SUBJECT: Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions

Transcription

1 User Bulletin ABI PRISM 3700 DNA Analyzer, ABI PRISM 3100 Genetic Analyzer, ABI PRISM 310 Genetic Analyzer, and ABI PRISM 377 DNA Sequencer April 11, 2002 SUBJECT: Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions Introduction About This User Bulletin This user bulletin describes the ethanol/sodium acetate precipitation method used to remove unincorporated dye terminators from ABI PRISM BigDye terminator v3.0 cycle sequencing reactions. IMPORTANT This method works well when performed exactly as detailed in this user bulletin. It is important that the recommended type and concentration of reagents are used. Ideally, we suggest performing controlled reactions along with your samples. Applicable Chemistry The ethanol/sodium acetate precipitation method described in this user bulletin is for use with the ABI PRISM BigDye terminator v3.0 chemistry. The following kits may be used: Kit Name ABI PRISM BigDye Terminator v3.0 Ready Reaction Cycle Sequencing Kit with AmpliTaq DNA Polymerase, FS Number of Reactions Part Number Note Perform the procedures in this user bulletin in conjunction with the ABI PRISM BigDye Terminator v3.0 Ready Reaction Cycle Sequencing Kit Protocol (P/N ).

2 Applicable Instruments The BigDye Terminator v3.0 Ready Reaction Cycle Sequencing Kit is for use with the following instruments: ABI PRISM 3700 DNA Analyzer ABI PRISM 3100 Genetic Analyzer ABI PRISM 310 Genetic Analyzer ABI PRISM 377 DNA Sequencer (all models 1 ) This kit can also be used with ABI PRISM 373 DNA Sequencers with the ABI PRISM BigDye Filter Wheel installed. 2 Refer to the ABI PRISM BigDye Filter Wheel User Bulletin (P/N ) for more information. IMPORTANT This kit is not designed for use with ABI PRISM 373 DNA Sequencers and ABI PRISM 373 DNA Sequencers with XL Upgrade that do not have the ABI PRISM BigDye Filter Wheel. In This User Bulletin The following topics are covered in this user bulletin: Topic See Page Safety 3 Technical Support 5 About Unincorporated Dye Terminators 6 Factors to Consider with the Ethanol/Sodium Acetate Precipitation Method 8 Technical Tips 11 Section: Ethanol/Sodium Acetate Precipitation Method 12 Ethanol/Sodium Acetate Concentrations 12 Ethanol/Sodium Acetate Precipitation in 96-Well Reaction Plates 15 Ethanol/Sodium Acetate Precipitation in Microcentrifuge Tubes 16 EDTA/Ethanol/Sodium Acetate Precipitation in 384-Well Reaction Plates Includes the ABI PRISM 377, ABI PRISM , ABI PRISM 377 with XL Upgrade, and the ABI PRISM 377 with 96-Lane Upgrade instruments. 2. Includes the ABI PRISM 373 and ABI PRISM 373 with XL Upgrade instruments. Page 2 of 20 Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions

3 Safety Documentation User Attention Words Five user attention words appear in the text of all Applied Biosystems user documentation. Each word implies a particular level of observation or action as described below. Note Calls attention to useful information. IMPORTANT Indicates information that is necessary for proper instrument operation, accurate chemistry kit use, or safe use of a chemical. Indicates a potentially hazardous situation which, if not avoided, may result in minor or moderate injury. It may also be used to alert against unsafe practices. Indicates a potentially hazardous situation which, if not avoided, could result in death or serious injury. Indicates an imminently hazardous situation which, if not avoided, will result in death or serious injury. This signal word is to be limited to the most extreme situations. Chemical Hazard Warning CHEMICAL HAZARD. Some of the chemicals used with Applied Biosystems instruments and protocols are potentially hazardous and can cause injury, illness, or death. Read and understand the material safety data sheets (MSDSs) provided by the chemical manufacturer before you store, handle, or work with any chemicals or hazardous materials. Minimize contact with chemicals. Wear appropriate personal protective equipment when handling chemicals (e.g., safety glasses, gloves, or protective clothing). For additional safety guidelines, consult the MSDS. Minimize the inhalation of chemicals. Do not leave chemical containers open. Use only with adequate ventilation (e.g., fume hood). For additional safety guidelines, consult the MSDS. Check regularly for chemical leaks or spills. If a leak or spill occurs, follow the manufacturer s cleanup procedures as recommended on the MSDS. Comply with all local, state/provincial, or national laws and regulations related to chemical storage, handling, and disposal. Chemical Waste Hazard Warning CHEMICAL WASTE HAZARD. Wastes produced by Applied Biosystems instruments are potentially hazardous and can cause injury, illness, or death. Read and understand the material safety data sheets (MSDSs) provided by the manufacturers of the chemicals in the waste container before you store, handle, or dispose of chemical waste. Handle chemical wastes in a fume hood. Minimize contact with chemicals. Wear appropriate personal protective equipment when handling chemicals (e.g., safety glasses, gloves, or protective clothing). For additional safety guidelines, consult the MSDS. Minimize the inhalation of chemicals. Do not leave chemical containers open. Use only with adequate ventilation (e.g., fume hood). For additional safety guidelines, consult the MSDS. After emptying the waste container, seal it with the cap provided. Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions Page 3 of 20

4 Dispose of the contents of the waste tray and waste bottle in accordance with good laboratory practices and local, state/provincial, or national environmental and health regulations. Site Preparation and Safety Guide Ordering MSDSs A site preparation and safety guide is a separate document sent to all customers who have purchased an Applied Biosystems instrument. Refer to the guide written for your instrument for information on site preparation, instrument safety, chemical safety, and waste profiles. You can order free additional copies of MSDSs for chemicals manufactured or distributed by Applied Biosystems using the contact information below. To order documents by automated telephone service: Step Action 1 From the U.S. or Canada, dial Follow the voice instructions to order documents (for delivery by fax). Note There is a limit of five documents per fax request. To order documents by telephone: In the U.S. Dial , and press 1. In Canada Dial , and press 1 for English or 2 for French. To view, download, or order documents through the Applied Biosystems web site: Step Action 1 Go to 2 Click SERVICES & SUPPORT at the top of the page, click Documents on Demand, then click MSDS. 3 Click MSDS Index, search through the list for the chemical of interest to you, then click on the MSDS document number for that chemical to open a PDF version of the MSDS. For chemicals not manufactured or distributed by Applied Biosystems, call the chemical manufacturer. Page 4 of 20 Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions

5 Technical Support Obtaining Services and Support For services and support, access the Applied Biosystems Web site: At the Applied Biosystems Web site, you can: Search through frequently asked questions (FAQs) Submit a question directly to Technical Support Order Applied Biosystems user documents, MSDSs, certificates of analysis, and other related documents Download PDF documents Obtain information about customer training Download software updates and patches In addition, the Applied Biosystems Web site provides a list of telephone and fax numbers that can be used to contact Technical Support. Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions Page 5 of 20

6 About Unincorporated Dye Terminators What Causes Unincorporated Dye Terminators in the Samples? What Do Unincorporated Dye Terminators Do? In BigDye terminator v3.0 cycle sequencing reactions, incomplete removal of the dye terminators may be due to: Problems with cycle sequencing reaction efficiency Suboptimal cleanup procedures Unincorporated dye terminators in the sequencing reaction can affect sequencing quality, particularly in systems with capillary electrokinetic injection. When unincorporated dye terminators are not removed completely, dye peaks can obscure portions of the sequencing electropherogram. This may cause the sequencing analysis software to make incorrect basecalls, particularly affecting its ability to determine peak 1 and start point locations. Location of Unincorporated Dye Terminators Figure 1 shows possible locations of BigDye terminator v3.0 unincorporated dye terminators. If the sequencing protocols and precipitation method in this user bulletin are followed correctly, unincorporated dye terminators located at positions 1, 4, 5, and 6 are removed completely. Occasionally, unincorporated dye terminators in positions 2 and 3 appear even when the precipitation method is performed carefully. If your application requires complete removal of unincorporated dye terminators, it may be more appropriate to use spin column cleanup protocols in place of alcohol precipitation. When used with an SDS heat treatment, commercially available products (e.g., Centri-Sep spin columns or the Gel Filtration Kit from Edge Biosystems) give very clean data. Note For more information, refer to the user bulletin Using an SDS/Heat Treatment with Spin Columns or 96-Well Spin Plates to Remove Unincorporated Dye Terminators (P/N ). NG ATCGACTC CTATAGGGCGAATTCGAGCT NCNTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAGTATTCTATAGT GTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCT TG AT CGACTC CTATAGGGCG AATTGGGTANTNC GCCCCCC CTCG AG AGCCTGGACCTC TC CGGCACCCTC CC C GGGGCCCCCAGCACCAG CCNG AAAACG ACTTGATCTGCTTAGAAGAG GCAACTTCGGG Figure 1 Unincorporated dye terminators (i.e., dye blobs) in two BigDye terminator v3.0 cycle sequencing reactions. The electropherograms shown are from a 3100 Genetic Analyzer (POP-6 polymer). Page 6 of 20 Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions

7 Migration of Unincorporated Dye Terminators When using BigDye terminator v3.0 chemistry, the migration of the unincorporated dye terminators depends on the gel/polymer matrix. Figure 2 shows unincorporated dye terminators from three BigDye terminator v3.0 cycle sequencing reactions, each run with a different gel/polymer matrix. Electropherogram Base Region Polymer/Gel Instrument POP-6 polymer 3100 Genetic Analyzer POP-5 polymer 3700 DNA Analyzer % Long Ranger gel 377 DNA Sequencer 1 A B 2 A B 3 A B Figure 2 Mobility of unincorporated dye terminators in BigDye terminator v3.0 cycle sequencing reactions Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions Page 7 of 20

8 Factors to Consider with the Ethanol/Sodium Acetate Precipitation Method Overview The ethanol/sodium acetate precipitation method is used for the BigDye terminator v3.0 chemistry. When using this precipitation method, several important factors should be considered to ensure success, as listed in the table below. To ensure success, consider the following: Careful adherence to protocol instructions Concentration of ethanol/sodium acetate page 12. Concentration of DNA below. Centrifuge time and g force page 9. Type of ethanol used page 9. Type of plate or tube used page 10. Type of centrifuge used page 10. For a detailed discussion, see... the protocols, beginning on page 12. DNA Concentration Versus Unincorporated Dye Terminators In most cases, more DNA template in the cycle sequencing reaction can help consume more dye terminators. This improves cleanup efficiency and thereby increases signal strength. However, the sequence quality and read length may be compromised if too much DNA is injected; additionally, the sequencing resolution may be lost if the signal is too high. Figure 3 on page 9 shows the concentrations of DNA template in five BigDye terminator v3.0 cycle sequencing reactions, as follows: Electropherogram a. Plasmid ranging from ~ 3 to 6 kb DNA Template a 1 50 ng ng ng ng 5 1 µg Page 8 of 20 Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions

9 Figure 3 DNA concentration versus unincorporated dye terminators. These reactions were cleaned using Centri-Sep spin columns. Centrifuge Time and g Force The relative centrifugal force (g) is dependent on the radius of the rotor and the speed of centrifugation. Since the revolutions per minute (rpm) will vary with the instrument and rotor, please calculate the correct g force using the equation below. The recovery of extended fragments increases with 30 minutes of centrifugation. Use this formula to calculate centrifuge spin speeds: g = x r x (rpm/1000) 2 where: g = relative centrifugal force rpm = revolutions per minute r = radius of the rotor in cm Type of Ethanol Used When exposed to air, absolute (100%) ethanol absorbs moisture from the air and becomes more dilute over time. This causes slight variations in concentration when absolute (100%) ethanol is used to generate 95% ethanol. To use the most accurate alcohol concentration and to minimize variations, we recommend using commercially prepared 95% ethanol. Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions Page 9 of 20

10 Plate and Tube Types The ethanol/precipitation method described in this user bulletin is for use with: 96-well reaction plates 384-well reaction plates Microcentrifuge tubes 96- and 384-Well Reaction Plates The protocols designed for use with 96- or 384-well reaction plates were optimized using Applied Biosystems MicroAmp reaction plates. Other 96- or 384-well formats should work efficiently, though the maximum amount of ethanol/sodium acetate that can be added to each well may be limited. Some plates accommodate larger volumes than others. The plates used must tolerate spin speeds up to 3000 x g for at least 30 minutes. Microcentrifuge Tubes Use 1.5- or 0.5-mL microcentrifuge tubes. The tubes used must tolerate spin speeds up to 15,000 g for at least 20 minutes. Variable-Speed Centrifuge for 96-Well Reaction Plates The protocols designed for use with the 96-well reaction plates require the samples to be centrifuged at different speeds: the first spin at > 2000 x g for 30 minutes to retrieve sequencing extension products, and the inverted spin at 50 x g for 1 minute to remove any remaining ethanol after decanting. Therefore, a variable-speed centrifuge functioning at the recommended spin speeds is essential for the success of these protocols. Page 10 of 20 Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions

11 Technical Tips Tips for Optimal Protocol Performance Follow these suggestions to ensure optimal protocol performance. After the addition of ethanol/sodium acetate, ensure that the solution is mixed thoroughly with the aqueous cycle sequencing sample. After the addition of ethanol/sodium acetate, let the samples sit at room temperature for at least 15 minutes for maximum precipitation of extension fragments. When using 96- or 384-well reaction plates, invert spin immediately after the 30-min spin. When using microcentrifuge tubes, aspirate off the supernatant immediately after the 20-min spin. If the inverted spin or aspiration is not performed immediately, the pellets may loosen and become lost during the spin or aspiration, resulting in weak signals. If the pellet is left in ethanol/sodium acetate solution for more than 1 minute, spin the samples again at: A spin speed greater than 2000 x g for 5 minutes for the 96- or 384-well reaction plates Maximum speed for 5 minutes for the microcentrifuge tubes When using microcentrifuge tubes, aspirating the supernatant is more effective than decanting. If performed carefully, aspiration removes nearly all of the supernatant. If your centrifuge cannot achieve a centrifugal force of 2000 g, a portion of the extension products may be lost. Work from a fresh source of 95% ethanol. Repeated opening can lead to ethanol evaporation and an ethanol concentration lower than 95%. Extension fragments are then difficult to precipitate, resulting in weak signals. To avoid evaporation of ethanol, aliquot to small bottles and keep tightly sealed when not in use. Use nondenatured ethanol. Denatured ethanol may contain additives such as benzene, toluene, methanol, etc. that may fluoresce during sequencing. Do not dry the inside of the tube with tissue. Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions Page 11 of 20

12 Section: Ethanol/Sodium Acetate Precipitation Method Considerations For most applications, the ethanol/sodium acetate precipitation method can give clean data. This method produces consistent signal, while minimizing unincorporated dye terminators. While the ethanol/sodium acetate precipitation method produces clean signal (i.e., a low amount of blobs), it may cause loss of small molecular weight fragments. In This Section The following topics are covered in this section: Topic See Page Ethanol/Sodium Acetate Concentrations 12 Ethanol/Sodium Acetate Precipitation in 96-Well Reaction Plates 15 Ethanol/Sodium Acetate Precipitation in Microcentrifuge Tubes 16 EDTA/Ethanol/Sodium Acetate Precipitation in 384-Well Reaction Plates 18 Ethanol/Sodium Acetate Concentrations Optimum Final Concentrations The optimum final concentrations of ethanol and sodium acetate for BigDye terminator v3.0 precipitations are: 59% ethanol 90 mm sodium acetate, ph 4.6 Decreasing the ethanol concentration may result in the loss of short sequencing fragments. The combination of 59% ethanol and 90 mm sodium acetate minimizes unincorporated dye terminators and the loss of small fragments, but maintains good overall signal strength. Page 12 of 20 Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions

13 Example Figure 4 below (gel images) and Figure 5 on page 14 (electropherograms) show the effects of ethanol/sodium acetate concentrations on BigDye terminator v3.0 precipitations. Plasmid DNA was sequenced using the standard recommended cycle sequencing protocol for BigDye terminator v3.0 chemistry. These reactions were precipitated by ethanol in the presence of sodium acetate (NaOAc) in a final volume of 100 µl, followed by a 150-µL 70% ethanol wash. The following ethanol and sodium acetate concentrations were used: Gel Image/ Electropherogram Ethanol Concentration Sodium Acetate Concentration % 90 mm % 90 mm 3 59% 90 mm 4 57% 90 mm 5 59% 360 mm 6 59% 270 mm 7 59% 180 mm Figure 4 Effect of ethanol/sodium acetate concentration on BigDye terminator v3.0 precipitations. The gel images are from a 377 DNA Sequencer. Figure 5 on page 14 shows the corresponding electropherograms (from a 3100 Genetic Analyzer) for the same sample. Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions Page 13 of 20

14 1 Signal G:132 A:138 T:218 C:128 2 Signal G:131 A:108 T:124 C:84 3 Signal G:87 A:77 T:92 C:65 4 Signal G:76 A:65 T:74 C:53 5 Signal G:93 A:77 T:94 C:67 6 Signal G:69 A:60 T:70 C:49 7 Signal G:67 A:60 T:75 C:51 Figure 5 Effect of ethanol/sodium acetate concentration on BigDye terminator v3.0 precipitations. The electropherograms are from a 3100 Genetic Analyzer (POP-6 polymer). Figure 4 on page 13 shows the corresponding gel images (from a 377 DNA Sequencer) for the same sample. Page 14 of 20 Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions

15 Another Option for Precipitation Another option for precipitation is to rinse with larger volumes of ethanol at the final 70% ethanol wash step. If you rinse with larger volumes of ethanol, there will be a greater dilution of excess dye terminators. Ethanol/Sodium Acetate Precipitation in 96-Well Reaction Plates 95% Ethanol Recommended IMPORTANT When exposed to air, absolute (100%) ethanol absorbs moisture from the air and becomes more dilute over time. This causes slight variations in concentration when absolute (100%) ethanol is used to generate 95% ethanol. To use the most accurate alcohol concentration and to minimize variations, we recommend using commercially prepared 95% ethanol. Precipitating in 96-Well Reaction Plates Note A final 70% ethanol wash is required. To precipitate a 20-µL reaction mixture in 96-well reaction plates: Step Action 1 a. Remove the 96-well reaction plate from the thermal cycler. b. Remove the cover from the reaction plate. 2 Prepare the ethanol/sodium acetate solution by combining the following for each sample: 3.0 µl of 3 M sodium acetate (NaOAc), ph µl of nondenatured 95% ethanol (EtOH) 14.5 µl of deionized water The final volume should be 80 µl for each sample.! WARNING CHEMICAL HAZARD. Ethanol is a flammable liquid and vapor. Exposure may cause eye, skin, and upper respiratory tract irritation. Prolonged or repeated contact may dry the skin. Exposure may cause central nervous system depression and liver damage. Keep away from heat, sparks, and flame. Read the MSDS, and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves. 3 Add the following to each 20-µL reaction mixture: 80 µl of ethanol/sodium acetate solution (created in step 2 above) 4 Seal the wells with a piece of 3M Scotch Tape 431 or 439 adhesive-backed aluminum foil tape. Press the foil onto the wells to prevent any leakage. 5 Invert the reaction plate a few times or vortex for 15 sec to mix. 6 Leave the reaction plate at room temperature for at least 15 min to precipitate the extension products. Note Precipitation times <15 min will result in the loss of very short extension products. Precipitation times >24 h will increase the precipitation of unincorporated dye terminators. Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions Page 15 of 20

16 To precipitate a 20-µL reaction mixture in 96-well reaction plates: (continued) Step Action 7 Place the reaction plate in a table-top centrifuge with a tube-tray adaptor and spin at the maximum speed, which must be 1400 g but <3000 g: g: 45 min g: 30 min Note A MicroAmp reaction plate can withstand 3000 g for 30 min. IMPORTANT Proceed to the next step immediately. If this is not possible, then spin the reaction plate for 2 min immediately before performing the next step. 8 Without disturbing the precipitates, remove the adhesive tape. 9 Invert the reaction plate onto a paper towel folded to the size of the plate. 10 Place the inverted reaction plate and paper towel into the table-top centrifuge and spin at 50 g for 1 min. IMPORTANT The supernatants must be removed completely, as unincorporated dye terminators are dissolved in them. The more residual supernatant left in the wells, the more unincorporated dye terminators will remain in the samples. 11 Add 150 µl of 70% ethanol to each pellet.! WARNING CHEMICAL HAZARD. Ethanol is a flammable liquid and vapor. Exposure may cause eye, skin, and upper respiratory tract irritation. Prolonged or repeated contact may dry the skin. Exposure may cause central nervous system depression and liver damage. Keep away from heat, sparks, and flame. Read the MSDS, and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves. 12 Seal the wells as in step 4 above, then invert the reaction plate a few times or vortex for 15 sec to mix. 13 Place the reaction plate in a table-top centrifuge with a tube-tray adaptor and spin for 10 min. Spin at the same speed you used in step 7 above. 14 Repeat steps 8 to Remove the reaction plate from the centrifuge and discard the paper towel. Note Pellets may or may not be visible. Vacuum drying of the samples is not necessary. Ethanol/Sodium Acetate Precipitation in Microcentrifuge Tubes 95% Ethanol Recommended IMPORTANT When exposed to air, absolute (100%) ethanol absorbs moisture from the air and becomes more dilute over time. This causes slight variations in concentration when absolute (100%) ethanol is used to generate 95% ethanol. To use the most accurate alcohol concentration and to minimize variations, we recommend using commercially prepared 95% ethanol. Page 16 of 20 Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions

17 Precipitating in Microcentrifuge Tubes Note A final 70% ethanol wash is required. To precipitate a 20-µL reaction mixture in microcentrifuge tubes: Step Action 1 Pipet the entire contents of each 20-µL reaction mixture into a 1.5-mL microcentrifuge tube. IMPORTANT If the TC1 or DNA Thermal Cycler 480 was used for thermal cycling, remove the reactions from the tubes as described below. To remove reactions run on the TC1 or DNA Thermal Cycler 480: Place the pipette tip into the bottom of the reaction and carefully remove the reaction from the oil. Transfer as little oil as possible. Oil Reaction 2 Prepare the ethanol/sodium acetate solution by combining the following for each sample: 3.0 µl of 3 M sodium acetate (NaOAc), ph µl of nondenatured 95% ethanol (EtOH) 14.5 µl of deionized water The final volume should be 80 µl for each sample.! WARNING CHEMICAL HAZARD. Ethanol is a flammable liquid and vapor. Exposure may cause eye, skin, and upper respiratory tract irritation. Prolonged or repeated contact may dry the skin. Exposure may cause central nervous system depression and liver damage. Keep away from heat, sparks, and flame. Read the MSDS, and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves. 3 Add the following to each 20-µL reaction mixture: 80 µl of ethanol/sodium acetate solution (created in step 2 above) 4 Close the tubes and vortex briefly. 5 Leave the tubes at room temperature for at least 15 min to precipitate the extension products. Note Precipitation times <15 min will result in the loss of very short extension products. Precipitation times >24 h will increase the precipitation of unincorporated dye terminators. 6 Place the tubes in a microcentrifuge and mark their orientations. Spin the tubes for 20 min at 15,000 g. (If your microcentrifuge cannot achieve 15,000 g, spin at its maximum speed.) IMPORTANT Proceed to the next step immediately. If this is not possible, then spin the tubes for 2 min immediately before performing the next step. Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions Page 17 of 20

18 To precipitate a 20-µL reaction mixture in microcentrifuge tubes: (continued) Step Action 7 Aspirate the supernatants carefully with a separate pipette tip for each sample and discard. Pellets may or may not be visible. IMPORTANT The supernatants must be removed completely, as unincorporated dye terminators are dissolved in them. The more residual supernatant left in the tubes, the more unincorporated dye terminators will remain in the samples. 8 Add 250 µl of 70% ethanol to the tubes and mix briefly.! WARNING CHEMICAL HAZARD. Ethanol is a flammable liquid and vapor. Exposure may cause eye, skin, and upper respiratory tract irritation. Prolonged or repeated contact may dry the skin. Exposure may cause central nervous system depression and liver damage. Keep away from heat, sparks, and flame. Read the MSDS, and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves. 9 Place the tubes in the microcentrifuge in the same orientation as step 6 above and spin for 5 min. Spin at the same speed you used in step Aspirate the supernatants carefully, as in step Dry the samples in a vacuum centrifuge for 10 to 15 min or to dryness. Do not over-dry. EDTA/Ethanol/Sodium Acetate Precipitation in 384-Well Reaction Plates 95% Ethanol Recommended IMPORTANT When exposed to air, absolute (100%) ethanol absorbs moisture from the air and becomes more dilute over time. This causes slight variations in concentration when absolute (100%) ethanol is used to generate 95% ethanol. To use the most accurate alcohol concentration and to minimize variations, we recommend using commercially prepared 95% ethanol. Precipitating in 384-Well Reaction Plates This protocol uses 10 µl of reaction mixture per well. This ensures you will not exceed the volume capacity of the 384-well reaction plates. Note A final 70% ethanol wash is optional. To precipitate a 10-µL reaction mixture in 384-well reaction plates: Step Action 1 a. Remove the 384-well reaction plate from the thermal cycler. b. Remove the seal from the reaction plate. 2 To 10 µl of reaction mixture, add 1 µl of 250 mm EDTA and mix.! CAUTION CHEMICAL HAZARD. EDTA may cause eye, skin, and respiratory tract irritation. Please read the MSDS, and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves. Page 18 of 20 Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions

19 To precipitate a 10-µL reaction mixture in 384-well reaction plates: (continued) Step Action 3 Prepare the ethanol/sodium acetate solution by combining the following for each sample: 1 µl of 3 M sodium acetate (NaOAc), ph µl of nondenatured 95% ethanol (EtOH) 1 µl of deionized water The final ethanol concentration should be 62%.! WARNING CHEMICAL HAZARD. Ethanol is a flammable liquid and vapor. Exposure may cause eye, skin, and upper respiratory tract irritation. Prolonged or repeated contact may dry the skin. Exposure may cause central nervous system depression and liver damage. Keep away from heat, sparks, and flame. Read the MSDS, and follow the handling instructions. Wear appropriate protective eyewear, clothing, and gloves. 4 Add the following to each 11-µL reaction mixture/edta sample: 25 µl of ethanol/sodium acetate solution (created in step 3 above) The final reaction volume should be 36 µl for each sample. 5 Seal the wells with a piece of 3M Scotch Tape 431 or 439 adhesive-backed aluminum foil tape. Press the foil onto the wells to prevent any leakage. 6 Invert the reaction plate a few times or vortex for 15 sec to mix. 7 Leave the reaction plate at room temperature for at least 15 min to precipitate the extension products. Note Precipitation times <15 min will result in the loss of very short extension products. Precipitation times >24 h will increase the precipitation of unincorporated dye terminators. 8 Place the reaction plate in a table-top centrifuge with a plate adaptor and spin at the maximum speed, which must be 1400 g but <3000 g: g: 45 min g: 30 min IMPORTANT Proceed to the next step immediately. If this is not possible, then spin the reaction plate for 2 min immediately before performing the next step. 9 Without disturbing the precipitates, remove the adhesive tape and pour out the supernatant. 10 Invert the reaction plate onto a paper towel folded to the size of the plate. 11 Place the inverted reaction plate and paper towel into the table-top centrifuge and spin at 20 g for 1 min. IMPORTANT The supernatants must be removed completely, as unincorporated dye terminators are dissolved in them. The more residual supernatant left in the wells, the more unincorporated dye terminators will remain in the samples. 12 Remove the reaction plate from the centrifuge and discard the paper towel. Pellets may or may not be visible. Precipitation Method to Remove Unincorporated Dye Terminators from ABI PRISM BigDye Terminator v3.0 Cycle Sequencing Reactions Page 19 of 20

20 To precipitate a 10-µL reaction mixture in 384-well reaction plates: (continued) Step Action 13 Optional. To avoid residual terminator peaks, before drying: a. Rinse the pellets with 35 µl of 70% ethanol. b. Seal the wells as in step 5 above, then invert the reaction plate a few times or vortex for 15 sec to mix. c. Place the reaction plate in a table-top centrifuge with a tube-tray adaptor and spin for 10 min. Spin at the same speed you used in step 8 above. d. Repeat step 9 to step Dry the samples by: Placing in a Speed-Vac for 15 min OR Air drying at room temperature for 1 h IMPORTANT drying. Make sure the samples are protected from light while they are Copyright 2002, Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information in this document is subject to change without notice. Applied Biosystems assumes no responsibility for any errors that may appear in this document. This document is believed to be complete and accurate at the time of publication. In no event shall Applied Biosystems be liable for incidental, special, multiple, or consequential damages in connection with or arising from the use of this document. ABI PRISM and its Design, Applied Biosystems, and MicroAmp are registered trademarks of Applera Corporation or its subsidiaries in the U.S. and certain other countries. AB (Design), ABI, Applera, BigDye, POP-5, and POP-6 are trademarks of Applera Corporation or its subsidiaries in the U.S. and certain other countries. Centri-Sep is a trademark of Princeton Separations, Inc. Long Ranger is a registered trademark of BioWhittaker Molecular Applications. All other trademarks are the sole property of their respective owners. Printed in the USA, 4/2002 P/N , Rev. A, Stock No. 106UB29-01