, AAS80537.1, CAJ58491.1, YP_001126309, YP_001126490.1, YP_001126974.1. 3
39 40 41 42 43 44 45 46 47 Figure S3. Thermostability of metal-reconstituted SOD NG2215 (a) and SODA NG2215 (b). The enzymes of Mn 2+ or Fe 2+ reconstituted SOD NG2215 and SODA NG2215 were respectively pre-incubated at 70 C, and aliquots were withdrawn every 10 minutes to test the residual activities at optimum temperature and ph by using the standard assay described in the Methods section. The activity of non-heated SOD was defined as 100%. Each point represents the mean (n = 3) ± standard deviation. 48 4
49 50 51 52 Figure S4. Temperature dependant CD spectra of SOD NG2215 (a) and SOD r (b). 5
53 54 55 56 Figure S5. The 3D plots of SOD NG2215 (a), SODA NG2215 (b), SOD BSn5 (c), SODA BSn5 (d) and SOD r (e). These plots were derived from the Equilibrium Model and generated by using A Matlab version of Equation 7 1. 57 6
58 Table S1. Primers used for construction of five recombinant clones in this study. 59 Gene Forward primer/reverse primer (5'-3') Length of PCR fragment (bp) sod NG2215 GGAATTCCATATGGACGACCAAACGTTGTTTGC 1350 CCCAAGCTTTTAAAATGGTTGCCAACGCA soda NG2215 GGAATTCCATATG CCTGGCAAGCATGTGCTGCC 618 CCCAAGCTT TTAAAATGGTTGCCAACGCA sod BSn5 GGAATTCATGAAACGTGAATCTTATCAAACG 846 CCGCTCGAGTTAATAGAGCTTCCAAACGACTTC soda BSn5 GGAATTCCATATG AAACACGTGCTGCCAAAGCT 612 CGCGGATCCTTAATAGAGCTTCCAAACGACTTC sod_n-gtng_2215 GGAATTCCATATGGACGACCAAACGTTGTTTGC 732 GCACATGTTTCGAAACCGCC sod_c-bsn5 GGCGGTTTCGAAACATGTGC 612 CGCGGATCCTTAATAGAGTTTCCAAACGACTTC sod r GGAATTCCATATG GACGACCAAACGTTGTTTGC 1344 CGCGGATCCTTAATAGAGcTTCCAAACGACTTC 60 7
61 62 63 64 65 66 67 Table S2. Metal contents and activities of native, apo, and metal-reconstituted SODs. Proteins Fe atoms per monomer Mn atoms per monomer Activity b (U/mg) a Native SOD NG2215 0.55 ± 0.03 0.10 ± 0.01 824.4 ± 10.9 Apo- SOD NG2215 0 0 0 Fe-reconstituted SOD NG2215 0.73 ± 0.02-769.1 ± 17.2 Mn-reconstituted SOD NG2215-0.81 ± 0.03 1158.4 ± 29.3 a Native SODA NG2215 0.32 ± 0.02 0.06 ± 0.01 680.2 ± 13.5 Apo- SODA NG2215 0 0 0 Fe-reconstituted SODA NG2215 0.40 ± 0.02-625.0 ± 19.2 Mn-reconstituted SODA NG2215-0.61 ± 0.03 933.3 ± 25.5 a The purified protein expressed in the normal E. coli system without metal enrichment and metal reconstitution process, was used as a control. b SOD activity was measured at 25 C by using the standard assay described in the Methods section. The values are given as means (n = 3) ± standard deviation. 8
68 69 Table S3. Thermodynamic parameters of purified SOD NG2215, SODA NG2215, SOD Bsn5, SODA Bsn5 and SOD r at different temperatures. Enzymes T ( ) a k d 10-3 (min -1 ) b D (min) c t 1/2 (min) d E d (kjmol -1 ) 70 71 72 73 74 75 20 0.77 2978.76 896.70 59.84 30 1.00 2302.59 693.15 40 0.90 2558.43 770.16 SOD NG2215 50 3.10 742.77 223.60 60 6.50 354.24 106.64 70 6.40 359.78 108.30 80 14.5 158.80 47.80 20 0.8 2878.23 866.43 28.46 30 2.5 921.03 277.26 40 16.2 142.13 42.79 SODA NG2215 50 24.9 92.47 27.84 60 48.2 47.77 14.38 70 37.1 62.06 18.68 80 331 6.95 2.09 20 0.36 6343.21 1909.50 47.27 30 1.8 1279.21 385.08 40 8.2 280.80 84.53 SOD BSn5 50 21.4 107.60 32.39 60 47.8 48.17 14.50 70 78.6 29.29 8.82 80 - - - 20 1.4 1644.70 495.11 50.35 30 9.3 247.59 74.53 40 17.6 130.83 39.38 SODA BSn5 50 47.2 48.78 14.69 60 155 14.83 4.46 70 - - - 80 - - - 20 0.5 4605.17 1386.29 66.31 30 1.6 1439.12 433.22 40 2.7 852.81 256.72 SOD r 50 4.2 548.23 165.04 60 8.9 258.72 77.88 70 25.3 91.01 27.40 80 33.2 69.35 20.88 a k d is the deactivation rate constant (1/min) 2. b Decimal reduction time (D) is defined by Belitz and Gosch 3, as determination of the holding time required to reduce the enzyme activity by one power of ten. c t 1/2 is the half-life time. d Ed is the deactivation energy required to inactive the enzyme during thermal inactivation process 4. 9
76 Table S4. Effects of inhibitors, detergents and denaturants on SOD activity. Inhibitors, detergents, and Relative activity (%) concentration denaturants SOD NG2215 SODA NG2215 SOD Bsn5 SODA Bsn5 SOD r control - 100.0 ± 1.2 100.0 ± 4.8 100.0 ± 2.2 100.0 ± 0.4 100.0 ± 7.3 EDTA 1mM 58.7 ± 0.0 48.4 ± 4.4 35.0 ± 4.2 30.4 ± 3.3 48.0 ± 5.7 10mM 53.7 ± 5.9 27.4 ± 5.0 29.8 ± 2.4 28.1 ± 1.6 31.6 ± 2.8 β-me 1mM 80.0 ± 8.4 47.6 ± 8.4 58.4 ± 2.0 53.7 ± 5.6 67.0 ± 9.0 10mM 69.3 ± 3.0 45.8 ± 6.7 42.0 ± 4.5 51.0 ± 5.5 69.5 ± 6.0 SDS 0.1% 63.2 ± 1.4 37.3 ± 2.6 30.6 ± 8.8 27.4 ± 4.4 62.9 ± 8.9 1% 45.8 ± 0.8 NA a NA NA 50.8 ± 6.2 Urea 2.5M 93.3 ± 2.7 60.4 ± 3.5 44.6 ± 8.9 45.7 ± 6.5 71.6 ± 6.6 Guanidine hydrochloride 2.5M 86.5 ± 1.5 43.0 ± 9.5 57.1 ± 2.9 64.3 ± 5.8 90.5 ± 9.0 77 a NA stands for no activity. 78 The enzyme was incubated with each inhibitor, detergent and denaturant with different final 79 concentrations in 50mM sodium phosphate buffer (ph 7.8) at 25 C for 30 min, individually. 80 Reaction mixture without inhibitor, detergent, and denaturant was used as a control. The 81 values are given as means (n = 3) ± standard deviation. 82 10
83 84 Table S5. The Equilibrium Model parameters 5 SODA BSn5 and SOD r for SOD NG2215, SODA NG2215, SOD BSn5, a G cat b G inact c H eq d T eq 85 86 87 88 Enzyme (KJ mol -1 ) (KJ mol -1 ) (KJ mol -1 ) ( ) SOD NG2215 38.24 108.00 104.05 60.84 SODA NG2215 35.62 100.08 87.21 31.39 SOD BSn5 36.56 101.43 99.97 37.02 SODA BSn5 36.12 97.30 113.84 32.31 SOD r 37.96 103.33 82.24 57.93 a Gibbs free energy of activation for an enzyme-catalysed reaction. b Gibbs free energy of activation for the irreversible thermal inactivation of an enzyme. c Change in enthalpy for the E act to E inact transition. d The temperature at which the E act -E inact equilibrium is at its mid-point. 89 11
90 91 92 93 94 95 96 97 98 99 100 Supplementary References 1. Daniel, R. M., Danson, M. J., Eisenthal, R., Lee, C. K. & Peterson, M. E. New parameters controlling the effect of temperature on enzyme activity. Biochemical Society transactions 35, 1543-1546 (2007). 2. Whitaker, J.R. Principles of Enzymology for the Food Sciences. Marcel Dekker (1994). 3. Belitz, H.D & Gosch, W. Enzymes In Food Chemistry (2nd edn), Springer-Verlag (1999). 4. James P. Henley et al. Categorization of enzyme deactivations using a series-type mechanism. Enzyme and Microbial Technology. 7, 50-60 (1985). 5. Daniel, R. M. & Danson, M. J. A new understanding of how temperature affects the catalytic activity of enzymes. Trends in biochemical sciences 35, 584-591 (2010). 12