BMI/CS 776 Lecture 4. Colin Dewey
|
|
- Oscar Cox
- 5 years ago
- Views:
Transcription
1 BMI/CS 776 Lecture 4 Colin Dewey
2 Outline Common nucleotide substitution models Directed graphical models Ancestral sequence inference
3 Poisson process continuous Markov process X t0 X t1 X t2 X tn Y t0 Y t1 Y t2 Y tn P[X ti+1 = x i+1 X ti = x i ] = e λ(t i+1 t i ) (λ(t i+1 t i )) x i+1 x i (x i+1 x i )! P[Y ti+1 = b Y ti = a, X ti+1 = x i+1, X ti = x i ] = (R x i+1 x i ) ab
4 Jukes-Cantor Model Π = Jukes-Cantor model R = P(t) = e λt 1 e λt 1 e λt 1 e λt 1 e λt 1 + 3e λt 1 e λt 1 e λt 1 e λt 1 e λt 1 + 3e λt 1 e λt 1 e λt 1 e λt 1 e λt 1 + 3e λt Jukes-Cantor model satisfies two important properties which a
5 Properties of Jukes- Cantor ergodic lim t P(t) = ΠJ time reversible ΠQ = Q T Π
6 Transitions vs. Transversions Transition purine purine pyrimidine pyrimidine Transversion pyrimidine purine purine pyrimidine Purines A G Pyrimidines C T
7 HKY85 R = 1 π G α π Y β π C β π G α π T β Q = π A β 1 π G α π R β π G β π T α π A α π C β 1 π A α π Y β π T β π A β π C α π G β 1 π C α π R β π G α π Y β π C β π G α π T β π A β π G α π R β π G β π T α π A α π C β π A α π Y β π T β π A β π C α π G β π C α π R β., Here α, β 0 and 0 α + 2β < 1 and π A + π C + π G + π T π R = π A + π G and π Y = π C + π T. = 1 with
8 Branch lengths What do the lengths of tree edges mean? Expected number of mutations per site time (t) and rate (λ) are not identifiable, only their product is: λt P(mutation event) = 1 x Σ π x R xx = 1 trace(πr) = trace(πq). Expected number of mutations = λt ( trace(πq)) Typically scale λ so that λt ( trace(πq)) = 1
9 Estimating branch length Given empirical P(t), can estimate branch length with the logdet transform logdet(p(t)) = log(det(p(t))) logdet(p(t)) = λt ( trace(q)).
10 Directed Graphical Models Same thing as Bayesian networks Directed graph G = (V, E) Vertices correspond to random variables Missing edges represent independence statements
11 X4 X2 Example DGM X6 X1 X4 X2 X1 X6 X5 X3 X3 X5
12 Tree model P[x 1, x 2,..., x 9 ] = π x9 P xi x j (t ij ) X9 L(data model) = (x i,x j ) E x 6,x 7,x 8,x 9 P(x 1, x 2,..., x 9 ) t97 t98 X8 data = (x 1, x 2, x 3, x 4, x 5 ) model = (T, P(t), Π) X7 t71 t72 t83 t64 t86 X6 t65 X1 X2 X3 X4 X5
13 Likelihood computation L k (a): Likelihood of subtree rooted by k with x k = a for each vertex k in a topological ordering: if k is a leaf: { 1 if xk = a set L k (a) = 0 otherwise else: let i and j be the child vertices of k set L k (a) = b,c P ab (t ki )L i (b)p ac (t kj )L j (c) return L(data model) = a π a L r (a), where r is the root vertex (Felsenstein s algorithm, sum-product algorithm)
14 Marginal reconstruction most likely character at root given the leaf characters compute L r (a) using the likelihood algorithm return argmax a π a L r (a)
15 Joint reconstruction character at root for most likely assignment to all interior vertices given the leaf characters V k (a): Likelihood of most likely interior vertex assignments for subtree rooted by k, with x k = a for each vertex k in a topological ordering: if k is a leaf: { 1 if xk = a set V k (a) = 0 otherwise else: let i and j be the child vertices of k set V k (a) = max b,c return argmax a P ab(t ki )V i (b)p ac (t kj )V j (c) π a V r (a), where r is the root vertex
Phylogenetics: Distance Methods. COMP Spring 2015 Luay Nakhleh, Rice University
Phylogenetics: Distance Methods COMP 571 - Spring 2015 Luay Nakhleh, Rice University Outline Evolutionary models and distance corrections Distance-based methods Evolutionary Models and Distance Correction
More informationSome of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!
Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis
More informationMarkov Chains. Sarah Filippi Department of Statistics TA: Luke Kelly
Markov Chains Sarah Filippi Department of Statistics http://www.stats.ox.ac.uk/~filippi TA: Luke Kelly With grateful acknowledgements to Prof. Yee Whye Teh's slides from 2013 14. Schedule 09:30-10:30 Lecture:
More informationSubstitution = Mutation followed. by Fixation. Common Ancestor ACGATC 1:A G 2:C A GAGATC 3:G A 6:C T 5:T C 4:A C GAAATT 1:G A
GAGATC 3:G A 6:C T Common Ancestor ACGATC 1:A G 2:C A Substitution = Mutation followed 5:T C by Fixation GAAATT 4:A C 1:G A AAAATT GAAATT GAGCTC ACGACC Chimp Human Gorilla Gibbon AAAATT GAAATT GAGCTC ACGACC
More informationMachine Learning for Data Science (CS4786) Lecture 24
Machine Learning for Data Science (CS4786) Lecture 24 Graphical Models: Approximate Inference Course Webpage : http://www.cs.cornell.edu/courses/cs4786/2016sp/ BELIEF PROPAGATION OR MESSAGE PASSING Each
More informationMaximum Likelihood Tree Estimation. Carrie Tribble IB Feb 2018
Maximum Likelihood Tree Estimation Carrie Tribble IB 200 9 Feb 2018 Outline 1. Tree building process under maximum likelihood 2. Key differences between maximum likelihood and parsimony 3. Some fancy extras
More informationEvolutionary Tree Analysis. Overview
CSI/BINF 5330 Evolutionary Tree Analysis Young-Rae Cho Associate Professor Department of Computer Science Baylor University Overview Backgrounds Distance-Based Evolutionary Tree Reconstruction Character-Based
More informationAdditive distances. w(e), where P ij is the path in T from i to j. Then the matrix [D ij ] is said to be additive.
Additive distances Let T be a tree on leaf set S and let w : E R + be an edge-weighting of T, and assume T has no nodes of degree two. Let D ij = e P ij w(e), where P ij is the path in T from i to j. Then
More informationReading for Lecture 13 Release v10
Reading for Lecture 13 Release v10 Christopher Lee November 15, 2011 Contents 1 Evolutionary Trees i 1.1 Evolution as a Markov Process...................................... ii 1.2 Rooted vs. Unrooted Trees........................................
More informationEvolutionary Models. Evolutionary Models
Edit Operators In standard pairwise alignment, what are the allowed edit operators that transform one sequence into the other? Describe how each of these edit operations are represented on a sequence alignment
More informationPhylogenetics: Likelihood
1 Phylogenetics: Likelihood COMP 571 Luay Nakhleh, Rice University The Problem 2 Input: Multiple alignment of a set S of sequences Output: Tree T leaf-labeled with S Assumptions 3 Characters are mutually
More informationπ b = a π a P a,b = Q a,b δ + o(δ) = 1 + Q a,a δ + o(δ) = I 4 + Qδ + o(δ),
ABC estimation of the scaled effective population size. Geoff Nicholls, DTC 07/05/08 Refer to http://www.stats.ox.ac.uk/~nicholls/dtc/tt08/ for material. We will begin with a practical on ABC estimation
More informationSequence Analysis 17: lecture 5. Substitution matrices Multiple sequence alignment
Sequence Analysis 17: lecture 5 Substitution matrices Multiple sequence alignment Substitution matrices Used to score aligned positions, usually of amino acids. Expressed as the log-likelihood ratio of
More informationLecture 4. Models of DNA and protein change. Likelihood methods
Lecture 4. Models of DNA and protein change. Likelihood methods Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 4. Models of DNA and protein change. Likelihood methods p.1/36
More informationMassachusetts Institute of Technology Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution
Massachusetts Institute of Technology 6.877 Computational Evolutionary Biology, Fall, 2005 Notes for November 7: Molecular evolution 1. Rates of amino acid replacement The initial motivation for the neutral
More informationReconstruire le passé biologique modèles, méthodes, performances, limites
Reconstruire le passé biologique modèles, méthodes, performances, limites Olivier Gascuel Centre de Bioinformatique, Biostatistique et Biologie Intégrative C3BI USR 3756 Institut Pasteur & CNRS Reconstruire
More informationHow should we go about modeling this? Model parameters? Time Substitution rate Can we observe time or subst. rate? What can we observe?
How should we go about modeling this? gorilla GAAGTCCTTGAGAAATAAACTGCACACACTGG orangutan GGACTCCTTGAGAAATAAACTGCACACACTGG Model parameters? Time Substitution rate Can we observe time or subst. rate? What
More informationMutation models I: basic nucleotide sequence mutation models
Mutation models I: basic nucleotide sequence mutation models Peter Beerli September 3, 009 Mutations are irreversible changes in the DNA. This changes may be introduced by chance, by chemical agents, or
More informationLecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/26
Lecture 27. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 27. Phylogeny methods, part 4 (Models of DNA and
More informationEVOLUTIONARY DISTANCES
EVOLUTIONARY DISTANCES FROM STRINGS TO TREES Luca Bortolussi 1 1 Dipartimento di Matematica ed Informatica Università degli studi di Trieste luca@dmi.units.it Trieste, 14 th November 2007 OUTLINE 1 STRINGS:
More informationLecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) p.1/22
Lecture 24. Phylogeny methods, part 4 (Models of DNA and protein change) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 24. Phylogeny methods, part 4 (Models of DNA and
More informationPhylogenetic Tree Reconstruction
I519 Introduction to Bioinformatics, 2011 Phylogenetic Tree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Evolution theory Speciation Evolution of new organisms is driven
More information进化树构建方法的概率方法 第 4 章 : 进化树构建的概率方法 问题介绍. 部分 lid 修改自 i i f l 的 ih l i
第 4 章 : 进化树构建的概率方法 问题介绍 进化树构建方法的概率方法 部分 lid 修改自 i i f l 的 ih l i 部分 Slides 修改自 University of Basel 的 Michael Springmann 课程 CS302 Seminar Life Science Informatics 的讲义 Phylogenetic Tree branch internal node
More informationLecture Notes: Markov chains
Computational Genomics and Molecular Biology, Fall 5 Lecture Notes: Markov chains Dannie Durand At the beginning of the semester, we introduced two simple scoring functions for pairwise alignments: a similarity
More informationLecture 4 October 18th
Directed and undirected graphical models Fall 2017 Lecture 4 October 18th Lecturer: Guillaume Obozinski Scribe: In this lecture, we will assume that all random variables are discrete, to keep notations
More informationUNDERSTANDING BELIEF PROPOGATION AND ITS GENERALIZATIONS
UNDERSTANDING BELIEF PROPOGATION AND ITS GENERALIZATIONS JONATHAN YEDIDIA, WILLIAM FREEMAN, YAIR WEISS 2001 MERL TECH REPORT Kristin Branson and Ian Fasel June 11, 2003 1. Inference Inference problems
More informationSome of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks!
Some of these slides have been borrowed from Dr. Paul Lewis, Dr. Joe Felsenstein. Thanks! Paul has many great tools for teaching phylogenetics at his web site: http://hydrodictyon.eeb.uconn.edu/people/plewis
More informationBayesian Networks: Belief Propagation in Singly Connected Networks
Bayesian Networks: Belief Propagation in Singly Connected Networks Huizhen u janey.yu@cs.helsinki.fi Dept. Computer Science, Univ. of Helsinki Probabilistic Models, Spring, 2010 Huizhen u (U.H.) Bayesian
More informationPhylogenetics: Parsimony and Likelihood. COMP Spring 2016 Luay Nakhleh, Rice University
Phylogenetics: Parsimony and Likelihood COMP 571 - Spring 2016 Luay Nakhleh, Rice University The Problem Input: Multiple alignment of a set S of sequences Output: Tree T leaf-labeled with S Assumptions
More information4 : Exact Inference: Variable Elimination
10-708: Probabilistic Graphical Models 10-708, Spring 2014 4 : Exact Inference: Variable Elimination Lecturer: Eric P. ing Scribes: Soumya Batra, Pradeep Dasigi, Manzil Zaheer 1 Probabilistic Inference
More informationQuantitative Model Checking (QMC) - SS12
Quantitative Model Checking (QMC) - SS12 Lecture 06 David Spieler Saarland University, Germany June 4, 2012 1 / 34 Deciding Bisimulations 2 / 34 Partition Refinement Algorithm Notation: A partition P over
More information2 : Directed GMs: Bayesian Networks
10-708: Probabilistic Graphical Models 10-708, Spring 2017 2 : Directed GMs: Bayesian Networks Lecturer: Eric P. Xing Scribes: Jayanth Koushik, Hiroaki Hayashi, Christian Perez Topic: Directed GMs 1 Types
More informationLecture 4: Hidden Markov Models: An Introduction to Dynamic Decision Making. November 11, 2010
Hidden Lecture 4: Hidden : An Introduction to Dynamic Decision Making November 11, 2010 Special Meeting 1/26 Markov Model Hidden When a dynamical system is probabilistic it may be determined by the transition
More informationInferring Molecular Phylogeny
Dr. Walter Salzburger he tree of life, ustav Klimt (1907) Inferring Molecular Phylogeny Inferring Molecular Phylogeny 55 Maximum Parsimony (MP): objections long branches I!! B D long branch attraction
More informationBasic math for biology
Basic math for biology Lei Li Florida State University, Feb 6, 2002 The EM algorithm: setup Parametric models: {P θ }. Data: full data (Y, X); partial data Y. Missing data: X. Likelihood and maximum likelihood
More informationBayesian Graphical Models
Graphical Models and Inference, Lecture 16, Michaelmas Term 2009 December 4, 2009 Parameter θ, data X = x, likelihood L(θ x) p(x θ). Express knowledge about θ through prior distribution π on θ. Inference
More informationEE562 ARTIFICIAL INTELLIGENCE FOR ENGINEERS
EE562 ARTIFICIAL INTELLIGENCE FOR ENGINEERS Lecture 16, 6/1/2005 University of Washington, Department of Electrical Engineering Spring 2005 Instructor: Professor Jeff A. Bilmes Uncertainty & Bayesian Networks
More informationCISC 889 Bioinformatics (Spring 2004) Hidden Markov Models (II)
CISC 889 Bioinformatics (Spring 24) Hidden Markov Models (II) a. Likelihood: forward algorithm b. Decoding: Viterbi algorithm c. Model building: Baum-Welch algorithm Viterbi training Hidden Markov models
More information3/1/17. Content. TWINSCAN model. Example. TWINSCAN algorithm. HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM
I529: Machine Learning in Bioinformatics (Spring 2017) Content HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM Yuzhen Ye School of Informatics and Computing Indiana University,
More information4.1 Notation and probability review
Directed and undirected graphical models Fall 2015 Lecture 4 October 21st Lecturer: Simon Lacoste-Julien Scribe: Jaime Roquero, JieYing Wu 4.1 Notation and probability review 4.1.1 Notations Let us recall
More informationLecture 4: Evolutionary models and substitution matrices (PAM and BLOSUM).
1 Bioinformatics: In-depth PROBABILITY & STATISTICS Spring Semester 2011 University of Zürich and ETH Zürich Lecture 4: Evolutionary models and substitution matrices (PAM and BLOSUM). Dr. Stefanie Muff
More informationMolecular Evolution, course # Final Exam, May 3, 2006
Molecular Evolution, course #27615 Final Exam, May 3, 2006 This exam includes a total of 12 problems on 7 pages (including this cover page). The maximum number of points obtainable is 150, and at least
More information9 Forward-backward algorithm, sum-product on factor graphs
Massachusetts Institute of Technology Department of Electrical Engineering and Computer Science 6.438 Algorithms For Inference Fall 2014 9 Forward-backward algorithm, sum-product on factor graphs The previous
More informationUsing algebraic geometry for phylogenetic reconstruction
Using algebraic geometry for phylogenetic reconstruction Marta Casanellas i Rius (joint work with Jesús Fernández-Sánchez) Departament de Matemàtica Aplicada I Universitat Politècnica de Catalunya IMA
More informationMean-field dual of cooperative reproduction
The mean-field dual of systems with cooperative reproduction joint with Tibor Mach (Prague) A. Sturm (Göttingen) Friday, July 6th, 2018 Poisson construction of Markov processes Let (X t ) t 0 be a continuous-time
More informationWeek 5: Distance methods, DNA and protein models
Week 5: Distance methods, DNA and protein models Genome 570 February, 2016 Week 5: Distance methods, DNA and protein models p.1/69 A tree and the expected distances it predicts E A 0.08 0.05 0.06 0.03
More informationLecture 9: PGM Learning
13 Oct 2014 Intro. to Stats. Machine Learning COMP SCI 4401/7401 Table of Contents I Learning parameters in MRFs 1 Learning parameters in MRFs Inference and Learning Given parameters (of potentials) and
More informationHMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM
I529: Machine Learning in Bioinformatics (Spring 2017) HMM for modeling aligned multiple sequences: phylo-hmm & multivariate HMM Yuzhen Ye School of Informatics and Computing Indiana University, Bloomington
More information9/30/11. Evolution theory. Phylogenetic Tree Reconstruction. Phylogenetic trees (binary trees) Phylogeny (phylogenetic tree)
I9 Introduction to Bioinformatics, 0 Phylogenetic ree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & omputing, IUB Evolution theory Speciation Evolution of new organisms is driven by
More informationTree of Life iological Sequence nalysis Chapter http://tolweb.org/tree/ Phylogenetic Prediction ll organisms on Earth have a common ancestor. ll species are related. The relationship is called a phylogeny
More informationGenerative and Discriminative Approaches to Graphical Models CMSC Topics in AI
Generative and Discriminative Approaches to Graphical Models CMSC 35900 Topics in AI Lecture 2 Yasemin Altun January 26, 2007 Review of Inference on Graphical Models Elimination algorithm finds single
More informationInference in Graphical Models Variable Elimination and Message Passing Algorithm
Inference in Graphical Models Variable Elimination and Message Passing lgorithm Le Song Machine Learning II: dvanced Topics SE 8803ML, Spring 2012 onditional Independence ssumptions Local Markov ssumption
More informationCSCI1950 Z Computa4onal Methods for Biology Lecture 4. Ben Raphael February 2, hhp://cs.brown.edu/courses/csci1950 z/ Algorithm Summary
CSCI1950 Z Computa4onal Methods for Biology Lecture 4 Ben Raphael February 2, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Algorithm Summary Parsimony Probabilis4c Method Input Output Sankoff s & Fitch
More informationFactor Graphs and Message Passing Algorithms Part 1: Introduction
Factor Graphs and Message Passing Algorithms Part 1: Introduction Hans-Andrea Loeliger December 2007 1 The Two Basic Problems 1. Marginalization: Compute f k (x k ) f(x 1,..., x n ) x 1,..., x n except
More informationLecture 4: State Estimation in Hidden Markov Models (cont.)
EE378A Statistical Signal Processing Lecture 4-04/13/2017 Lecture 4: State Estimation in Hidden Markov Models (cont.) Lecturer: Tsachy Weissman Scribe: David Wugofski In this lecture we build on previous
More informationMarkov Models & DNA Sequence Evolution
7.91 / 7.36 / BE.490 Lecture #5 Mar. 9, 2004 Markov Models & DNA Sequence Evolution Chris Burge Review of Markov & HMM Models for DNA Markov Models for splice sites Hidden Markov Models - looking under
More informationDynamic Approaches: The Hidden Markov Model
Dynamic Approaches: The Hidden Markov Model Davide Bacciu Dipartimento di Informatica Università di Pisa bacciu@di.unipi.it Machine Learning: Neural Networks and Advanced Models (AA2) Inference as Message
More informationDiscrete & continuous characters: The threshold model
Discrete & continuous characters: The threshold model Discrete & continuous characters: the threshold model So far we have discussed continuous & discrete character models separately for estimating ancestral
More informationAn Introduction to Bayesian Networks: Representation and Approximate Inference
An Introduction to Bayesian Networks: Representation and Approximate Inference Marek Grześ Department of Computer Science University of York Graphical Models Reading Group May 7, 2009 Data and Probabilities
More informationMichael Yaffe Lecture #5 (((A,B)C)D) Database Searching & Molecular Phylogenetics A B C D B C D
7.91 Lecture #5 Database Searching & Molecular Phylogenetics Michael Yaffe B C D B C D (((,B)C)D) Outline Distance Matrix Methods Neighbor-Joining Method and Related Neighbor Methods Maximum Likelihood
More informationLecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM)
Bioinformatics II Probability and Statistics Universität Zürich and ETH Zürich Spring Semester 2009 Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM) Dr Fraser Daly adapted from
More informationConditional Random Field
Introduction Linear-Chain General Specific Implementations Conclusions Corso di Elaborazione del Linguaggio Naturale Pisa, May, 2011 Introduction Linear-Chain General Specific Implementations Conclusions
More informationProbabilistic Graphical Models: MRFs and CRFs. CSE628: Natural Language Processing Guest Lecturer: Veselin Stoyanov
Probabilistic Graphical Models: MRFs and CRFs CSE628: Natural Language Processing Guest Lecturer: Veselin Stoyanov Why PGMs? PGMs can model joint probabilities of many events. many techniques commonly
More informationEstimating Phylogenies (Evolutionary Trees) II. Biol4230 Thurs, March 2, 2017 Bill Pearson Jordan 6-057
Estimating Phylogenies (Evolutionary Trees) II Biol4230 Thurs, March 2, 2017 Bill Pearson wrp@virginia.edu 4-2818 Jordan 6-057 Tree estimation strategies: Parsimony?no model, simply count minimum number
More informationarxiv: v1 [q-bio.pe] 4 Sep 2013
Version dated: September 5, 2013 Predicting ancestral states in a tree arxiv:1309.0926v1 [q-bio.pe] 4 Sep 2013 Predicting the ancestral character changes in a tree is typically easier than predicting the
More informationConstructing Evolutionary/Phylogenetic Trees
Constructing Evolutionary/Phylogenetic Trees 2 broad categories: istance-based methods Ultrametric Additive: UPGMA Transformed istance Neighbor-Joining Character-based Maximum Parsimony Maximum Likelihood
More informationPhylogenetic Inference and Hypothesis Testing. Catherine Lai (92720) BSc(Hons) Department of Mathematics and Statistics University of Melbourne
Phylogenetic Inference and Hypothesis Testing Catherine Lai (92720) BSc(Hons) Department of Mathematics and Statistics University of Melbourne November 13, 2003 Contents 1 Introduction 4 2 Molecular Phylogenetics
More informationPart I. C. M. Bishop PATTERN RECOGNITION AND MACHINE LEARNING CHAPTER 8: GRAPHICAL MODELS
Part I C. M. Bishop PATTERN RECOGNITION AND MACHINE LEARNING CHAPTER 8: GRAPHICAL MODELS Probabilistic Graphical Models Graphical representation of a probabilistic model Each variable corresponds to a
More informationGraphical Models and Kernel Methods
Graphical Models and Kernel Methods Jerry Zhu Department of Computer Sciences University of Wisconsin Madison, USA MLSS June 17, 2014 1 / 123 Outline Graphical Models Probabilistic Inference Directed vs.
More information1. what conditional independencies are implied by the graph. 2. whether these independecies correspond to the probability distribution
NETWORK ANALYSIS Lourens Waldorp PROBABILITY AND GRAPHS The objective is to obtain a correspondence between the intuitive pictures (graphs) of variables of interest and the probability distributions of
More informationA Minimum Spanning Tree Framework for Inferring Phylogenies
A Minimum Spanning Tree Framework for Inferring Phylogenies Daniel Giannico Adkins Electrical Engineering and Computer Sciences University of California at Berkeley Technical Report No. UCB/EECS-010-157
More informationProbabilistic Graphical Networks: Definitions and Basic Results
This document gives a cursory overview of Probabilistic Graphical Networks. The material has been gleaned from different sources. I make no claim to original authorship of this material. Bayesian Graphical
More informationA (short) introduction to phylogenetics
A (short) introduction to phylogenetics Thibaut Jombart, Marie-Pauline Beugin MRC Centre for Outbreak Analysis and Modelling Imperial College London Genetic data analysis with PR Statistics, Millport Field
More informationEvolutionary Analysis of Viral Genomes
University of Oxford, Department of Zoology Evolutionary Biology Group Department of Zoology University of Oxford South Parks Road Oxford OX1 3PS, U.K. Fax: +44 1865 271249 Evolutionary Analysis of Viral
More informationCS Lecture 3. More Bayesian Networks
CS 6347 Lecture 3 More Bayesian Networks Recap Last time: Complexity challenges Representing distributions Computing probabilities/doing inference Introduction to Bayesian networks Today: D-separation,
More informationProbabilistic Graphical Models
Probabilistic Graphical Models Brown University CSCI 295-P, Spring 213 Prof. Erik Sudderth Lecture 11: Inference & Learning Overview, Gaussian Graphical Models Some figures courtesy Michael Jordan s draft
More information1. Can we use the CFN model for morphological traits?
1. Can we use the CFN model for morphological traits? 2. Can we use something like the GTR model for morphological traits? 3. Stochastic Dollo. 4. Continuous characters. Mk models k-state variants of the
More informationPhylogenetics: Building Phylogenetic Trees
1 Phylogenetics: Building Phylogenetic Trees COMP 571 Luay Nakhleh, Rice University 2 Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary model should
More information13: Variational inference II
10-708: Probabilistic Graphical Models, Spring 2015 13: Variational inference II Lecturer: Eric P. Xing Scribes: Ronghuo Zheng, Zhiting Hu, Yuntian Deng 1 Introduction We started to talk about variational
More information11 The Max-Product Algorithm
Massachusetts Institute of Technology Department of Electrical Engineering and Computer Science 6.438 Algorithms for Inference Fall 2014 11 The Max-Product Algorithm In the previous lecture, we introduced
More informationApril 20th, Advanced Topics in Machine Learning California Institute of Technology. Markov Chain Monte Carlo for Machine Learning
for for Advanced Topics in California Institute of Technology April 20th, 2017 1 / 50 Table of Contents for 1 2 3 4 2 / 50 History of methods for Enrico Fermi used to calculate incredibly accurate predictions
More information5. Sum-product algorithm
Sum-product algorithm 5-1 5. Sum-product algorithm Elimination algorithm Sum-product algorithm on a line Sum-product algorithm on a tree Sum-product algorithm 5-2 Inference tasks on graphical models consider
More informationArtificial Intelligence
ICS461 Fall 2010 Nancy E. Reed nreed@hawaii.edu 1 Lecture #14B Outline Inference in Bayesian Networks Exact inference by enumeration Exact inference by variable elimination Approximate inference by stochastic
More informationAnnouncements. CS 188: Artificial Intelligence Fall Causality? Example: Traffic. Topology Limits Distributions. Example: Reverse Traffic
CS 188: Artificial Intelligence Fall 2008 Lecture 16: Bayes Nets III 10/23/2008 Announcements Midterms graded, up on glookup, back Tuesday W4 also graded, back in sections / box Past homeworks in return
More informationIntelligent Systems:
Intelligent Systems: Undirected Graphical models (Factor Graphs) (2 lectures) Carsten Rother 15/01/2015 Intelligent Systems: Probabilistic Inference in DGM and UGM Roadmap for next two lectures Definition
More informationBayesian Analysis of Elapsed Times in Continuous-Time Markov Chains
Bayesian Analysis of Elapsed Times in Continuous-Time Markov Chains Marco A. R. Ferreira 1, Marc A. Suchard 2,3,4 1 Department of Statistics, University of Missouri at Columbia, USA 2 Department of Biomathematics
More informationSampling Rejection Sampling Importance Sampling Markov Chain Monte Carlo. Sampling Methods. Machine Learning. Torsten Möller.
Sampling Methods Machine Learning orsten Möller Möller/Mori 1 Recall Inference or General Graphs Junction tree algorithm is an exact inference method for arbitrary graphs A particular tree structure defined
More informationLetter to the Editor. Department of Biology, Arizona State University
Letter to the Editor Traditional Phylogenetic Reconstruction Methods Reconstruct Shallow and Deep Evolutionary Relationships Equally Well Michael S. Rosenberg and Sudhir Kumar Department of Biology, Arizona
More informationCPSC 540: Machine Learning
CPSC 540: Machine Learning Undirected Graphical Models Mark Schmidt University of British Columbia Winter 2016 Admin Assignment 3: 2 late days to hand it in today, Thursday is final day. Assignment 4:
More informationIs the equal branch length model a parsimony model?
Table 1: n approximation of the probability of data patterns on the tree shown in figure?? made by dropping terms that do not have the minimal exponent for p. Terms that were dropped are shown in red;
More informationPhylogenetics: Bayesian Phylogenetic Analysis. COMP Spring 2015 Luay Nakhleh, Rice University
Phylogenetics: Bayesian Phylogenetic Analysis COMP 571 - Spring 2015 Luay Nakhleh, Rice University Bayes Rule P(X = x Y = y) = P(X = x, Y = y) P(Y = y) = P(X = x)p(y = y X = x) P x P(X = x 0 )P(Y = y X
More informationPOPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics
POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics - in deriving a phylogeny our goal is simply to reconstruct the historical relationships between a group of taxa. - before we review the
More information11. Learning graphical models
Learning graphical models 11-1 11. Learning graphical models Maximum likelihood Parameter learning Structural learning Learning partially observed graphical models Learning graphical models 11-2 statistical
More informationCSC 412 (Lecture 4): Undirected Graphical Models
CSC 412 (Lecture 4): Undirected Graphical Models Raquel Urtasun University of Toronto Feb 2, 2016 R Urtasun (UofT) CSC 412 Feb 2, 2016 1 / 37 Today Undirected Graphical Models: Semantics of the graph:
More informationHidden Markov Model. Ying Wu. Electrical Engineering and Computer Science Northwestern University Evanston, IL 60208
Hidden Markov Model Ying Wu Electrical Engineering and Computer Science Northwestern University Evanston, IL 60208 http://www.eecs.northwestern.edu/~yingwu 1/19 Outline Example: Hidden Coin Tossing Hidden
More informationProbabilistic Graphical Models
Probabilistic Graphical Models Lecture 11 CRFs, Exponential Family CS/CNS/EE 155 Andreas Krause Announcements Homework 2 due today Project milestones due next Monday (Nov 9) About half the work should
More informationBayesian Inference for DSGE Models. Lawrence J. Christiano
Bayesian Inference for DSGE Models Lawrence J. Christiano Outline State space-observer form. convenient for model estimation and many other things. Bayesian inference Bayes rule. Monte Carlo integation.
More informationLecture 8: Bayesian Networks
Lecture 8: Bayesian Networks Bayesian Networks Inference in Bayesian Networks COMP-652 and ECSE 608, Lecture 8 - January 31, 2017 1 Bayes nets P(E) E=1 E=0 0.005 0.995 E B P(B) B=1 B=0 0.01 0.99 E=0 E=1
More informationStatistical Approaches to Learning and Discovery
Statistical Approaches to Learning and Discovery Graphical Models Zoubin Ghahramani & Teddy Seidenfeld zoubin@cs.cmu.edu & teddy@stat.cmu.edu CALD / CS / Statistics / Philosophy Carnegie Mellon University
More informationBayesian Machine Learning - Lecture 7
Bayesian Machine Learning - Lecture 7 Guido Sanguinetti Institute for Adaptive and Neural Computation School of Informatics University of Edinburgh gsanguin@inf.ed.ac.uk March 4, 2015 Today s lecture 1
More information