Table S1. Bacterial strains, and plasmids Strain or plasmid Relevant characteristics Reference M. xanthus strains DK1622 Wild-type M. xanthus 1 AG306 pnbc6::nla6, Kan r 2 AG1151 DK 1622 pkg51::mxan2688 This study AG1152 DK 1622 pkg52::mxan3259 This study AG1132 DK 1622 pkg32 3 AG1154 DK 1622 pkg54 This study AG1155 DK 1622 pkg55 This study Plasmids pcr2.1-topo Kan r Invitrogen pmbp-parallel1 Amp r 4 preg1727 Kan r / lacz 5 pkg14 Amp r Nla6-DBD/pMBP-parallel1 3 pkg51 Kan r pcr2.1-topo containing a 489 bp MXAN2688 fragment This study pkg52 Kan r pcr2.1-topo containing a 402 bp MXAN3259 fragment This study pkg32 Kan r preg1727 containing a 418 bp nla28 promoter fragment 3 pkg54 Kan r preg1727 containing a 418 bp nla28 promoter fragment with a mutation in the Nla6 enhancer site This study pkg55 Kan r preg1727 containing a 418 bp nla28 promoter fragment with a mutation in the NLa6 enhancer site This study 1. Kaiser, D. 1979. Social gliding is correlated with the presence of pili in Myxococcus xanthus. Proc. Natl. Acad. Sci. USA 76: 5952-5956. 2. Caberoy NB, Welch RD, Jakobsen JS, Slater SC, Garza AG. 2003. Global mutational analysis of NtrC-like activators in Myxococcus xanthus: identifying activator mutants defective for motility and fruiting body development. J. Bacteriol. 185:6083-6094. 3. Giglio KM, Caberoy N, Suen G, Kaiser D, Garza AG. 2011. A cascade of coregulating enhancer binding proteins initiates and propagates a multicellular developmental program. Proc. Natl. Acad. Sci. U. S. A. 108:E431-439. 4. Sheffield P, Garrard S, Derewenda Z. 1999. Overcoming expression and purification problems of RhoGDI using a family of "parallel" expression vectors. Protein. Expr. Purif. 15:34-39. 5. Fisseha M, Gloudemans M, Gill RE, Kroos L. 1996. Characterization of the regulatory region of a cell interaction-dependent gene in Myxococcus xanthus. J. Bacteriol. 178:2539-2550.
Table S2. Primers used in this study Primers Sequence Amplicon size/description Primers used in qpcr 16s up 5 caagggaactgagagacagg3 All primers used in 16s down 5 ctctgtaccggccattgtagc3 qpcr amplify a probe that is 90-110. rpod up 5 gacgtcttggagcgagagctgtc3 bp in length rpod down 5 ctccatcatcttggtccggaggtc3 actb up actb down asge up asge down exo up exo down MXAN2688 up MXAN2688 down MXAN3259 up MXAN3259 down nla28 up nla28 down 5 ctccaggacgaggagttcttccg3 5 gcgatttccttctccaggttcgc3 5 ctcgtcaacggacactccca3 5 caactccagaagtcgtccgcctc3 5 ctccgtccgcatggctacatctc3 5 gaaggcttccttcagcgagtcgg3 5 cgcgggtgtcgttatcactgtc3 5 ccgtcgacgtggagttcgaaagac3 5 ctgctcatctcccaggagaccttc3 5 cattcatgacgtccaccgcgtc3 5 gtgttgcaggagggcgaaatcc3 5 cgcgtcttgaggtccttgttcg3 Primers used to generate promoter region fragments actbp1 up 5 ccgccgtcgtggagtc3 actbp1 down 5 tttgacctcatgcagccg3 185 bp asgep1 up 5 ttggtgctgaaggacgaa3 asgep1 down 5 aagacaccgtggtagccgtca3 190 bp asgep2 up 5 aactgcgtcagttgcg3 asgep2 down 5 cccagggcaggcccttc3 192 bp dev up 5 gcatgcatcagcgaa3 dev down 5 ccaacatgcgcaggt3 70 bp exop1 up 5 aaatgggaagcgggagg3 exop1 down 5 aaagcccttggatcgcag3 165 bp exop2 up 5 cgccacgcgcgggcgcccgg3 exop2 down 5 cgttcgcgatgggcacggga3 207 bp MXAN2688P1 up 5 gcgggaaggtatgggcacgct3 MXAN2688P1 down 5 aggagttgggcggggttg3 159 bp MXAN2688P2 up 5 gctgggcctcgcgtaccaagg3 MXAN2688P2 down 5 agcgtgcccataccttcccgc3 205 bp MXAN3259P1 up 5 cgaccacatcgggaggaaagg3 MXAN3259P1 down 5 gagggaggttgggcaccctgg3 159 bp
MXAN3259P2 up 5 ccaccggcggccataccgctt3 MXAN3259P2 down 5 cctttcctcccgatgtggtcg3 165 bp nla6p1a up 5 tgacgtgggccacatgatggaga3 nla6p1a down 5 tcccggtagaactcgccgaaca3 201 bp nla28p1a up 5 gcgtcatctggttgcagggt3 nla28p1a down 5 gctcgagcggaatacccgt3 151 bp Primers used to generate mutations in the nla promoter n28c217t_c218t 5 tggtgtgggagagatggtttatgcggttcctctgtttc3 n28 c217t_c218t anti 5 gaaacagaggaaccgcataaaccatctctcccacacca3 CC to TT 1 st half site nla28p n28c241t_a242t 5 gcggttcctctgtttcgcgattgcgttggccgtc3 n28c241t_a242t anti 5 gacggccaacgcaatcgcgaaacagaggaaccgc3 CA to TT 2 nd half site nla28p n6c62t_a63t_a64t 5 cgtccacgcggaggctttcgccatcatccaggc3 n6c62t_a63t_a64t anti 5 gcctggatgatggcgaaagcctccgcgtggacg3 CAA to TTT 1 st half site nla6p n6c122t_a123t_c124t 5 gggcgaccatctacactttcgcctcgccttgctgg3 n6c122t_a123t_c124t anti 5 ccagcaaggcgaggcgaaagtgtagatggtcgccc3 CAC to TTT 2 nd half site nla6p
Table S3. Functions/potential functions of putative Nla6 target operons Operon a Function/putative function exo operon* exoa exob exoc exod exoe exof exog exoh exoi Polysaccharide biosynthesis/export protein Chain length determinant family protein Polysaccharide biosynthesis/export protein Sugar transferase Aminotransferase mrpc operon mrpc MXAN5126 Transcriptional regulator/antitoxin (programmed cell death) phop1 operon phop1 phor1 MXAN4779 MXAN4780 Response regulator Histidine Kinase Ser/Thr protein phosphatase family protein Phosphoglycerate mutase family protein MXAN0021 (hydrolase activity) MXAN0303 Aldo/keto reductase family oxidoreductase
MXAN0325 operon MXAN0325 MXAN0324 DedA family protein MXAN0326 Phage tail collar domain-containing protein MXAN0620 MXAN0993 Hybrid sensory box histidine kinase and response regulator MXAN1020 operon MXAN1020 MXAN1019 MXAN1018 MXAN1017 Prepilin-type N-terminal cleavage/methylation domain-containing protein Prepilin-type N-terminal cleavage/methylation domain-containing protein MXAN1847 operon MXAN1847 MXAN1846 MXAN1845 MXAN1844 MXAN1843 MXAN1842 MXAN1841 MXAN1840 MXAN1839 MXAN1838 Putative phage late control gene D protein Phage-related baseplate assembly protein Gene 25-like lysozyme Baseplate J-like protein
MXAN1837 MXAN1836 Putative phage tail protein MXAN2305 TonB domain-containing protein MXAN2409 operon MXAN2409 MXAN2410 Limonene-1,2-epoxide hydrolase catalytic domain MXAN2688* hypothetical MXAN2974 Alpha2 macroglobulin domain MXAN3147 Integral membrane protein MXAN3259 operon* MXAN3259 MXAN3260 MXAN3261 MXAN3262 MXAN3263 Polysaccharide deacetylase Polysaccharide biosynthesis Hexapeptide repeat-containing transferase Glycosyltransferase Glycosyltransferase MXAN3329 operon MXAN3329 MXAN3328 TPR repeat-containing protein
MXAN3442 operon MXAN3442 MXAN3443 Rieske family iron-sulfur cluster-binding protein TetR family transcriptional regulator MXAN3641 operon MXAN3641 MXAN3640 Major facilitator superfamily (MFS) transporter Aminotransferase MXAN3677 Major facilitator superfamily (MFS) transporter MXAN3703 Thioredoxin family protein MXAN3880 Major facilitator superfamily (MFS) transporter MXAN3932 operon MXAN3932 MXAN3931 Polyketide synthase Methyltransferase domain MXAN5094 Luciferase-like monooxygenase family protein MXAN5134 MutS-like protein (DNA mismatch repair) MXAN5181 operon MXAN5181 MXAN5182 MXAN5183 MXAN5184 Penicillin-binding protein FG-GAP repeat-containing protein Bacterial extracellular solute-binding protein Histidine kinase
MXAN5624 operon MXAN5624 MXAN5625 MXAN5736 Protein metabolic process MXAN5936 MXAN6192 operon MXAN6192 MXAN6191 MXAN6190 MXAN6189 GlcNAc-PI de-n-acetylase domain Solute/sodium symporter MXAN6448 operon MXAN6448 MXAN6447 MXAN6446 Putative lipoprotein MXAN6480 MXAN6513 Nudix hydrolase family MXAN7013 Prolyl oligopeptidase family MXAN7064
MXAN7145 operon MXAN7145 MXAN7144 ABC transporter, ATP-binding protein ABC transporter, ATP-binding protein MXAN7167 operon MXAN7167 MXAN7168 Leucine rich repeat-containing protein MXAN7327 MXAN7411 operon MXAN7411 MXAN7410 Putative lipoprotein a Genes marked with an asterisk were chosen for further analysis.