A Mathematical Model of the Genetic Code, the Origin of Protein Coding, and the Ribosome as a Dynamical Molecular Machine

Transcription

1 A Mathematical Model of the Genetic Code, the Origin of Protein Coding, and the Ribosome as a Dynamical Molecular Machine Diego L. Gonzalez CNR- IMM Is)tuto per la Microele4ronica e i Microsistemi Dipar)mento di Sta)s)ca Università di Bologna Workshop on Dynamical Systems and Applica)ons BCAM December

2 The Origin of the Genetic code and Protein Coding The origin of the code is perhaps the most perplexing problem in evolutionary biology. The existing translation machinery is at the same time so complex, so universal and so essential that is hard to see how it could have come into existence, or how life could have existed without it Smith and Szathmary, The Major Transitions in Evolution Oxford university Press, New York (1995). Is it possible to obtain new insight on this problem on a first principles basis? The genetic code is not immediately dictated by any known physics or chemistry it evokes the scary spectra of irreducible complexity Wolf and Kooning, On the origin of the translation system and the genetic code, Biol Direct 2, 14 (2007). We present here a mathematical model of the genetic code that furnishes new first principles insight on the origin of the genetic code and protein coding The main motivation of our model is the search for error detection/correction mechanisms that should use the redundancy of genetic information Workshop on Dynamical Systems and Applica)ons BCAM December

3 Fundamental Dogma of Molecular Biology DNA molecules GENETIC CODE Messenger RNA PROTEIN Thymine (T) Uracil (U) Protein Synthesis Adenine, Thymine, Guanine, Cytosine REPLICATION TRANSCRIPTION TRANSLATION Workshop on Dynamical Systems and Applica)ons BCAM December

4 Symbolic Coding of Genetic Information DNA (T,C,A,G) Thymine» Uracil mrna (U,C,A,G) Codons Three-letter groups Amino acids TACGGCATGGTGATAGCCCTTA ATGCCGTACCACTATCGGGAAT TRANSCRIPTION (mrna Synthesis) AUGCCGUACCACUAUCGGGAAU AUG CCG UAC CAC UAU CGG GAA U Met Pro Tyr Gln Tyr Arg Stop TRANSLATION (Protein Synthesis) Workshop on Dynamical Systems and Applica)ons BCAM December

5 Protein Synthesis Workshop on Dynamical Systems and Applica)ons BCAM December

6 The Nuclear Genetic Code Workshop on Dynamical Systems and Applica)ons BCAM December

7 The Genetic Code as a Mapping 64 codons; 4x4x4 = 64 (Words of three letters from an alphabet of four, i.e., A, T, C, G) 20 amino acids + Stop codon (Methyonine represents also the synthesis start signal) Redundancy and Degeneracy follow Workshop on Dynamical Systems and Applica)ons BCAM December

8 Degeneracy Distribution of the Genetic Code Degeneracy distribu)on inside quartets Cys Euplotes nuclear gene)c code Workshop on Dynamical Systems and Applica)ons BCAM December

9 Outline 1. Description of the degeneracy distribution of the Euplotes nuclear genetic code with a redundant integer number representation system 2. Isomorphisms and models, the role of symmetries in the construction of a non-power model of the Euplotes nuclear genetic code 3. Modelling of the vertebrate mitochondrial genetic code and the origin of degeneracy in amino acid s coding Workshop on Dynamical Systems and Applica)ons BCAM December

10 Outline 1. Description of the degeneracy distribution of the Euplotes nuclear genetic code with a redundant integer number representation system 2. Isomorphisms and models, the role of symmetries in the construction of a non-power model of the Euplotes nuclear genetic code 3. Modelling of the vertebrate mitochondrial genetic code and the origin of degeneracy in amino acid s coding Workshop on Dynamical Systems and Applica)ons BCAM December

11 Outline 1. Description of the degeneracy distribution of the Euplotes nuclear genetic code with a redundant integer number representation system 2. Isomorphisms and models, the role of symmetries in the construction of a non-power model of the Euplotes nuclear genetic code 3. Modelling of the vertebrate mitochondrial genetic code and the origin of degeneracy in amino acid s coding Workshop on Dynamical Systems and Applica)ons BCAM December

12 Outline 1. Description of the degeneracy distribution of the Euplotes nuclear genetic code with a redundant integer number representation system 2. Isomorphisms and models, the role of symmetries in the construction of a non-power model of the Euplotes nuclear genetic code 3. Modelling of the vertebrate mitochondrial genetic code and the origin of degeneracy in amino acid s coding Workshop on Dynamical Systems and Applica)ons BCAM December

13 Mathematical model: integer number representation systems Usual positional notation power representation systems base k d 5 d 4 d 3 d 2 d 1 d 0 Digits: d i (0, (k-1)) k 5 k 4 k 3 k 2 k 1 k 0 R (integer) = d 5 k 5 + d 4 k 4 + d 3 k 3 + d 2 k 2 + d 1 k 1 + d 0 k 0 Univocity condition: (k 1) Example 1: k=10; decimal system m k n n=0 = k m+1 1 Digits: d i (0, 9) R = = 19 Workshop on Dynamical Systems and Applica)ons BCAM December

14 Redundant representation systems Example 2: Binary power system Digits: d i (0, 1) R = = 19 Redundant Power Representations Using Out-of-Range Digits Example 3: Binary signed digits with three possible values: -1, 0, R = = 19 Redundant Workshop on Dynamical Systems and Applica)ons BCAM December

15 Non-power redundant representation systems posi)onal bases grow slowly than the powers of k Example 4: k=2; Fibonacci system Digits: d i (0, 1) R = = 19 Non-power representation systems are redundant, for example, the number 19 can be represented in the Fibonacci system in another alternative way: Maya serpent numbers R = = 19 Workshop on Dynamical Systems and Applica)ons BCAM December

16 Fibonacci s non-power representation system Degeneracy Number Signed Binary Fibonacci System Genetic Code Workshop on Dynamical Systems and Applica)ons BCAM December

17 Non-power representation system 1,1,2,4,7,8! Represented) number! Length 6 binary strings ) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) 0) ) 0) 0) 0) 0) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 1) ) 0) 0) 0) 0) 0) 1) ) 0) 0) 0) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 2) ) 0) 0) 0) 0) 1) 1) ) 0) 0) 0) 1) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 3) ) 0) 0) 0) 1) 0) 1) ) 0) 0) 0) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 4) ) 0) 0) 1) 0) 0) 0) ) 0) 0) 0) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 5) ) 0) 0) 1) 0) 0) 1) ) 0) 0) 1) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 6) ) 0) 0) 1) 1) 0) 0) ) 0) 0) 1) 0) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 7) ) 0) 0) 1) 1) 0) 1) ) 0) 0) 1) 1) 1) 0) ) 0) 1) 0) 0) 0) 0) ) ) ) ) ) ) ) 8) ) 0) 1) 0) 0) 0) 1) ) 0) 1) 0) 0) 1) 0) ) 1) 0) 0) 0) 0) 0) ) 0) 0) 1) 1) 1) 1) 9) ) 1) 0) 0) 0) 0) 1) ) 1) 0) 0) 0) 1) 0) ) 0) 1) 0) 1) 0) 0) ) 0) 1) 0) 0) 1) 1) 10) ) 0) 1) 0) 1) 0) 1) ) 0) 1) 0) 1) 1) 0) ) 1) 0) 0) 1) 0) 0) ) 1) 0) 0) 0) 1) 1) 11) ) 1) 0) 0) 1) 0) 1) ) 1) 0) 0) 1) 1) 0) ) 0) 1) 1) 0) 0) 0) ) 0) 1) 0) 1) 1) 1) 12) ) 0) 1) 1) 0) 0) 1) ) 0) 1) 1) 0) 1) 0) ) 1) 0) 1) 0) 0) 0) ) 1) 0) 0) 1) 1) 1) 13) ) 1) 0) 1) 0) 0) 1) ) 1) 0) 1) 0) 1) 0) ) 0) 1) 1) 1) 0) 0) ) 0) 1) 1) 0) 1) 1) 14) ) 0) 1) 1) 1) 0) 1) ) 0) 1) 1) 1) 1) 0) ) 1) 0) 1) 1) 0) 0) ) 1) 0) 1) 0) 1) 1) 15) ) 1) 0) 1) 1) 0) 1) ) 1) 0) 1) 1) 1) 0) ) 1) 1) 0) 0) 0) 0) ) 0) 1) 1) 1) 1) 1) 16) ) 1) 1) 0) 0) 0) 1) ) 1) 1) 0) 0) 1) 0) ) 1) 0) 1) 1) 1) 1) ) ) ) ) ) ) ) 17) ) 1) 1) 0) 0) 1) 1) ) 1) 1) 0) 1) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 18) ) 1) 1) 0) 1) 0) 1) ) 1) 1) 0) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 19) ) 1) 1) 1) 0) 1) 1) ) 1) 1) 0) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 20) ) 1) 1) 1) 0) 0) 1) ) 1) 1) 1) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 21) ) 1) 1) 1) 1) 0) 0) ) 1) 1) 1) 0) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 22) ) 1) 1) 1) 1) 0) 1) ) 1) 1) 1) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 23) ) 1) 1) 1) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) Degeneracy distribution Non-power representation system 1,1,2,4,7,8 # of integer Degeneracy numbers Unique solution 1,1,2,4,7,8 Degeneracy distribution Euplotes nuclear genetic code # of amino acids Degeneracy Workshop on Dynamical Systems and Applica)ons BCAM December

18 Outline 1. Description of the degeneracy distribution of the Euplotes nuclear genetic code with a redundant integer number representation system 2. Isomorphisms and models, the role of symmetries in the construction of a non-power model of the Euplotes nuclear genetic code 3. Modelling of the vertebrate mitochondrial genetic code and the origin of degeneracy in amino acid s coding Workshop on Dynamical Systems and Applica)ons BCAM December

19 From a structural isomorphism to a true model GENETIC CODE 64 Codons 24 (aa + signs) NON-POWER REPRESENTATION SYMMETRY 64 Binary strings 24 Integer numbers Workshop on Dynamical Systems and Applica)ons BCAM December

20 Symmetry of U ç è C exchange NNU and NNC codify the same amino acid 16 pairs of codons NNU - NNC U C A G U C A G UUU UCU UAU UGU U Phe Tyr UUC UCC UAC Cys UGC C Ser UUA UCA UAA UGA A Leu Stop UUG UCG UAG Trp UGG G CUU CCU CAU CGU U His CUC CCC CAC CGC C Leu Pro Arg CUA CCA CAA CGA A Gln CUG CCG CAG CGG G AUU ACU AAU AGU U Asn Ser Ile AUC ACC AAC AGC C Thr AUA ACA AAA AGA A Lys Arg Met AUG ACG AAG AGG G GUU GCU GAU GGU U Asp GUC GCC GAC GGC C Val Ala Gly GUA GCA GAA GGA A Glu GUG GCG GAG GGG G Common to all known versions of the genetic code Workshop on Dynamical Systems and Applica)ons BCAM December

21 Symmetry of U ç è C exchange NNU and NNC codify the same amino acid 16 pairs of codons NNU - NNC U C A G U C A G UUU UCU UAU UGU U Phe Tyr UUC UCC UAC Cys UGC C Ser UUA UCA UAA UGA A Leu Stop UUG UCG UAG Trp UGG G CUU CCU CAU CGU U His CUC CCC CAC CGC C Leu Pro Arg CUA CCA CAA CGA A Gln CUG CCG CAG CGG G AUU ACU AAU AGU U Asn Ser Ile AUC ACC AAC AGC C Thr AUA ACA AAA AGA A Lys Arg Met AUG ACG AAG AGG G GUU GCU GAU GGU U Asp GUC GCC GAC GGC C Val Ala Gly GUA GCA GAA GGA A Glu GUG GCG GAG GGG G Common to all known versions of the genetic code Workshop on Dynamical Systems and Applica)ons BCAM December

22 Non-power representation system 1,1,2,4,7,8! Represented) number! Length 6 binary strings ) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) 0) ) 0) 0) 0) 0) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 1) ) 0) 0) 0) 0) 0) 1) ) 0) 0) 0) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 2) ) 0) 0) 0) 0) 1) 1) ) 0) 0) 0) 1) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 3) ) 0) 0) 0) 1) 0) 1) ) 0) 0) 0) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 4) ) 0) 0) 1) 0) 0) 0) ) 0) 0) 0) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 5) ) 0) 0) 1) 0) 0) 1) ) 0) 0) 1) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 6) ) 0) 0) 1) 1) 0) 0) ) 0) 0) 1) 0) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 7) ) 0) 0) 1) 1) 0) 1) ) 0) 0) 1) 1) 1) 0) ) 0) 1) 0) 0) 0) 0) ) ) ) ) ) ) ) 8) ) 0) 1) 0) 0) 0) 1) ) 0) 1) 0) 0) 1) 0) ) 1) 0) 0) 0) 0) 0) ) 0) 0) 1) 1) 1) 1) 9) ) 1) 0) 0) 0) 0) 1) ) 1) 0) 0) 0) 1) 0) ) 0) 1) 0) 1) 0) 0) ) 0) 1) 0) 0) 1) 1) 10) ) 0) 1) 0) 1) 0) 1) ) 0) 1) 0) 1) 1) 0) ) 1) 0) 0) 1) 0) 0) ) 1) 0) 0) 0) 1) 1) 11) ) 1) 0) 0) 1) 0) 1) ) 1) 0) 0) 1) 1) 0) ) 0) 1) 1) 0) 0) 0) ) 0) 1) 0) 1) 1) 1) 12) ) 0) 1) 1) 0) 0) 1) ) 0) 1) 1) 0) 1) 0) ) 1) 0) 1) 0) 0) 0) ) 1) 0) 0) 1) 1) 1) 13) ) 1) 0) 1) 0) 0) 1) ) 1) 0) 1) 0) 1) 0) ) 0) 1) 1) 1) 0) 0) ) 0) 1) 1) 0) 1) 1) 14) ) 0) 1) 1) 1) 0) 1) ) 0) 1) 1) 1) 1) 0) ) 1) 0) 1) 1) 0) 0) ) 1) 0) 1) 0) 1) 1) 15) ) 1) 0) 1) 1) 0) 1) ) 1) 0) 1) 1) 1) 0) ) 1) 1) 0) 0) 0) 0) ) 0) 1) 1) 1) 1) 1) 16) ) 1) 1) 0) 0) 0) 1) ) 1) 1) 0) 0) 1) 0) ) 1) 0) 1) 1) 1) 1) ) ) ) ) ) ) ) 17) ) 1) 1) 0) 0) 1) 1) ) 1) 1) 0) 1) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 18) ) 1) 1) 0) 1) 0) 1) ) 1) 1) 0) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 19) ) 1) 1) 1) 0) 1) 1) ) 1) 1) 0) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 20) ) 1) 1) 1) 0) 0) 1) ) 1) 1) 1) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 21) ) 1) 1) 1) 1) 0) 0) ) 1) 1) 1) 0) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 22) ) 1) 1) 1) 1) 0) 1) ) 1) 1) 1) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 23) ) 1) 1) 1) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) Degeneracy distribution Non-power representation system 1,1,2,4,7,8 # of integer Degeneracy numbers Unique solution 1,1,2,4,7,8 Degeneracy distribution Euplotes nuclear genetic code # of amino acids Degeneracy Workshop on Dynamical Systems and Applica)ons BCAM December

23 Symmetry of xxxx01 ç è xxxx10 exchange! Represented) number! Length 6 binary strings ) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) 0) ) 0) 0) 0) 0) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 1) ) 0) 0) 0) 0) 0) 1) ) 0) 0) 0) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 2) ) 0) 0) 0) 0) 1) 1) ) 0) 0) 0) 1) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 3) ) 0) 0) 0) 1) 0) 1) ) 0) 0) 0) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 4) ) 0) 0) 1) 0) 0) 0) ) 0) 0) 0) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 5) ) 0) 0) 1) 0) 0) 1) ) 0) 0) 1) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 6) ) 0) 0) 1) 1) 0) 0) ) 0) 0) 1) 0) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 7) ) 0) 0) 1) 1) 0) 1) ) 0) 0) 1) 1) 1) 0) ) 0) 1) 0) 0) 0) 0) ) ) ) ) ) ) ) 8) ) 0) 1) 0) 0) 0) 1) ) 0) 1) 0) 0) 1) 0) ) 1) 0) 0) 0) 0) 0) ) 0) 0) 1) 1) 1) 1) 9) ) 1) 0) 0) 0) 0) 1) ) 1) 0) 0) 0) 1) 0) ) 0) 1) 0) 1) 0) 0) ) 0) 1) 0) 0) 1) 1) 10) ) 0) 1) 0) 1) 0) 1) ) 0) 1) 0) 1) 1) 0) ) 1) 0) 0) 1) 0) 0) ) 1) 0) 0) 0) 1) 1) 11) ) 1) 0) 0) 1) 0) 1) ) 1) 0) 0) 1) 1) 0) ) 0) 1) 1) 0) 0) 0) ) 0) 1) 0) 1) 1) 1) 12) ) 0) 1) 1) 0) 0) 1) ) 0) 1) 1) 0) 1) 0) ) 1) 0) 1) 0) 0) 0) ) 1) 0) 0) 1) 1) 1) 13) ) 1) 0) 1) 0) 0) 1) ) 1) 0) 1) 0) 1) 0) ) 0) 1) 1) 1) 0) 0) ) 0) 1) 1) 0) 1) 1) 14) ) 0) 1) 1) 1) 0) 1) ) 0) 1) 1) 1) 1) 0) ) 1) 0) 1) 1) 0) 0) ) 1) 0) 1) 0) 1) 1) 15) ) 1) 0) 1) 1) 0) 1) ) 1) 0) 1) 1) 1) 0) ) 1) 1) 0) 0) 0) 0) ) 0) 1) 1) 1) 1) 1) 16) ) 1) 1) 0) 0) 0) 1) ) 1) 1) 0) 0) 1) 0) ) 1) 0) 1) 1) 1) 1) ) ) ) ) ) ) ) 17) ) 1) 1) 0) 0) 1) 1) ) 1) 1) 0) 1) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 18) ) 1) 1) 0) 1) 0) 1) ) 1) 1) 0) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 19) ) 1) 1) 1) 0) 1) 1) ) 1) 1) 0) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 20) ) 1) 1) 1) 0) 0) 1) ) 1) 1) 1) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 21) ) 1) 1) 1) 1) 0) 0) ) 1) 1) 1) 0) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 22) ) 1) 1) 1) 1) 0) 1) ) 1) 1) 1) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 23) ) 1) 1) 1) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) xxxx01 and xxxx10 codify the same integer number 16 pairs of strings xxxx01 xxxx10 Workshop on Dynamical Systems and Applica)ons BCAM December

24 Symmetry of xxxx01 ç è xxxx10 exchange! Represented) number! Length 6 binary strings ) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) 0) ) 0) 0) 0) 0) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 1) ) 0) 0) 0) 0) 0) 1) ) 0) 0) 0) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 2) ) 0) 0) 0) 0) 1) 1) ) 0) 0) 0) 1) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 3) ) 0) 0) 0) 1) 0) 1) ) 0) 0) 0) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 4) ) 0) 0) 1) 0) 0) 0) ) 0) 0) 0) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 5) ) 0) 0) 1) 0) 0) 1) ) 0) 0) 1) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 6) ) 0) 0) 1) 1) 0) 0) ) 0) 0) 1) 0) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 7) ) 0) 0) 1) 1) 0) 1) ) 0) 0) 1) 1) 1) 0) ) 0) 1) 0) 0) 0) 0) ) ) ) ) ) ) ) 8) ) 0) 1) 0) 0) 0) 1) ) 0) 1) 0) 0) 1) 0) ) 1) 0) 0) 0) 0) 0) ) 0) 0) 1) 1) 1) 1) 9) ) 1) 0) 0) 0) 0) 1) ) 1) 0) 0) 0) 1) 0) ) 0) 1) 0) 1) 0) 0) ) 0) 1) 0) 0) 1) 1) 10) ) 0) 1) 0) 1) 0) 1) ) 0) 1) 0) 1) 1) 0) ) 1) 0) 0) 1) 0) 0) ) 1) 0) 0) 0) 1) 1) 11) ) 1) 0) 0) 1) 0) 1) ) 1) 0) 0) 1) 1) 0) ) 0) 1) 1) 0) 0) 0) ) 0) 1) 0) 1) 1) 1) 12) ) 0) 1) 1) 0) 0) 1) ) 0) 1) 1) 0) 1) 0) ) 1) 0) 1) 0) 0) 0) ) 1) 0) 0) 1) 1) 1) 13) ) 1) 0) 1) 0) 0) 1) ) 1) 0) 1) 0) 1) 0) ) 0) 1) 1) 1) 0) 0) ) 0) 1) 1) 0) 1) 1) 14) ) 0) 1) 1) 1) 0) 1) ) 0) 1) 1) 1) 1) 0) ) 1) 0) 1) 1) 0) 0) ) 1) 0) 1) 0) 1) 1) 15) ) 1) 0) 1) 1) 0) 1) ) 1) 0) 1) 1) 1) 0) ) 1) 1) 0) 0) 0) 0) ) 0) 1) 1) 1) 1) 1) 16) ) 1) 1) 0) 0) 0) 1) ) 1) 1) 0) 0) 1) 0) ) 1) 0) 1) 1) 1) 1) ) ) ) ) ) ) ) 17) ) 1) 1) 0) 0) 1) 1) ) 1) 1) 0) 1) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 18) ) 1) 1) 0) 1) 0) 1) ) 1) 1) 0) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 19) ) 1) 1) 1) 0) 1) 1) ) 1) 1) 0) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 20) ) 1) 1) 1) 0) 0) 1) ) 1) 1) 1) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 21) ) 1) 1) 1) 1) 0) 0) ) 1) 1) 1) 0) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 22) ) 1) 1) 1) 1) 0) 1) ) 1) 1) 1) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 23) ) 1) 1) 1) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) xxxx01 and xxxx10 codify the same integer number 16 pairs of strings xxxx01 xxxx10 Workshop on Dynamical Systems and Applica)ons BCAM December

25 Structural Isomorphism STRUCTURAL ISOMORPHISM GC-LIKE NON-POWER INTEGER NUMBER REPRESENTATION STARTING SET BINARY STRINGS OF LENGTH 6 CARDINALITY = 64 MAPPING (8,7,4,2,1,1) ARRIVING SET INTEGER NUMBERS FROM 0 TO 23 CARDINALITY = 24 Workshop on Dynamical Systems and Applica)ons BCAM December

26 Model SYMMETRY STRUCTURAL ISOMORPHISM GC-LIKE NON-POWER INTEGER NUMBER REPRESENTATION STARTING SET BINARY STRINGS OF LENGTH 6 CARDINALITY = 64 MAPPING (8,7,4,2,1,1) ARRIVING SET INTEGER NUMBERS FROM 0 TO 23 CARDINALITY = 24 Workshop on Dynamical Systems and Applica)ons BCAM December

27 The Model of the Euplotes Nuclear Genetic Code Can the genetic code be mathematically described?, Diego L. Gonzalez, Medical Science Monitor, v.10, n.4, HY11-17 (2004). The Mathematical Structure of the Genetic Code D.L. Gonzalez, The Codes of Life, M.. Barbieri Editor, Springer Verlag (2008) Workshop on Dynamical Systems and Applica)ons BCAM December

28 THE MODEL Puts in evidence the role played by symmetries which are associated to conserved quantities in a complete analogy with their role in physics. Because such symmetries are highly conserved in the genetic code they must be associated to important biological functions! Workshop on Dynamical Systems and Applica)ons BCAM December

29 Parity Dichotomic Class The parity of the strings can be described in terms of biochemical properties Parity of a string = parity of the # of 1 s, i.e., 0,1,1,0,1,0 = odd string The complete set of parity rules: Codons ending in A are odd (grey boxes); codons ending in G are even (white boxes) Codons ending in T or C are odd if the second letter is T or G (Keto) Codons ending in T or C are even if the second letter is A or C (Amino) Dichotomic classes: Parity, Rumer, Hidden Actual sequences can be binary coded: short-range correlations, circular codes, etc. Workshop on Dynamical Systems and Applica)ons BCAM December

30 Rumer s Dichotomic Class Degeneracy Class 4 Degeneracy Class 1,2,3 Strong Short-Range Correlations and Codon Class Dichotomies classes in Coding DNA Sequences, Diego L. Gonzalez, Simone Giannerini and Rodolfo Rosa, Physical Review E,78, n.5, 08481, (2008). Circular codes revisited: a statistical approach Diego Luis Gonzalez, Simone Giannerini and Rodolfo Rosa, Journal of Theoretical Biology, vol. 275, n.1, pp21-28, (2011). "DNA, circular codes and dichotomic classes: a quasi-crystal framework", Diego Luis Gonzalez, Simone Giannerini and Rodolfo Rosa, Phil Trans A of the Royal Society, Beyond Crystals: the dialectic of information and structure, theme issue, 370, ; doi: /rsta , (2012). Genome characterization through dichotomic classes: an analysis of the whole chromosome 1 of A. Thaliana, Enrico Properzi, Simone Giannerini, Diego L. Gonzalez, and Rodolfo Rosa, Mathematical Biosciences and Engineering, v. 10, n. 1, pp , (2013). Circular codes, symmetries and transformations Elena Fimmel, Simone Giannerini, Diego Luis Gonzalez, Lutz Strüngmann, submitted to Journal of Mathematical Biology, (2013). Workshop on Dynamical Systems and Applica)ons BCAM December

31 Outline 1. Description of the degeneracy distribution of the Euplotes nuclear genetic code with a redundant integer number representation system 2. Isomorphisms and models, the role of symmetries in the construction of a non-power model of the Euplotes nuclear genetic code 3. Modelling of the vertebrate mitochondrial genetic code and the origin of degeneracy in amino acid s coding Workshop on Dynamical Systems and Applica)ons BCAM December

32 Information Processing in the Eukaryotic Cell Eukaryotic cell Nucleus E Cytoplasm Workshop on Dynamical Systems and Applica)ons BCAM December

33 Information Processing in the Eukaryotic Cell Eukaryotic cell Nucleus E Cytoplasm Workshop on Dynamical Systems and Applica)ons BCAM December

34 Error detection/correction hypothesis Why exists a strong and conserved mathematical structure inside the genetic code? Error detection/correction hypothesis: not the unique possibility (protein synthesis regulation, protein folding, etc.) A difficult problem in the framework of nuclear genetic information A more simpler case: mitochondrial genetic information Nuclear Genetic Code Mitochondrial Genetic Code Nuclear Information: bases Mitochondrial Information: bases D.L. Gonzalez, Error Detection and Correction Codes in The Codes of Life, chapter 6, Marcello Barbieri Editor, Springer Verlag (2008). Elebeoba E. May, Mladen A. Vouk, Donald L. Bitzer, and David I. Rosnick. An error-correcting code framework for genetic sequence analysis. Journal of the Franklin Institute, 341:89-109, (2004). Workshop on Dynamical Systems and Applica)ons BCAM December

35 Vertebrate mitochondrial genetic code Distribution of Degeneracy inside Quartets Degeneracy (number of synonimous codons) Number of amino acids sharing this degeneracy Total: 24 different objects In yellow are evidenced the differences with the standard nuclear genetic code Workshop on Dynamical Systems and Applica)ons BCAM December

36 Non-power representation system 1,1,2,4,7,8! Represented) number! Length 6 binary strings ) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) ) 8) 7) 4) 2) 1) 1) 0) ) 0) 0) 0) 0) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 1) ) 0) 0) 0) 0) 0) 1) ) 0) 0) 0) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 2) ) 0) 0) 0) 0) 1) 1) ) 0) 0) 0) 1) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 3) ) 0) 0) 0) 1) 0) 1) ) 0) 0) 0) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 4) ) 0) 0) 1) 0) 0) 0) ) 0) 0) 0) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 5) ) 0) 0) 1) 0) 0) 1) ) 0) 0) 1) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 6) ) 0) 0) 1) 1) 0) 0) ) 0) 0) 1) 0) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 7) ) 0) 0) 1) 1) 0) 1) ) 0) 0) 1) 1) 1) 0) ) 0) 1) 0) 0) 0) 0) ) ) ) ) ) ) ) 8) ) 0) 1) 0) 0) 0) 1) ) 0) 1) 0) 0) 1) 0) ) 1) 0) 0) 0) 0) 0) ) 0) 0) 1) 1) 1) 1) 9) ) 1) 0) 0) 0) 0) 1) ) 1) 0) 0) 0) 1) 0) ) 0) 1) 0) 1) 0) 0) ) 0) 1) 0) 0) 1) 1) 10) ) 0) 1) 0) 1) 0) 1) ) 0) 1) 0) 1) 1) 0) ) 1) 0) 0) 1) 0) 0) ) 1) 0) 0) 0) 1) 1) 11) ) 1) 0) 0) 1) 0) 1) ) 1) 0) 0) 1) 1) 0) ) 0) 1) 1) 0) 0) 0) ) 0) 1) 0) 1) 1) 1) 12) ) 0) 1) 1) 0) 0) 1) ) 0) 1) 1) 0) 1) 0) ) 1) 0) 1) 0) 0) 0) ) 1) 0) 0) 1) 1) 1) 13) ) 1) 0) 1) 0) 0) 1) ) 1) 0) 1) 0) 1) 0) ) 0) 1) 1) 1) 0) 0) ) 0) 1) 1) 0) 1) 1) 14) ) 0) 1) 1) 1) 0) 1) ) 0) 1) 1) 1) 1) 0) ) 1) 0) 1) 1) 0) 0) ) 1) 0) 1) 0) 1) 1) 15) ) 1) 0) 1) 1) 0) 1) ) 1) 0) 1) 1) 1) 0) ) 1) 1) 0) 0) 0) 0) ) 0) 1) 1) 1) 1) 1) 16) ) 1) 1) 0) 0) 0) 1) ) 1) 1) 0) 0) 1) 0) ) 1) 0) 1) 1) 1) 1) ) ) ) ) ) ) ) 17) ) 1) 1) 0) 0) 1) 1) ) 1) 1) 0) 1) 0) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 18) ) 1) 1) 0) 1) 0) 1) ) 1) 1) 0) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 19) ) 1) 1) 1) 0) 1) 1) ) 1) 1) 0) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 20) ) 1) 1) 1) 0) 0) 1) ) 1) 1) 1) 0) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 21) ) 1) 1) 1) 1) 0) 0) ) 1) 1) 1) 0) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 22) ) 1) 1) 1) 1) 0) 1) ) 1) 1) 1) 1) 1) 0) ) ) ) ) ) ) ) ) ) ) ) ) ) ) 23) ) 1) 1) 1) 1) 1) 1) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) Degeneracy distribution Non-power representation system 1,1,2,4,7,8 # of integer Degeneracy numbers Unique solution 1,1,2,4,7,8 Degeneracy distribution Euplotes nuclear genetic code # of amino acids Degeneracy Workshop on Dynamical Systems and Applica)ons BCAM December

37 The 8,8,4,2,1,0 non-power solution for mitochondrial degeneracy Workshop on Dynamical Systems and Applica)ons BCAM December

38 Half the Degeneracy of the Mitochondrial Genetic Code Half the degeneracy of the genetic code Obtained by excluding the 0 non-power base of the representation (8,8,4,2,1) Workshop on Dynamical Systems and Applica)ons BCAM December

39 Dinucleotide Coding Workshop on Dynamical Systems and Applica)ons BCAM December

40 One Half of the Tesserae Set: Symmetric Tesserae Palindromic Self-complementary Wu HL, Bagby S, van den Elsen JM. Evolution of the genetic triplet code via two types of doublet codons, J Molecular Evolution, 61(1), (2005) Workshop on Dynamical Systems and Applica)ons BCAM December

41 Reversible Ancient trnas S. Nikolajewa. M. Friedel, A. Beyer, and T. Wilhelm, The new classification scheme of the genetic code, its early evolution, and trna usage, Journal of Bioinformatics and Cmputational Biology, 12, 54 (2005) 1-12 Workshop on Dynamical Systems and Applica)ons BCAM December

42 Reading the Symmetric set of Tesserae Workshop on Dynamical Systems and Applica)ons BCAM December

43 How can be Completed the Tesserae Set? Palindromic Self-complementary Workshop on Dynamical Systems and Applica)ons BCAM December

44 The Complete Tesserae Representation Group properties of the four symmetric transformations, i.e., I, C, YR and KM Klein 4-group V Workshop on Dynamical Systems and Applica)ons BCAM December

45 Origin of the mitochondrial genetic code Distribution of Degeneracy Vertebrate Mitochondrial Degeneracy number of synonymous codons Number of amino acids sharing this degeneracy Distribution of Degeneracy Non-power system Degeneracy 8,8,4,2,1,0 # of integers Distribution of Degeneracy Tesserae Degeneracy Number of synonymous tesserae Number of amino acids sharing this degeneracy Workshop on Dynamical Systems and Applica)ons BCAM December

46 Origin of degeneracy in amino acid coding Degeneracy as plurality of states characterized by the same interaction energy D.L. Gonzalez, S. Giannerini, and R. Rosa, On the origin of the mitochondrial genetic code: Towards a Unified mathematical framework for the management of genetic information, Nature Precedings, < (2012) H. Seligman, Pocketknife trna hypothesis: anticodons in mammal mitochondrial trna side-arm loops translate proteins? Biosystems (2013) Workshop on Dynamical Systems and Applica)ons BCAM December

47 The Complete Tesserae Representation Palindromic Self-complementary Non symmetric tesserae Completely immune to point mutations Workshop on Dynamical Systems and Applica)ons BCAM December

48 How we can pass from tesserae to codons? Tesserae Model Present Code # Tesserae = = 256 # Valid Tesserae = 64 # Codons = = 64 # Valid Codons = 64 MAPPING? Tesserae suggest an origin of proteins based in direct template synthesis Present codons, instead, are read by the ribosome Workshop on Dynamical Systems and Applica)ons BCAM December

49 The ribosome as a dynamical error-correcting molecular machine The ribosome mediated protein synthesis should compensate to some extent the loss of information involved in passing from codons of length four (tesserae) to codons of length three (present codons). The ribosome is in fact a dynamical molecular machine able to incorporate until 30 amino acids in a second (human cell). The process of protein synthesis can be though as a chaotic synchronization: the input represented by the symbolic sequence of bases in the mrna molecule and the output by the symbolic sequence of complementary bases in trna molecules (or, equivalently, by the sequence of corresponding amino acids) Workshop on Dynamical Systems and Applica)ons BCAM December

50 Consequences NON-POWER REPRESENTATION OF THE MITOCHONDRIAL GENETIC CODE - PRIMEVAL FOUR-BASES CODONS (TESSERAE) (64 tesserae 64 codons) - DEGENERACY EXPLAINED ON THE BASIS OF PRIMEVAL CHEMICAL SYMMETRIES (palindromic and self-complementary) -ERROR DETECTION/CORRECTION CAPABILITIES (point mutations) -REVERSE AND REVERSE COMPLEMENTED TESSERAE CODES THE SAME AA - RUMER S TRANSFORMATION (changes degeneracy if applied on the first two bases of a codon changes degeneracy if applied to the first two letters of a tesserae) - ORIGIN OF THE GENETIC CODE (robustness to point mutations) - THE RIBOSOME AS A DYNAMICAL ERROR-CORRECTING MOLECULAR MACHINE P.V. Baranov, M. Venin, G. Provan, Codon Size Reduction as the Origin of the Triplet Genetic Code, PLOS ONE 4(5): e5708. doi: , (2009). Workshop on Dynamical Systems and Applica)ons BCAM December

51 Workshop on Dynamical Systems and Applica)ons BCAM December

52 Collaborations Oreste Piro Departamento de Fisica, Universidad de las Islas Baleares, Palma de Mallorca, Spain Julyan Cartwright CSIC- Instituto Andaluz de Ciencias de la Tierra, Universidad de Granada, Spain Simone Giannerini Dipartimento di Statistica, Universidad di Bologna, Italy Rodolfo Rosa Dipartimento di Statistica, Universidad di Bologna, CNR-IMM, Italy Alberto Danieli Dipartimento di Farmacia e Biotecnologie, Università di Bologna, Italy Elena Fimmel Hochschule Mannheim/Institut für Angewandte Mathematik, Mannheim, Germany Lutz Strüngmann Hochschule Mannheim/Institut für Angewandte Mathematik, Mannheim, Germany Ivo Wolf Hochschule Mannheim/Institut für Angewandte Mathematik, Mannheim, Germany Markus Kumbel Hochschule Mannheim/Institut für Angewandte Mathematik, Mannheim, Germany Enrico Properzi Biotecnologie, Università di Bologna, Italy Workshop on Dynamical Systems and Applica)ons BCAM December

53 Publications Una Nuova Descrizione Matematica del Codice Genetico D.L. Gonzalez and M. Zanna, Systema Naturae, Annali di Biologia Teorica, V. 5, pp , (2003). Can the genetic code be mathematically described?, Diego L. Gonzalez, Medical Science Monitor, v.10, n.4, HY11-17 (2004). Detecting Structure in Parity Binary Sequences: Error Correction and Detection in DNA, Diego Luis Gonzalez, Simone Giannerini and Rodolfo Rosa, IEEE-EMB Magazine, Special Issue on Communication Theory, Coding Theory and Molecular Biology, pp , January/February (2006). Error Detection and Correction Codes D.L. Gonzalez, in The Codes of Life, chapter 6, Marcello Barbieri Editor, Springer Verlag (2008). The Mathematical Structure of the Genetic Code D.L. Gonzalez, in The Codes of Life, chapter 17, Marcello Barbieri Editor, Springer Verlag (2008). Strong Short-Range Correlations and Codon Class Dichotomies classes in Coding DNA Sequences, Diego L. Gonzalez, Simone Giannerini and Rodolfo Rosa, Physical Review E,78, n.5, 08481, (2008). The mathematical structure of the genetic code: a tool for inquiring on the origin of life Diego L. Gonzalez, S. Giannerini, and R. Rosa, Rivista di Statistica, Anno LXIX, n. 2-3, pp ,(2009). Circular codes revisited: a statistical approach Diego Luis Gonzalez, Simone Giannerini and Rodolfo Rosa, Journal of Theoretical Biology, vol. 275, n.1, pp21-28, (2011). "DNA, circular codes and dichotomic classes: a quasi-crystal framework", Diego Luis Gonzalez, Simone Giannerini and Rodolfo Rosa, Phil Trans A of the Royal Society, Beyond Crystals: the dialectic of information and structure, theme issue, 370, ; doi: /rsta , (2012). On the origin of the mitochondrial genetic code: Towards a unified mathematical framework for the management of genetic information Gonzalez, Diego Luis, Giannerini, Simone, and Rosa, Rodolfo. Available from Nature Precedings < (2012) Genome characterization through dichotomic classes: an analysis of the whole chromosome 1 of A. Thaliana, Enrico Properzi, Simone Giannerini, Diego L. Gonzalez, and Rodolfo Rosa, Mathematical Biosciences and Engineering, v. 10, n. 1, pp , (2013). Circular codes, symmetries and transformations Elena Fimmel, Simone Giannerini, Diego Luis Gonzalez, Lutz Strüngmann, submitted to Journal of Mathematical Biology, (2013). Workshop on Dynamical Systems and Applica)ons BCAM December