FW 1 CDR 1 FW 2 CDR 2

Similar documents
Structure and evolution of the spliceosomal peptidyl-prolyl cistrans isomerase Cwc27

Supplementary figure 1. Comparison of unbound ogm-csf and ogm-csf as captured in the GIF:GM-CSF complex. Alignment of two copies of unbound ovine

Supplementary Figure 3 a. Structural comparison between the two determined structures for the IL 23:MA12 complex. The overall RMSD between the two

SUPPLEMENTARY INFORMATION

Stabilizing the CH2 domain of an Antibody by Engineering in an Enhanced Aromatic Sequon

Full wwpdb X-ray Structure Validation Report i

SUPPLEMENTARY INFORMATION

Sensitive NMR Approach for Determining the Binding Mode of Tightly Binding Ligand Molecules to Protein Targets

Full wwpdb X-ray Structure Validation Report i

Full wwpdb X-ray Structure Validation Report i

Nitrogenase MoFe protein from Clostridium pasteurianum at 1.08 Å resolution: comparison with the Azotobacter vinelandii MoFe protein

SUPPLEMENTARY INFORMATION

Table 1. Crystallographic data collection, phasing and refinement statistics. Native Hg soaked Mn soaked 1 Mn soaked 2

Full wwpdb X-ray Structure Validation Report i

SUPPLEMENTARY INFORMATION

Proteins: Characteristics and Properties of Amino Acids

What makes a good graphene-binding peptide? Adsorption of amino acids and peptides at aqueous graphene interfaces: Electronic Supplementary

Rho1 binding site PtdIns(4,5)P2 binding site Both sites

SUPPLEMENTARY INFORMATION

Full wwpdb X-ray Structure Validation Report i

Programme Last week s quiz results + Summary Fold recognition Break Exercise: Modelling remote homologues

Experimental and Computational Mutagenesis to Investigate the. Positioning of a General Base within an Enzyme Active Site

NMR study of complexes between low molecular mass inhibitors and the West Nile virus NS2B-NS3 protease

Ramachandran Plot. 4ysz Phi (degrees) Plot statistics

Amino Acid Side Chain Induced Selectivity in the Hydrolysis of Peptides Catalyzed by a Zr(IV)-Substituted Wells-Dawson Type Polyoxometalate

ml. ph 7.5 ph 6.5 ph 5.5 ph 4.5. β 2 AR-Gs complex + GDP β 2 AR-Gs complex + GTPγS

Table S1. Primers used for the constructions of recombinant GAL1 and λ5 mutants. GAL1-E74A ccgagcagcgggcggctgtctttcc ggaaagacagccgcccgctgctcgg

Supplementary Figures

Supplementary Information. Broad Spectrum Anti-Influenza Agents by Inhibiting Self- Association of Matrix Protein 1

Supporting information to: Time-resolved observation of protein allosteric communication. Sebastian Buchenberg, Florian Sittel and Gerhard Stock 1

Properties of amino acids in proteins

Oxygen Binding in Hemocyanin

Full wwpdb X-ray Structure Validation Report i

Course Notes: Topics in Computational. Structural Biology.

Supplementary Materials for

Supporting Information

Bacterial protease uses distinct thermodynamic signatures for substrate recognition

Packing of Secondary Structures

Using Higher Calculus to Study Biologically Important Molecules Julie C. Mitchell

Other Methods for Generating Ions 1. MALDI matrix assisted laser desorption ionization MS 2. Spray ionization techniques 3. Fast atom bombardment 4.

Electronic Supplementary Information

7.012 Problem Set 1. i) What are two main differences between prokaryotic cells and eukaryotic cells?

Supplementary Information. Viral immunoevasin targeting of a Natural Killer cell receptor family

Supplementary Information Intrinsic Localized Modes in Proteins

Secondary Structure. Bioch/BIMS 503 Lecture 2. Structure and Function of Proteins. Further Reading. Φ, Ψ angles alone determine protein structure

Viewing and Analyzing Proteins, Ligands and their Complexes 2

Central Dogma. modifications genome transcriptome proteome

Physiochemical Properties of Residues

Computational Protein Design

Supplementary information for:

Model Mélange. Physical Models of Peptides and Proteins

Exam III. Please read through each question carefully, and make sure you provide all of the requested information.

SUPPLEMENTARY INFORMATION

Unraveling the degradation of artificial amide bonds in Nylon oligomer hydrolase: From induced-fit to acylation processes

Supplementary information

NB-DNJ/GCase-pH 7.4 NB-DNJ+/GCase-pH 7.4 NB-DNJ+/GCase-pH 4.5

Peptide Syntheses. Illustrative Protection: BOC/ t Bu. A. Introduction. do not acid

Protein Fragment Search Program ver Overview: Contents:

Supplementary Figure 1. Biochemical and sequence alignment analyses the

SUPPLEMENTARY INFORMATION

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplement information

Full wwpdb X-ray Structure Validation Report i

Peptides And Proteins

Amino Acids and Proteins at ZnO-water Interfaces in Molecular Dynamics Simulations: Electronic Supplementary Information

Sequential resonance assignments in (small) proteins: homonuclear method 2º structure determination

Exam I Answer Key: Summer 2006, Semester C

Full wwpdb X-ray Structure Validation Report i

Monomeric Clavularia CFP July 19, 2006

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

C H E M I S T R Y N A T I O N A L Q U A L I F Y I N G E X A M I N A T I O N SOLUTIONS GUIDE

Table S1. Overview of used PDZK1 constructs and their binding affinities to peptides. Related to figure 1.

SUPPLEMENTARY INFORMATION

Supplemental Information

Supplementary figure 1 Application of tmfret in LeuT. (a) To assess the feasibility of using tmfret for distance-dependent measurements in LeuT, a

Supporting Online Material for

Molecular Structure Prediction by Global Optimization

Translation. A ribosome, mrna, and trna.

ENZYME MECHANISMS, PROTEASES, STRUCTURAL BIOLOGY

Protein Structures: Experiments and Modeling. Patrice Koehl

Background BIOCHEMISTRY LAB CHE-554. Experiment #1 Spectrophotometry

IgE binds asymmetrically to its B cell receptor CD23

Protein Structure Bioinformatics Introduction

A. Two of the common amino acids are analyzed. Amino acid X and amino acid Y both have an isoionic point in the range of

1. What is an ångstrom unit, and why is it used to describe molecular structures?

Supplementary Information. Structural basis for precursor protein-directed ribosomal peptide macrocyclization

Supplemental Information. Molecular Basis of Spectral Diversity. in Near-Infrared Phytochrome-Based. Fluorescent Proteins

*Corresponding Author *K. F.: *T. H.:

Nature Structural & Molecular Biology doi: /nsmb Supplementary Figure 1. CRBN binding assay with thalidomide enantiomers.

SUPPLEMENTARY INFORMATION

Introduction to Comparative Protein Modeling. Chapter 4 Part I

Deciphering the Rules for Amino Acid Co- Assembly Based on Interlayer Distances

Protein structure. Protein structure. Amino acid residue. Cell communication channel. Bioinformatics Methods

Diastereomeric resolution directed towards chirality. determination focussing on gas-phase energetics of coordinated. sodium dissociation

β1 Structure Prediction and Validation

Snork Synthesis Lab Lab Directions

Protein Struktur. Biologen und Chemiker dürfen mit Handys spielen (leise) go home, go to sleep. wake up at slide 39

Supporting Information

Supplementary Figure 1. SDS-PAGE analysis of GFP oligomer variants with different linkers. Oligomer mixtures were applied to a PAGE gel containing

Structural basis of PROTAC cooperative recognition for selective protein degradation

Transcription:

Supplementary Figure 1 Supplementary Figure 1: Interface of the E9:Fas structure. The two interfaces formed by V H and V L of E9 with Fas are shown in stereo. The Fas receptor is represented as a surface with the epitope residues displayed as blue and light blue sticks for CRD1 and CRD2, respectively. The paratope residues of CDRs 1, 2 and 3 of V H and V L are represented as sticks and colored violet, orange and red, respectively. In the V H epitope the position of the V L epitope is indicated by the dashed circle. Supplementary Figure 2 Heavy chain sequence alignment FW 1 CDR 1 FW 2 CDR 2 Kabat numbering 1 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 2 21 22 23 24 25 26 27 28 29 3 31 32 33 34 35 35a 35b 36 37 38 39 4 41 42 43 44 45 46 47 48 49 5 51 52 52a 52b 52c 52d 52e 53 54 55 56 57 58 59 6 61 62 63 64 65 E9 Q L Q L Q E S G P G L V K P S E T L S L T C T V S G A S I S A N S Y Y G V W V R Q S P G K G L E W V G S I A Y R G N S N S G S T Y Y N P S L K S EP12r_E1 Q L Q L Q E S G P G L V K P S E T L S L T C T V S G A S I S A N S Y Y G V W V R Q S P G K G L E W V G S I A Y R E N S N S G S T Y Y N P S F K S EP4b_E3 Q L Q L Q E S G P G L V K P S E T L S L T C T V S G A P I S A N S Y Y G V W V R Q S P G K G L E W V G S I A Y R G N S N S G S T Y Y N P S L K S EP5b_E5 Q L Q L Q E S G P G L V K P S E T L Y L T C T V S G A S I G A N S Y Y G V W V R Q S P G K G L E W V G S I A Y R G S S N S G S T Y Y N P S L K S EP6b_B1 Q L Q L Q E S G P G L V K P S E T L S L T C T V S G A S I S A N S Y Y G V W V R Q S P G K G L E W V G S I A Y R G N S N S G S T Y Y N P S L K S FW 3 CDR 3 FW 4 Kabat numbering 66 67 68 69 7 71 72 73 74 75 76 77 78 79 8 81 82 82a 82b 82c 83 84 85 86 87 88 89 9 91 92 93 94 95 96 97 98 99 1 1a 1b 1c 1d 1e 1f 1g 1h 1i 11 12 13 14 15 16 17 18 19 11 111 112 113 E9 R A T V S V D T S K N Q V S L R L T S V T A A D T A L Y Y C A R R Q L L D D G T G Y Q W A A F D V W G Q G T M V T V S S EP12r_E1 R A T V S V D T S K N Q V S L R L T S V T A A D T A L Y Y C A R R Q L L D D G T G Y Q W A A F D V W G Q G T M V T V S S EP4b_E3 R A T V S V D T S K N Q V S L R L T S V T A A D T A L Y Y C A R R Q L L D D G T G Y Q W A A F D V W G Q G T M V T I S S EP5b_E5 R A T V S V D T S K N Q V S L R L T S V T A A D T A L Y Y C A R R Q L L D D G T G Y Q W A A F D V W G Q G T M V T V S S EP6b_B1 R A T V S V D S S K N Q V S L R L T S V T A A D T A L Y Y C A R R Q L L D D G T G Y Q W A A F D V W G Q G T M V T V S S Light chain sequence alignment * FW 1 CDR 1 FW 2 CDR 2 Kabat numbering 1 2 3 4 5 6 7 8 9 11 12 13 14 15 16 17 18 19 2 21 22 23 24 25 26 27 27a 27b 28 29 3 31 32 33 34 35 36 37 38 39 4 41 42 43 44 45 46 47 48 49 5 51 52 53 54 55 56 E9 Q S V L T Q P P S V S E A P R Q T V T I S C S G N S F N I G R Y P V N W Y Q Q L P G K A P K L L I Y Y N N L R F S EP12r_E1 Q S V L T Q P P S V S E A P R Q T V T I S C S G N S F N I G R Y P V N W Y Q Q L P G K A P K L L I Y Y N N L R F S EP4b_E3 Q S V L T Q P P S V S E A P R Q T V T I S C S G N S F N I G R Y P V N W Y Q Q L P G K A P K L L I Y N N N L R F S EP5b_E5 Q S V L T Q P P S V S E A P R Q T V T I S C S G N S F N T G R Y P V N W Y Q Q L P G K A P K L L I Y S N N L R L S EP6b_B1 Q S V L T Q P P S V S E A P R Q T V T I S C S G N S S N I G R Y P V N W Y Q Q L P G K A P K L L I Y S D N L R F S FW 3 CDR 3 FW 4 72 73 93 94 95 12 13 Kabat numbering 57 58 59 6 61 62 63 64 65 66 67 68 69 7 71 74 75 76 77 78 79 8 81 82 83 84 85 86 87 88 89 9 91 92 95a 95b 96 97 98 99 1 11 14 15 16 17 E9 G V S D R F S G S K S G T S A S L A I R D L L S E D E A D Y Y C S T W D D T L K G W V F G G G T K V T V L EP12r_E1 G V S D R F S G S K S G T S A S L A I R D L L S E D E A D Y Y C S T W D D T L K G W V F G G G T K V T V L EP4b_E3 G V S D R F S G S K S G T S A S L A I R D L L S E D E A D Y Y C S T W D D T L K G W V F G G G T K V T V L EP5b_E5 G V S D R F S G S K S G T S A S L A I R D L L S E D E A D Y Y C S T W D D T L E G W V F G G G T K V T V L EP6b_B1 G V P D R F S G S K S G T T A S L A I R D L L S E D E A D Y Y C S T W D D T L E G W V F G G G T K V T V L Supplementary Figure 2: Amino acid sequence alignment for E9 and variant antibodies. Heavy (top) and light (bottom) variable domain sequences are aligned versus the parental E9 antibody and differences are shown in pink. Hotspot mutations found in the round 6 population are highlighted in boxes.

Supplementary Figure 3 1 8 6 4 Framework VH CDRs Vernier residues V H73 Heavy chain % re si du e m ut at ed 2 1 11 21 31 41 51 61 71 81 91 11 111 121 131 1 8 6 4 2 Framework VL CDRs Vernier residues V L27a V L5 VL51 V L7 1 11 21 31 41 51 61 71 81 91 11 111 AA numbering in V chains Light chain V L95a Supplementary Figure 3: Analysis of mutations after the directed evolution process. The percentage of residues mutated following 6 rounds of directed evolution selection is shown for both the heavy (top) and light (bottom) chains. Amino acids are numbered numerically. Positions mutated above 2% were defined as hotspots. Residues in the framework regions, the CDR loops and at Vernier positions are shown in grey, blue and orange bars, respectively. Supplementary Figure 4 A V H R52b B V H A52 V H S56 V H Y52a V H G55 E9 Heavy chain FasR V H Y58 V H CDR2 Supplementary Figure 4: Fas receptor affinity modulation by single point mutagenesis. A) Close-up view of the E9 heavy chain (cyan) in complex with the cysteine-rich repeat domain (CRD)- 1 of Fas (green). Heavy chain CDR2 loop is shown in yellow and the 6 residues chosen for sitedirected mutagenesis are shown in orange. B) Affinity of single point-mutants for Fas receptor as determined by SPR. Point mutants were purified as scfv and run as analyte on Fas ECD in fusion with Fc fragment previously immobilised on Protein G-immobilised CM5 chip. Points, each one representing a different sidechain replacement, were grouped by the residue mutated and sorted by K d value on the Y-axis. Affinity of the parent E9 is shown as a grey line.

Supplementary Figure 5 B A Supplementary Figure 5: Influence of cross-linking IgGs on cell viability. Dose-dependent in vitro cell killing of Jurkat cells by anti-fas E9 and variant antibodies without (A) or with (B) protein A crosslinking prior to the assay. Supplementary Table 1 A. Diffraction data Space group Unit cell constants [Å]/ [ ] Resolution [Å] Rsym [%] I/σ No. of reflections No. of unique reflections Completeness [%] sfasr:e9 C2221 a= 89.49, b= 166.4, c= 11.72; α=β=γ=9 46.9 1.93 (1.98-1.93) a 4.5 (43.9) 22.51 (4.73) 398919 61296 98.3 (99.6) EP6b_B1:sFasR P3121 a=b= 94.51, c= 139.2 α=β= 9, γ=12 47.26-2.1 (2.15-2.1) 1.4 (63.7) 16.4 (4.13) 42595 42586 1 (1) A. Refinement No. of reflections work / test 58229 / 364 4441 / 2129.2/.225 8568 (incl. H).182 /.224 824 (incl. H) 519 2 NAG, 1 FUC, 5 EDO, 1 Na Rwork/Rfree Number of atoms Number of residues Number of heteromolecules 2 Cd, 1 Cl, 6 EDO Number of waters 411 349 Rmsd (bonds) [Å].8.6 Rmsd (angles) [ ] 1.14.955 DPI Biso [Å2] 49.6 39.85 Wilson B [Å2] 34.83 29.48 Ramachandran plot (Molprobity) Residues in most favored region 95.9 96.7 [%] Outliers [%].2 Molprobity score 1.32 1.35 a Numbers in parentheses refer to the highest resolution shell

Supplementary Table 2 Fas Residue ASA BSA % ig Interaction 39 Asp 113.34 26.71 23.6 -.14 4 Gly 16.42 8.16 49.7.1 H-bond 41 Gln 158.17 115.93 73.3 -.91 H-bond 42 Phe 11.85 9.97 82.1 1.37 43 Cys 13.63 12.8 93.9 -.14 H-bond 44 His 159.67 149.84 93.8.75 H-bond 45 Lys 132.81 66.64 5.2.45 46 Pro 7.77 65.56 92.6.92 47 Cys.47.47 1..1 48 Pro 64.61 47.6 72.8.75 49 Pro 6.24 22.59 37.5.36 58 Thr 8.89 3.19 3.9 -.4 59 Val 19.77 93.45 85.1.97 6 Asn 136.96 12.25 8.9 -.2 61 Gly 42.6.74 1.7 -.1 75 Tyr 18.64 3.19 17.1 -.4 76 Thr 5.37.34 6.3.1 77 Asp 66.7 14.77 22.1 -.16 H-bond 78 Lys 146.82 64.18 43.7.64 79 Ala 57.3 54.31 95.2.34 8 His 35.43 17.32 48.9.28 81 Phe 9.24 85.64 94.9 1.33 Cation-Pi 86 Arg 15.11 73.57 49. -1.37 H-bond / Cation-Pi Supplementary Table 2 (continued) Supplementary Table 2: Interface residues in the E9:Fas complex determined by PISA. The antibody residues are numbered with the Kabat system. The accessible surface area (ASA) and the buried surface area (BSA) in Å2 of the indicated interface residues are indicated with the change in percent upon complex formation. The solvation energy effect is shown as ig in kcal/mol. Interaction types are also listed. E9 V L Residue ASA BSA % ig 29 Gly 35.57.74 2.1 -.1 3 Arg 132.17 48.59 36.8.9 31 Tyr 48.59 48.22 99.2.22 32 Pro 19.4 13.32 68.7.21 5 Tyr 41.42 31.13 75.2.5 51 Asn 27.62 1.33 37.4 -.12 91 Trp 56.48 53.55 94.8.74 93 Asp 41.34 3.81 9.2 -.5 95A Lys 124.46 13.85 11.1.21 96 Trp 16.98 8.34 49.1.9 Interaction Interaction E9 V H Residue ASA BSA % ig 33 Ser 67.8 41.47 61.2.6 34 Tyr 17.15 3.24 18.9.5 35 Tyr 42.96 4.63 94.6.22 H-bond 5 Ser 1.46 1.34 91.8.2 51 Ile 7.87.17 2.2 52 Ala 41.35 4.59 98.2.47 52A Tyr 5.69 2.74 48.2.2 52B Arg 126.28 4.23 31.9 -.9 52E Ser 65.91 7.54 11.4.2 54 Ser 61.25 2.8 34. -.5 55 Gly 37.95 8.9 23.5.12 56 Ser 75.16 47.26 62.9.13 H-bond 57 Thr 57.92 4.96 8.6 58 Tyr 85.96 48.4 55.9.65 95 Arg 58.15 57.53 98.9-2.97 H-bond / Cation-Pi 96 Gln 64.18 7.25 11.3 -.11 97 Leu 1 7.21 7.2 1.5 1B Thr 95.72 9.82 1.3 -.11 H-bond 1C Gly 66.5 11.36 17.2.8 1D Tyr 134.1 98.37 73.4.6 H-bond/Cation-Pi 1E Gln 1.78 36.39 36.1 -.42 1F Trp 46.55 45.97 98.8.74 1H Ala 5.81 5.53 95.2.9

Supplementary Table 3 E9 mutants (scfv) # scfv Mutation kd (1/s) ka (1/Ms) KD (M) Change KD/parent 1 E9_WT / 2.4E-3 2.8E+5 8.6E-9 1. 2 E9_H73S H73_T>S 1.3E-3 3.6E+5 3.5E-9 2.4 3 E9_L27aS L27a_F>S 2.E-3 2.5E+5 7.9E-9 1.1 4 E9_L5S L5_Y>S 2.9E-4 3.3E+5 8.7E-1 9.8 5 E9_L51D L51_N>D 5.E-4 4.5E+5 1.1E-9 7.8 6 E9_L59P L59_S>P 2.6E-3 3.3E+5 8.E-9 1.1 7 E9_L7T L7_S>T 2.6E-3 3.E+5 8.5E-9 1. 8 E9_L95aE L95aE_K>E 1.9E-3 2.9E+5 6.7E-9 1.3 EP6bB1 revertants (scfv) # scfv Mutation kd (1/s) ka (1/Ms) KD (M) Change KD/parent 1 EP6B_WT / 7.8E-5 4.2E+5 1.8E-1 1. 2 EP6B_H73S H73_S>T 9.3E-5 4.8E+5 2.E-1 1.1 3 EP6B_L27aS L27a_S>F 1.E-4 5.6E+5 1.8E-1 1. 4 EP6B_L5S L5_S>Y 1.4E-4 3.9E+5 3.7E-1 2. 5 EP6B_L51D L51_D>N 1.1E-4 3.2E+5 3.3E-1 1.8 6 EP6B_L59P L59_P>S 1.3E-4 4.1E+5 3.1E-1 1.7 7 EP6B_L7T L7_T>S 8.4E-5 5.2E+5 1.6E-1.9 8 EP6B_L95aE L95aE_E>K 1.E-4 5.E+5 2.E-1 1.1 Supplementary Table 3: Affinity data for E9 point mutants and EP6b_B1 revertants. The seven mutations found in the high affinity antibody EP6b_B1 were individually introduced in the parent E9 backbone or removed from EP6b_B1 to measure their impact on affinity improvement. Kinetic parameters and affinity for recombinant Fas of the mutants, revertants, parent E9 and EP6b_B1 were determined by BIAcore. KA values (1/KD in M-1) were used to calculate free energy of binding compared to the parent E9 ( G(mut.-WT) ) presented in Figure 4B. Supplementary Table 4 Antibody Cell killing efficiency (%) Cell killing EC5 (nm) E9 75.74 EP12r_E1 77.9 EP4b_E3 63.8 EP5b_E5 43.96 EP6b_B1 Non Functional Non Functional E9_Y58W 59 2.69 E9_Y52aR 75 1.82 E9_R52bS 34.63 Supplementary Table 4: Cell killing data for E9 and variant antibodies. Cell killing efficiency and EC 5 were determined from in vitro viability assays using Jurkat cells and a titration of the anti-fas antibodies without cross-linking.

2024 © sciencedocbox.com Privacy Policy | Terms of Service | Feedback