A Bayesian Approach to Phylogenetics

Size: px
Start display at page:

Download "A Bayesian Approach to Phylogenetics"

Transcription

1 A Bayesian Approach to Phylogenetics Niklas Wahlberg Based largely on slides by Paul Lewis ( An Introduction to Bayesian Phylogenetics Bayesian inference in general Markov chain Monte Carlo Bayesian phylogenetics Prior distributions 10 important considerations Bayesian inference in general D will stand for Data H will mean any one of a number of things: a discrete hypothesis a distinct model (e.g. JC, HKY, GTR, etc.) a tree topology one of an infinite number of continuous model parameter values (e.g. ts:tv rate ratio) A Bayesian approach compared to ML In ML, we choose the hypothesis that gives the highest (maximized) likelihood to the data The likelihood is the probability of the data given the hypothesis L = P (D H). A Bayesian analysis expresses its results as the probability of the hypothesis given the data. this may be a more desirable way to express the result

2 The posterior probability of a hypothesis Likelihood of hypothesis Prior probability of hypothesis The posterior probability, [P (H D)], is the probability of the hypothesis given the observations, or data (D) The main feature in Bayesian statistics is that it takes into account prior knowledge of the hypothesis P (H D) = P (D H) * P (H) P (D) Posterior probability of hypothesis H Probability of the data (a normalizing constant) Likelihood function is common Both ML and Bayesian methods use the likelihood function In ML, free parameters are optimized, maximizing the likelihood In a Bayesian approach, free parameters are probability distributions, which are sampled. Coin-flipping example Data D: 6 heads (out of 10 flips) H = true underlying proportion of heads (the probability of coming up heads on any single flip) if H = 0.5, coin is perfectly fair if H = 1.0, coin always comes up heads (i.e. it is a trick coin)

3 The Frequentist and the Bayesian F: there exists true probability H of getting heads, H 0 : H=0.5 Does the data reject the null hypothesis? B: what is the range around 0.5 that we are willing to accept as being in the fair coin range? What is the probability that H is in this range? H

4 How the MCMC works Markov chain Monte Carlo Start somewhere That somewhere will have a likelihood associated with it Not the optimized, maximum likelihood Randomly propose a new state If the new state has a better likelihood, the chain goes there

5 Target vs. proposal distributions The target distribution is the posterior distribution of interest The proposal distribution is used to decide where to go next; you have much flexibility here, and the choice affects the efficiency of the MCMC algorithm Symmetric proposal distributions have been assumed thus far, but the Hastings ratio can be used for asymmetric ones

6 The Tradeoff Pro: taking big steps helps in jumping from one island in the posterior density to another Con: taking big steps often results in poor mixing Solution: MCMCMC!

7 Metropolis-coupled Markov chain Monte Carlo (MCMCMC, or MC 3 ) MC 3 involves running several chains simultaneously (one cold and several heated ) The cold chain is the one that counts, the heated chains are scouts Chain is heated by raising densities to a power less than 1.0 (values closer to 0.0 are warmer) Bayesian phylogenetics

8 Sampling the chain Marginal = taking into account all possible values Record the position of the robot every 100 or 1000 steps (1000 represents more thinning than 100) This sample will be autocorrelated, but not much so if it is thinned appropriately (can measure autocorrelation to assess this) If using heated chains, only the cold chain is sampled The marginal distribution of any parameter can be obtained from this sample

9 Putting it all together Start with random tree and arbitrary initial values for branch lengths and model parameters Each generation consists of one of these (chosen at random): Propose a new tree (e.g. Larget-Simon move) and either accept or reject the move Propose (and either accept or reject) a new model parameter value Every k generations, save tree topology, branch lengths and all model parameters (i.e. sample the chain) After n generations, summarize sample using histograms, means, credible intervals, etc. Prior Distributions Prior distributions For topologies: discrete Uniform distribution For proportions: Beta(a,b) distribution flat when a=b peaked above 0.5 if a=b and both are greater than 1 For base frequencies: Dirichlet(a,b,c,d) distribution flat when a=b=c=d all base frequencies close to 0.25 if v=a=b=c=d and v large (e.g. 300) For GTR model relative rates: Dirichlet(a,b,c,d,e,f) distribution

10 Prior Distributions For other model parameters and branch lengths: Gamma(a,b) distribution Exponential(λ) equals Gamma(1, λ-1) λ distribution Mean of Gamma(a,b) is ab (so mean of an Exponential(10) distribution is 0.1) Variance of a Gamma(a,b) distribution is ab 2 (so variance of an Exponential(10) distribution is 0.01) The effect of priors Flat (uninformative) priors mean that the posterior probability is directly proportional to the likelihood The value of H at the peak of the posterior distribution is equal to the MLE of H Informative priors can have a strong effect on posterior probabilities

11 10 important considerations Top 10 List (of important considerations) 1. Beware arbitrarily truncated priors 2. Branch length priors particularly important 3. Beware high posteriors for very short branch lengths 4. Partition with care (prefer fewer subsets) 5. MCMC run length should depend on number of parameters 6. Calculate how many times parameters were updated 7. Pay attention to parameter estimates 8. Run without data to explore prior 9. Run long and run often! 10. Future: model selection should include effects of priors

12

13 Top 10 List (of important considerations) 1. Beware arbitrarily truncated priors 2. Branch length priors particularly important 3. Beware high posteriors for very short branch lengths 4. Partition with care (prefer fewer subsets) 5. MCMC run length should depend on number of parameters 6. Calculate how many times parameters were updated 7. Pay attention to parameter estimates 8. Run without data to explore prior 9. Run long and run often! 10. Future: model selection should include effects of priors

14 To conclude Bayesian methods have great potential Are able to take into account uncertainty in parameter estimates Still assume a homogenous Markov model for rates of change in a tree There are still problems that need to be fixed

Bayesian Phylogenetics

Bayesian Phylogenetics Bayesian Phylogenetics Paul O. Lewis Department of Ecology & Evolutionary Biology University of Connecticut Woods Hole Molecular Evolution Workshop, July 27, 2006 2006 Paul O. Lewis Bayesian Phylogenetics

More information

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis

More information

Bayesian inference & Markov chain Monte Carlo. Note 1: Many slides for this lecture were kindly provided by Paul Lewis and Mark Holder

Bayesian inference & Markov chain Monte Carlo. Note 1: Many slides for this lecture were kindly provided by Paul Lewis and Mark Holder Bayesian inference & Markov chain Monte Carlo Note 1: Many slides for this lecture were kindly provided by Paul Lewis and Mark Holder Note 2: Paul Lewis has written nice software for demonstrating Markov

More information

Bayesian Methods for Machine Learning

Bayesian Methods for Machine Learning Bayesian Methods for Machine Learning CS 584: Big Data Analytics Material adapted from Radford Neal s tutorial (http://ftp.cs.utoronto.ca/pub/radford/bayes-tut.pdf), Zoubin Ghahramni (http://hunch.net/~coms-4771/zoubin_ghahramani_bayesian_learning.pdf),

More information

Bayesian Inference using Markov Chain Monte Carlo in Phylogenetic Studies

Bayesian Inference using Markov Chain Monte Carlo in Phylogenetic Studies Bayesian Inference using Markov Chain Monte Carlo in Phylogenetic Studies 1 What is phylogeny? Essay written for the course in Markov Chains 2004 Torbjörn Karfunkel Phylogeny is the evolutionary development

More information

Bayesian Inference and MCMC

Bayesian Inference and MCMC Bayesian Inference and MCMC Aryan Arbabi Partly based on MCMC slides from CSC412 Fall 2018 1 / 18 Bayesian Inference - Motivation Consider we have a data set D = {x 1,..., x n }. E.g each x i can be the

More information

Bayesian Phylogenetics:

Bayesian Phylogenetics: Bayesian Phylogenetics: an introduction Marc A. Suchard msuchard@ucla.edu UCLA Who is this man? How sure are you? The one true tree? Methods we ve learned so far try to find a single tree that best describes

More information

Infer relationships among three species: Outgroup:

Infer relationships among three species: Outgroup: Infer relationships among three species: Outgroup: Three possible trees (topologies): A C B A B C Model probability 1.0 Prior distribution Data (observations) probability 1.0 Posterior distribution Bayes

More information

Who was Bayes? Bayesian Phylogenetics. What is Bayes Theorem?

Who was Bayes? Bayesian Phylogenetics. What is Bayes Theorem? Who was Bayes? Bayesian Phylogenetics Bret Larget Departments of Botany and of Statistics University of Wisconsin Madison October 6, 2011 The Reverand Thomas Bayes was born in London in 1702. He was the

More information

Bayesian Inference. Anders Gorm Pedersen. Molecular Evolution Group Center for Biological Sequence Analysis Technical University of Denmark (DTU)

Bayesian Inference. Anders Gorm Pedersen. Molecular Evolution Group Center for Biological Sequence Analysis Technical University of Denmark (DTU) Bayesian Inference Anders Gorm Pedersen Molecular Evolution Group Center for Biological Sequence Analysis Technical University of Denmark (DTU) Background: Conditional probability A P (B A) = A,B P (A,

More information

Bayesian Phylogenetics

Bayesian Phylogenetics Bayesian Phylogenetics Bret Larget Departments of Botany and of Statistics University of Wisconsin Madison October 6, 2011 Bayesian Phylogenetics 1 / 27 Who was Bayes? The Reverand Thomas Bayes was born

More information

Bayesian Regression Linear and Logistic Regression

Bayesian Regression Linear and Logistic Regression When we want more than point estimates Bayesian Regression Linear and Logistic Regression Nicole Beckage Ordinary Least Squares Regression and Lasso Regression return only point estimates But what if we

More information

Lecture 5. G. Cowan Lectures on Statistical Data Analysis Lecture 5 page 1

Lecture 5. G. Cowan Lectures on Statistical Data Analysis Lecture 5 page 1 Lecture 5 1 Probability (90 min.) Definition, Bayes theorem, probability densities and their properties, catalogue of pdfs, Monte Carlo 2 Statistical tests (90 min.) general concepts, test statistics,

More information

Stat 516, Homework 1

Stat 516, Homework 1 Stat 516, Homework 1 Due date: October 7 1. Consider an urn with n distinct balls numbered 1,..., n. We sample balls from the urn with replacement. Let N be the number of draws until we encounter a ball

More information

Phylogenetics: Bayesian Phylogenetic Analysis. COMP Spring 2015 Luay Nakhleh, Rice University

Phylogenetics: Bayesian Phylogenetic Analysis. COMP Spring 2015 Luay Nakhleh, Rice University Phylogenetics: Bayesian Phylogenetic Analysis COMP 571 - Spring 2015 Luay Nakhleh, Rice University Bayes Rule P(X = x Y = y) = P(X = x, Y = y) P(Y = y) = P(X = x)p(y = y X = x) P x P(X = x 0 )P(Y = y X

More information

Bayesian inference. Fredrik Ronquist and Peter Beerli. October 3, 2007

Bayesian inference. Fredrik Ronquist and Peter Beerli. October 3, 2007 Bayesian inference Fredrik Ronquist and Peter Beerli October 3, 2007 1 Introduction The last few decades has seen a growing interest in Bayesian inference, an alternative approach to statistical inference.

More information

Bayesian phylogenetics. the one true tree? Bayesian phylogenetics

Bayesian phylogenetics. the one true tree? Bayesian phylogenetics Bayesian phylogenetics the one true tree? the methods we ve learned so far try to get a single tree that best describes the data however, they admit that they don t search everywhere, and that it is difficult

More information

Parameter estimation and forecasting. Cristiano Porciani AIfA, Uni-Bonn

Parameter estimation and forecasting. Cristiano Porciani AIfA, Uni-Bonn Parameter estimation and forecasting Cristiano Porciani AIfA, Uni-Bonn Questions? C. Porciani Estimation & forecasting 2 Temperature fluctuations Variance at multipole l (angle ~180o/l) C. Porciani Estimation

More information

CPSC 540: Machine Learning

CPSC 540: Machine Learning CPSC 540: Machine Learning MCMC and Non-Parametric Bayes Mark Schmidt University of British Columbia Winter 2016 Admin I went through project proposals: Some of you got a message on Piazza. No news is

More information

(5) Multi-parameter models - Gibbs sampling. ST440/540: Applied Bayesian Analysis

(5) Multi-parameter models - Gibbs sampling. ST440/540: Applied Bayesian Analysis Summarizing a posterior Given the data and prior the posterior is determined Summarizing the posterior gives parameter estimates, intervals, and hypothesis tests Most of these computations are integrals

More information

Answers and expectations

Answers and expectations Answers and expectations For a function f(x) and distribution P(x), the expectation of f with respect to P is The expectation is the average of f, when x is drawn from the probability distribution P E

More information

MCMC Review. MCMC Review. Gibbs Sampling. MCMC Review

MCMC Review. MCMC Review. Gibbs Sampling. MCMC Review MCMC Review http://jackman.stanford.edu/mcmc/icpsr99.pdf http://students.washington.edu/fkrogsta/bayes/stat538.pdf http://www.stat.berkeley.edu/users/terry/classes/s260.1998 /Week9a/week9a/week9a.html

More information

Markov Chain Monte Carlo methods

Markov Chain Monte Carlo methods Markov Chain Monte Carlo methods By Oleg Makhnin 1 Introduction a b c M = d e f g h i 0 f(x)dx 1.1 Motivation 1.1.1 Just here Supresses numbering 1.1.2 After this 1.2 Literature 2 Method 2.1 New math As

More information

MCMC notes by Mark Holder

MCMC notes by Mark Holder MCMC notes by Mark Holder Bayesian inference Ultimately, we want to make probability statements about true values of parameters, given our data. For example P(α 0 < α 1 X). According to Bayes theorem:

More information

Bayes Nets: Sampling

Bayes Nets: Sampling Bayes Nets: Sampling [These slides were created by Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley. All CS188 materials are available at http://ai.berkeley.edu.] Approximate Inference:

More information

Bayesian Models in Machine Learning

Bayesian Models in Machine Learning Bayesian Models in Machine Learning Lukáš Burget Escuela de Ciencias Informáticas 2017 Buenos Aires, July 24-29 2017 Frequentist vs. Bayesian Frequentist point of view: Probability is the frequency of

More information

Molecular Evolution & Phylogenetics

Molecular Evolution & Phylogenetics Molecular Evolution & Phylogenetics Heuristics based on tree alterations, maximum likelihood, Bayesian methods, statistical confidence measures Jean-Baka Domelevo Entfellner Learning Objectives know basic

More information

STA 4273H: Sta-s-cal Machine Learning

STA 4273H: Sta-s-cal Machine Learning STA 4273H: Sta-s-cal Machine Learning Russ Salakhutdinov Department of Computer Science! Department of Statistical Sciences! rsalakhu@cs.toronto.edu! h0p://www.cs.utoronto.ca/~rsalakhu/ Lecture 2 In our

More information

CS 343: Artificial Intelligence

CS 343: Artificial Intelligence CS 343: Artificial Intelligence Bayes Nets: Sampling Prof. Scott Niekum The University of Texas at Austin [These slides based on those of Dan Klein and Pieter Abbeel for CS188 Intro to AI at UC Berkeley.

More information

Reminder of some Markov Chain properties:

Reminder of some Markov Chain properties: Reminder of some Markov Chain properties: 1. a transition from one state to another occurs probabilistically 2. only state that matters is where you currently are (i.e. given present, future is independent

More information

STAT 499/962 Topics in Statistics Bayesian Inference and Decision Theory Jan 2018, Handout 01

STAT 499/962 Topics in Statistics Bayesian Inference and Decision Theory Jan 2018, Handout 01 STAT 499/962 Topics in Statistics Bayesian Inference and Decision Theory Jan 2018, Handout 01 Nasser Sadeghkhani a.sadeghkhani@queensu.ca There are two main schools to statistical inference: 1-frequentist

More information

How should we go about modeling this? Model parameters? Time Substitution rate Can we observe time or subst. rate? What can we observe?

How should we go about modeling this? Model parameters? Time Substitution rate Can we observe time or subst. rate? What can we observe? How should we go about modeling this? gorilla GAAGTCCTTGAGAAATAAACTGCACACACTGG orangutan GGACTCCTTGAGAAATAAACTGCACACACTGG Model parameters? Time Substitution rate Can we observe time or subst. rate? What

More information

Lecture 12: Bayesian phylogenetics and Markov chain Monte Carlo Will Freyman

Lecture 12: Bayesian phylogenetics and Markov chain Monte Carlo Will Freyman IB200, Spring 2016 University of California, Berkeley Lecture 12: Bayesian phylogenetics and Markov chain Monte Carlo Will Freyman 1 Basic Probability Theory Probability is a quantitative measurement of

More information

Physics 509: Bootstrap and Robust Parameter Estimation

Physics 509: Bootstrap and Robust Parameter Estimation Physics 509: Bootstrap and Robust Parameter Estimation Scott Oser Lecture #20 Physics 509 1 Nonparametric parameter estimation Question: what error estimate should you assign to the slope and intercept

More information

ECE295, Data Assimila0on and Inverse Problems, Spring 2015

ECE295, Data Assimila0on and Inverse Problems, Spring 2015 ECE295, Data Assimila0on and Inverse Problems, Spring 2015 1 April, Intro; Linear discrete Inverse problems (Aster Ch 1 and 2) Slides 8 April, SVD (Aster ch 2 and 3) Slides 15 April, RegularizaFon (ch

More information

Parameter Estimation. William H. Jefferys University of Texas at Austin Parameter Estimation 7/26/05 1

Parameter Estimation. William H. Jefferys University of Texas at Austin Parameter Estimation 7/26/05 1 Parameter Estimation William H. Jefferys University of Texas at Austin bill@bayesrules.net Parameter Estimation 7/26/05 1 Elements of Inference Inference problems contain two indispensable elements: Data

More information

Introduction to Machine Learning

Introduction to Machine Learning Introduction to Machine Learning Brown University CSCI 1950-F, Spring 2012 Prof. Erik Sudderth Lecture 25: Markov Chain Monte Carlo (MCMC) Course Review and Advanced Topics Many figures courtesy Kevin

More information

Statistical Data Analysis Stat 3: p-values, parameter estimation

Statistical Data Analysis Stat 3: p-values, parameter estimation Statistical Data Analysis Stat 3: p-values, parameter estimation London Postgraduate Lectures on Particle Physics; University of London MSci course PH4515 Glen Cowan Physics Department Royal Holloway,

More information

Announcements. Inference. Mid-term. Inference by Enumeration. Reminder: Alarm Network. Introduction to Artificial Intelligence. V22.

Announcements. Inference. Mid-term. Inference by Enumeration. Reminder: Alarm Network. Introduction to Artificial Intelligence. V22. Introduction to Artificial Intelligence V22.0472-001 Fall 2009 Lecture 15: Bayes Nets 3 Midterms graded Assignment 2 graded Announcements Rob Fergus Dept of Computer Science, Courant Institute, NYU Slides

More information

Bayesian Inference. Chapter 1. Introduction and basic concepts

Bayesian Inference. Chapter 1. Introduction and basic concepts Bayesian Inference Chapter 1. Introduction and basic concepts M. Concepción Ausín Department of Statistics Universidad Carlos III de Madrid Master in Business Administration and Quantitative Methods Master

More information

Example. If 4 tickets are drawn with replacement from ,

Example. If 4 tickets are drawn with replacement from , Example. If 4 tickets are drawn with replacement from 1 2 2 4 6, what are the chances that we observe exactly two 2 s? Exactly two 2 s in a sequence of four draws can occur in many ways. For example, (

More information

Informatics 2D Reasoning and Agents Semester 2,

Informatics 2D Reasoning and Agents Semester 2, Informatics 2D Reasoning and Agents Semester 2, 2018 2019 Alex Lascarides alex@inf.ed.ac.uk Lecture 25 Approximate Inference in Bayesian Networks 19th March 2019 Informatics UoE Informatics 2D 1 Where

More information

Estimating Evolutionary Trees. Phylogenetic Methods

Estimating Evolutionary Trees. Phylogenetic Methods Estimating Evolutionary Trees v if the data are consistent with infinite sites then all methods should yield the same tree v it gets more complicated when there is homoplasy, i.e., parallel or convergent

More information

STA414/2104 Statistical Methods for Machine Learning II

STA414/2104 Statistical Methods for Machine Learning II STA414/2104 Statistical Methods for Machine Learning II Murat A. Erdogdu & David Duvenaud Department of Computer Science Department of Statistical Sciences Lecture 3 Slide credits: Russ Salakhutdinov Announcements

More information

Brief introduction to Markov Chain Monte Carlo

Brief introduction to Markov Chain Monte Carlo Brief introduction to Department of Probability and Mathematical Statistics seminar Stochastic modeling in economics and finance November 7, 2011 Brief introduction to Content 1 and motivation Classical

More information

an introduction to bayesian inference

an introduction to bayesian inference with an application to network analysis http://jakehofman.com january 13, 2010 motivation would like models that: provide predictive and explanatory power are complex enough to describe observed phenomena

More information

Bayesian Analysis. Justin Chin. Spring 2018

Bayesian Analysis. Justin Chin. Spring 2018 Bayesian Analysis Justin Chin Spring 2018 Abstract We often think of the field of Statistics simply as data collection and analysis. While the essence of Statistics lies in numeric analysis of observed

More information

Statistical Methods in Particle Physics Lecture 1: Bayesian methods

Statistical Methods in Particle Physics Lecture 1: Bayesian methods Statistical Methods in Particle Physics Lecture 1: Bayesian methods SUSSP65 St Andrews 16 29 August 2009 Glen Cowan Physics Department Royal Holloway, University of London g.cowan@rhul.ac.uk www.pp.rhul.ac.uk/~cowan

More information

Computational statistics

Computational statistics Computational statistics Markov Chain Monte Carlo methods Thierry Denœux March 2017 Thierry Denœux Computational statistics March 2017 1 / 71 Contents of this chapter When a target density f can be evaluated

More information

Introduc)on to Bayesian Methods

Introduc)on to Bayesian Methods Introduc)on to Bayesian Methods Bayes Rule py x)px) = px! y) = px y)py) py x) = px y)py) px) px) =! px! y) = px y)py) y py x) = py x) =! y "! y px y)py) px y)py) px y)py) px y)py)dy Bayes Rule py x) =

More information

Stat 535 C - Statistical Computing & Monte Carlo Methods. Arnaud Doucet.

Stat 535 C - Statistical Computing & Monte Carlo Methods. Arnaud Doucet. Stat 535 C - Statistical Computing & Monte Carlo Methods Arnaud Doucet Email: arnaud@cs.ubc.ca 1 CS students: don t forget to re-register in CS-535D. Even if you just audit this course, please do register.

More information

Frequentist Statistics and Hypothesis Testing Spring

Frequentist Statistics and Hypothesis Testing Spring Frequentist Statistics and Hypothesis Testing 18.05 Spring 2018 http://xkcd.com/539/ Agenda Introduction to the frequentist way of life. What is a statistic? NHST ingredients; rejection regions Simple

More information

One-minute responses. Nice class{no complaints. Your explanations of ML were very clear. The phylogenetics portion made more sense to me today.

One-minute responses. Nice class{no complaints. Your explanations of ML were very clear. The phylogenetics portion made more sense to me today. One-minute responses Nice class{no complaints. Your explanations of ML were very clear. The phylogenetics portion made more sense to me today. The pace/material covered for likelihoods was more dicult

More information

Advanced Statistical Methods. Lecture 6

Advanced Statistical Methods. Lecture 6 Advanced Statistical Methods Lecture 6 Convergence distribution of M.-H. MCMC We denote the PDF estimated by the MCMC as. It has the property Convergence distribution After some time, the distribution

More information

Introduction to Machine Learning CMU-10701

Introduction to Machine Learning CMU-10701 Introduction to Machine Learning CMU-10701 Markov Chain Monte Carlo Methods Barnabás Póczos & Aarti Singh Contents Markov Chain Monte Carlo Methods Goal & Motivation Sampling Rejection Importance Markov

More information

COMP90051 Statistical Machine Learning

COMP90051 Statistical Machine Learning COMP90051 Statistical Machine Learning Semester 2, 2017 Lecturer: Trevor Cohn 2. Statistical Schools Adapted from slides by Ben Rubinstein Statistical Schools of Thought Remainder of lecture is to provide

More information

Bayes Networks. CS540 Bryan R Gibson University of Wisconsin-Madison. Slides adapted from those used by Prof. Jerry Zhu, CS540-1

Bayes Networks. CS540 Bryan R Gibson University of Wisconsin-Madison. Slides adapted from those used by Prof. Jerry Zhu, CS540-1 Bayes Networks CS540 Bryan R Gibson University of Wisconsin-Madison Slides adapted from those used by Prof. Jerry Zhu, CS540-1 1 / 59 Outline Joint Probability: great for inference, terrible to obtain

More information

Statistics: Learning models from data

Statistics: Learning models from data DS-GA 1002 Lecture notes 5 October 19, 2015 Statistics: Learning models from data Learning models from data that are assumed to be generated probabilistically from a certain unknown distribution is a crucial

More information

Inference in Bayesian Networks

Inference in Bayesian Networks Andrea Passerini passerini@disi.unitn.it Machine Learning Inference in graphical models Description Assume we have evidence e on the state of a subset of variables E in the model (i.e. Bayesian Network)

More information

Monte Carlo in Bayesian Statistics

Monte Carlo in Bayesian Statistics Monte Carlo in Bayesian Statistics Matthew Thomas SAMBa - University of Bath m.l.thomas@bath.ac.uk December 4, 2014 Matthew Thomas (SAMBa) Monte Carlo in Bayesian Statistics December 4, 2014 1 / 16 Overview

More information

The Ising model and Markov chain Monte Carlo

The Ising model and Markov chain Monte Carlo The Ising model and Markov chain Monte Carlo Ramesh Sridharan These notes give a short description of the Ising model for images and an introduction to Metropolis-Hastings and Gibbs Markov Chain Monte

More information

MCMC: Markov Chain Monte Carlo

MCMC: Markov Chain Monte Carlo I529: Machine Learning in Bioinformatics (Spring 2013) MCMC: Markov Chain Monte Carlo Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington Spring 2013 Contents Review of Markov

More information

Chris Fraley and Daniel Percival. August 22, 2008, revised May 14, 2010

Chris Fraley and Daniel Percival. August 22, 2008, revised May 14, 2010 Model-Averaged l 1 Regularization using Markov Chain Monte Carlo Model Composition Technical Report No. 541 Department of Statistics, University of Washington Chris Fraley and Daniel Percival August 22,

More information

Machine Learning for Data Science (CS4786) Lecture 24

Machine Learning for Data Science (CS4786) Lecture 24 Machine Learning for Data Science (CS4786) Lecture 24 Graphical Models: Approximate Inference Course Webpage : http://www.cs.cornell.edu/courses/cs4786/2016sp/ BELIEF PROPAGATION OR MESSAGE PASSING Each

More information

Bayesian Estimation of Input Output Tables for Russia

Bayesian Estimation of Input Output Tables for Russia Bayesian Estimation of Input Output Tables for Russia Oleg Lugovoy (EDF, RANE) Andrey Polbin (RANE) Vladimir Potashnikov (RANE) WIOD Conference April 24, 2012 Groningen Outline Motivation Objectives Bayesian

More information

Machine Learning CSE546 Carlos Guestrin University of Washington. September 30, 2013

Machine Learning CSE546 Carlos Guestrin University of Washington. September 30, 2013 Bayesian Methods Machine Learning CSE546 Carlos Guestrin University of Washington September 30, 2013 1 What about prior n Billionaire says: Wait, I know that the thumbtack is close to 50-50. What can you

More information

Introduction to Bayesian Statistics and Markov Chain Monte Carlo Estimation. EPSY 905: Multivariate Analysis Spring 2016 Lecture #10: April 6, 2016

Introduction to Bayesian Statistics and Markov Chain Monte Carlo Estimation. EPSY 905: Multivariate Analysis Spring 2016 Lecture #10: April 6, 2016 Introduction to Bayesian Statistics and Markov Chain Monte Carlo Estimation EPSY 905: Multivariate Analysis Spring 2016 Lecture #10: April 6, 2016 EPSY 905: Intro to Bayesian and MCMC Today s Class An

More information

CS 361: Probability & Statistics

CS 361: Probability & Statistics October 17, 2017 CS 361: Probability & Statistics Inference Maximum likelihood: drawbacks A couple of things might trip up max likelihood estimation: 1) Finding the maximum of some functions can be quite

More information

Bayesian philosophy Bayesian computation Bayesian software. Bayesian Statistics. Petter Mostad. Chalmers. April 6, 2017

Bayesian philosophy Bayesian computation Bayesian software. Bayesian Statistics. Petter Mostad. Chalmers. April 6, 2017 Chalmers April 6, 2017 Bayesian philosophy Bayesian philosophy Bayesian statistics versus classical statistics: War or co-existence? Classical statistics: Models have variables and parameters; these are

More information

Markov Chain Monte Carlo (MCMC) and Model Evaluation. August 15, 2017

Markov Chain Monte Carlo (MCMC) and Model Evaluation. August 15, 2017 Markov Chain Monte Carlo (MCMC) and Model Evaluation August 15, 2017 Frequentist Linking Frequentist and Bayesian Statistics How can we estimate model parameters and what does it imply? Want to find the

More information

CLASS NOTES Models, Algorithms and Data: Introduction to computing 2018

CLASS NOTES Models, Algorithms and Data: Introduction to computing 2018 CLASS NOTES Models, Algorithms and Data: Introduction to computing 208 Petros Koumoutsakos, Jens Honore Walther (Last update: June, 208) IMPORTANT DISCLAIMERS. REFERENCES: Much of the material (ideas,

More information

Approximate Bayesian Computation: a simulation based approach to inference

Approximate Bayesian Computation: a simulation based approach to inference Approximate Bayesian Computation: a simulation based approach to inference Richard Wilkinson Simon Tavaré 2 Department of Probability and Statistics University of Sheffield 2 Department of Applied Mathematics

More information

Machine Learning using Bayesian Approaches

Machine Learning using Bayesian Approaches Machine Learning using Bayesian Approaches Sargur N. Srihari University at Buffalo, State University of New York 1 Outline 1. Progress in ML and PR 2. Fully Bayesian Approach 1. Probability theory Bayes

More information

Molecular Epidemiology Workshop: Bayesian Data Analysis

Molecular Epidemiology Workshop: Bayesian Data Analysis Molecular Epidemiology Workshop: Bayesian Data Analysis Jay Taylor and Ananias Escalante School of Mathematical and Statistical Sciences Center for Evolutionary Medicine and Informatics Arizona State University

More information

Point Estimation. Vibhav Gogate The University of Texas at Dallas

Point Estimation. Vibhav Gogate The University of Texas at Dallas Point Estimation Vibhav Gogate The University of Texas at Dallas Some slides courtesy of Carlos Guestrin, Chris Bishop, Dan Weld and Luke Zettlemoyer. Basics: Expectation and Variance Binary Variables

More information

Advanced Statistical Modelling

Advanced Statistical Modelling Markov chain Monte Carlo (MCMC) Methods and Their Applications in Bayesian Statistics School of Technology and Business Studies/Statistics Dalarna University Borlänge, Sweden. Feb. 05, 2014. Outlines 1

More information

Inconsistency of Bayesian inference when the model is wrong, and how to repair it

Inconsistency of Bayesian inference when the model is wrong, and how to repair it Inconsistency of Bayesian inference when the model is wrong, and how to repair it Peter Grünwald Thijs van Ommen Centrum Wiskunde & Informatica, Amsterdam Universiteit Leiden June 3, 2015 Outline 1 Introduction

More information

Approximate Inference

Approximate Inference Approximate Inference Simulation has a name: sampling Sampling is a hot topic in machine learning, and it s really simple Basic idea: Draw N samples from a sampling distribution S Compute an approximate

More information

The Particle Filter. PD Dr. Rudolph Triebel Computer Vision Group. Machine Learning for Computer Vision

The Particle Filter. PD Dr. Rudolph Triebel Computer Vision Group. Machine Learning for Computer Vision The Particle Filter Non-parametric implementation of Bayes filter Represents the belief (posterior) random state samples. by a set of This representation is approximate. Can represent distributions that

More information

(1) Introduction to Bayesian statistics

(1) Introduction to Bayesian statistics Spring, 2018 A motivating example Student 1 will write down a number and then flip a coin If the flip is heads, they will honestly tell student 2 if the number is even or odd If the flip is tails, they

More information

Markov Chain Monte Carlo methods

Markov Chain Monte Carlo methods Markov Chain Monte Carlo methods Tomas McKelvey and Lennart Svensson Signal Processing Group Department of Signals and Systems Chalmers University of Technology, Sweden November 26, 2012 Today s learning

More information

ST 740: Markov Chain Monte Carlo

ST 740: Markov Chain Monte Carlo ST 740: Markov Chain Monte Carlo Alyson Wilson Department of Statistics North Carolina State University October 14, 2012 A. Wilson (NCSU Stsatistics) MCMC October 14, 2012 1 / 20 Convergence Diagnostics:

More information

Bayesian Networks. Motivation

Bayesian Networks. Motivation Bayesian Networks Computer Sciences 760 Spring 2014 http://pages.cs.wisc.edu/~dpage/cs760/ Motivation Assume we have five Boolean variables,,,, The joint probability is,,,, How many state configurations

More information

Forward Problems and their Inverse Solutions

Forward Problems and their Inverse Solutions Forward Problems and their Inverse Solutions Sarah Zedler 1,2 1 King Abdullah University of Science and Technology 2 University of Texas at Austin February, 2013 Outline 1 Forward Problem Example Weather

More information

PROBABILISTIC REASONING SYSTEMS

PROBABILISTIC REASONING SYSTEMS PROBABILISTIC REASONING SYSTEMS In which we explain how to build reasoning systems that use network models to reason with uncertainty according to the laws of probability theory. Outline Knowledge in uncertain

More information

Results: MCMC Dancers, q=10, n=500

Results: MCMC Dancers, q=10, n=500 Motivation Sampling Methods for Bayesian Inference How to track many INTERACTING targets? A Tutorial Frank Dellaert Results: MCMC Dancers, q=10, n=500 1 Probabilistic Topological Maps Results Real-Time

More information

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!

Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis

More information

Bayesian Methods in Multilevel Regression

Bayesian Methods in Multilevel Regression Bayesian Methods in Multilevel Regression Joop Hox MuLOG, 15 september 2000 mcmc What is Statistics?! Statistics is about uncertainty To err is human, to forgive divine, but to include errors in your design

More information

Unobservable Parameter. Observed Random Sample. Calculate Posterior. Choosing Prior. Conjugate prior. population proportion, p prior:

Unobservable Parameter. Observed Random Sample. Calculate Posterior. Choosing Prior. Conjugate prior. population proportion, p prior: Pi Priors Unobservable Parameter population proportion, p prior: π ( p) Conjugate prior π ( p) ~ Beta( a, b) same PDF family exponential family only Posterior π ( p y) ~ Beta( a + y, b + n y) Observed

More information

STA 4273H: Statistical Machine Learning

STA 4273H: Statistical Machine Learning STA 4273H: Statistical Machine Learning Russ Salakhutdinov Department of Computer Science! Department of Statistical Sciences! rsalakhu@cs.toronto.edu! h0p://www.cs.utoronto.ca/~rsalakhu/ Lecture 7 Approximate

More information

Comparison of Bayesian and Frequentist Inference

Comparison of Bayesian and Frequentist Inference Comparison of Bayesian and Frequentist Inference 18.05 Spring 2014 First discuss last class 19 board question, January 1, 2017 1 /10 Compare Bayesian inference Uses priors Logically impeccable Probabilities

More information

ST 740: Model Selection

ST 740: Model Selection ST 740: Model Selection Alyson Wilson Department of Statistics North Carolina State University November 25, 2013 A. Wilson (NCSU Statistics) Model Selection November 25, 2013 1 / 29 Formal Bayesian Model

More information

Statistical Inference for Stochastic Epidemic Models

Statistical Inference for Stochastic Epidemic Models Statistical Inference for Stochastic Epidemic Models George Streftaris 1 and Gavin J. Gibson 1 1 Department of Actuarial Mathematics & Statistics, Heriot-Watt University, Riccarton, Edinburgh EH14 4AS,

More information

QTL model selection: key players

QTL model selection: key players Bayesian Interval Mapping. Bayesian strategy -9. Markov chain sampling 0-7. sampling genetic architectures 8-5 4. criteria for model selection 6-44 QTL : Bayes Seattle SISG: Yandell 008 QTL model selection:

More information

Bayesian Inference in Astronomy & Astrophysics A Short Course

Bayesian Inference in Astronomy & Astrophysics A Short Course Bayesian Inference in Astronomy & Astrophysics A Short Course Tom Loredo Dept. of Astronomy, Cornell University p.1/37 Five Lectures Overview of Bayesian Inference From Gaussians to Periodograms Learning

More information

27 : Distributed Monte Carlo Markov Chain. 1 Recap of MCMC and Naive Parallel Gibbs Sampling

27 : Distributed Monte Carlo Markov Chain. 1 Recap of MCMC and Naive Parallel Gibbs Sampling 10-708: Probabilistic Graphical Models 10-708, Spring 2014 27 : Distributed Monte Carlo Markov Chain Lecturer: Eric P. Xing Scribes: Pengtao Xie, Khoa Luu In this scribe, we are going to review the Parallel

More information

CS 188: Artificial Intelligence. Bayes Nets

CS 188: Artificial Intelligence. Bayes Nets CS 188: Artificial Intelligence Probabilistic Inference: Enumeration, Variable Elimination, Sampling Pieter Abbeel UC Berkeley Many slides over this course adapted from Dan Klein, Stuart Russell, Andrew

More information

Bagging During Markov Chain Monte Carlo for Smoother Predictions

Bagging During Markov Chain Monte Carlo for Smoother Predictions Bagging During Markov Chain Monte Carlo for Smoother Predictions Herbert K. H. Lee University of California, Santa Cruz Abstract: Making good predictions from noisy data is a challenging problem. Methods

More information

Accounting for Phylogenetic Uncertainty in Comparative Studies: MCMC and MCMCMC Approaches. Mark Pagel Reading University.

Accounting for Phylogenetic Uncertainty in Comparative Studies: MCMC and MCMCMC Approaches. Mark Pagel Reading University. Accounting for Phylogenetic Uncertainty in Comparative Studies: MCMC and MCMCMC Approaches Mark Pagel Reading University m.pagel@rdg.ac.uk Phylogeny of the Ascomycota Fungi showing the evolution of lichen-formation

More information

An introduction to Bayesian reasoning in particle physics

An introduction to Bayesian reasoning in particle physics An introduction to Bayesian reasoning in particle physics Graduiertenkolleg seminar, May 15th 2013 Overview Overview A concrete example Scientific reasoning Probability and the Bayesian interpretation

More information