Precision Polymers and 3D DNA Nanostructures: Emergent Assemblies from New Parameter Space - Supporting Information
|
|
- Phyllis Lambert
- 5 years ago
- Views:
Transcription
1 Precision Polymers and 3D DNA Nanostructures: Emergent Assemblies from New Parameter Space - Supporting Information Christopher J. Serpell, Thomas G. W. Edwardson, Pongphak Chidchob, Karina M. M. Carneiro, Hanadi F. Sleiman* Department of Chemistry and Centre for Self-assembled Chemical Structures, McGill University, 801 Sherbrooke Street West, Montreal, QC H3A 2K6, Canada. * hanadi.sleiman@mcgill.ca General Considerations Acetic acid, tris(hydroxymethyl)-aminomethane (Tris), formamide, urea, and polypropylene oxide (PPO) were used as purchased from Aldrich. Acetic acid and boric acid were purchased from Fisher Scientific and used without further purification. Nucleoside (da, dc, dg and T) derivatized 1000Å LCAACPG supports with loading densities between μmol/g and reagents used for automated DNA synthesis were purchased from Bioautomation Corporated. The hexa(ethylene glycol) (HEG) and dodecane-diol (HE) phosphoramidites were purchased from ChemGenes Corporated. Sephadex G-25 (super fine, DNA grade) was purchased from Glen research. 1xTBE buffer is composed of 0.09M Tris and boric acid (TB) and 2 mm EDTA with a ph ~8.3. 1xTAMg buffer is composed of 45 mm Tris, and 12.5 mm Mg(OAc) 2 6H 2O. The ph was adjusted to 8 using glacial acetic acid. Gels were stained using GelRed and imaged by BioRad ChemiDoc MP, with BioRad Image Lab 5.0 software. Synthesis and purification of DNA strands DNA strands were synthesised using automated oligonucleotide solid-phase synthesis performed on a Mermade MM6 synthesizer from Bioautomation. Optimal yields for the HEG insertion could be obtained by using an extended five minute coupling time. Washing, capping, and oxidation were then achieved using the synthesiser, followed by appendage of the next DNA tract. Coupling efficiency was monitored after removal of the dimethoxytrityl (DMT) 5ʹ-OH protecting groups. Strands were synthesised on a 1 µmol scale, after which cleavage and deprotection was achieved by treatment with concentrated NH 4OH (1 hour at room temperature, followed by at least 4 hours at 60 C). Crude clip strands were purified on 12 % polyacrylamide/8m urea polyacrylamide gels (PAGE; up to 20 OD 260 of crude DNA per gel) at constant current of 30 ma and set voltage of 250V for 30 minutes followed by a set voltage of 500V for 1 hour using 1x TBE buffer. Following electrophoresis, the gels were wrapped in plastic and placed on a fluorescent TLC plate and illuminated with a UV lamp (254 nm). The bands were quickly excised, and the gel pieces were crushed and incubated in 12 ml of sterile water at 55 C for 16 hours. Samples were then dried to ca. 1.5 ml, and desalted using size exclusion chromatography (Sephadex G-25), and then quantified (OD 260) using a NanoDrop Lite spectrophotometer from Thermo Scientific. The protocol for fluorescently labelled strands depended upon the dye in question. Strand B-A488 was generated using a commercially available amine-modified CPG to give a 3 -amine DNA strand, which was then coupled with Alexa488-NHS ester (Life Technologies) according to the manufacturer s instructions. Cy dyes were appended to strands at the 5 ends using commercial phosphoramidite reagents (Glen Research), performing the reaction manually in a glove box with a coupling time of 15 minutes. The Eclipse Quencher strand was generated using a functionalised CPG (Glen Research), resulting in a 3 modification. Whether the strands were modified at the 3 or 5 ends, a 5T spacer was inserted between the dye and the 14mer binding region. After the synthesis, the strands were purified according the protocol described for clip strands, using 15% denaturing PAGE. Extinction coefficients at 260 nm for the dyes were taken into consideration in the quantification (Alexa488 = , Cy3 = , Cy5 = , EQ = M 1 cm 1 ). S1
2 DNA-polymer strands were synthesised and characterised exactly as previously reported. 1 Sequence Design Clips are designated with a number, representing their position in the prism, and two letters indicating the sequences of the single-stranded binding regions presented in the assembled object. A prefix is appended to the special strands required for non-cubic prisms (TP or PP). X designates a hexa(ethylene glycol) insertion. The A sequence is complementary to the DNA-polymer and is drawn red in the figures. Table S1. DNA sequences. Strand Sequence 1-AA 2-AA 3-AA 4-AA 1-AB 2-AB 3-AB 4-AB 1-TT 3-TT 4-TT 2-AC 3-AD 4-AE TP3-AB PP4-AB PP5-AB HE x-a (HE) xtttttcagttgaccatata HE x-b (HE) xtttttccatctggtattac B-A488 CCATCTGGTATTACTTTTT-A488 C-Cy3 Cy3-TTTTTTCTTACGGCAGAGT D-Cy5 Cy5-TTTTTATGGACCAAGGCCA E-EQ CTCTGCTAATCCTGTTTTT-EQ A20 GAGCAGTTGACCATATAGGA B20 ACTCCATCTGGTATTACTAC XL1 TTTAATGCGCGAGCAGTTGACCATATAGGA XL2 GAGCAGTTGACCATATAGGAACATAGAGCG XLX GCGCATTAAACGCTCTATGT +30 GTAAATGACGACTCCATCTGGTATTACTAC +60 GGATTGCACTCGCGTCCTGAAATTCGATCATGTTTCGCCGACTCCATCTGGTATTACTAC +100 ACTCCATCTGGTATTACTACGCCATTAAGTTAGGCCGGTTGGATTGCACT CGCGTCCTGAAATTCGATCATGTTTCGCCGACTCCATCTGGTATTACTAC TCGCTGAGTAXTCCTATATGGTCAACTGCTCXGCAAGTGTGGGCACGCACACXTCCTATATGGTCAACTGCTCXCACAAATCTG CTATCGGTAGXTCCTATATGGTCAACTGCTCXTACTCAGCGACAGATTTGTGXTCCTATATGGTCAACTGCTCXCAACTAGCGG CACTGGTCAGXTCCTATATGGTCAACTGCTCXCTACCGATAGCCGCTAGTTGXTCCTATATGGTCAACTGCTCXGGTTTGCTGA CCACACTTGCXTCCTATATGGTCAACTGCTCXCTGACCAGTGTCAGCAAACCXTCCTATATGGTCAACTGCTCXGTGTGCGTGC TCGCTGAGTAXTCCTATATGGTCAACTGCTCXGCAAGTGTGGGCACGCACACXGTAGTAATACCAGATGGAGTXCACAAATCTG CTATCGGTAGXTCCTATATGGTCAACTGCTCXTACTCAGCGACAGATTTGTGXGTAGTAATACCAGATGGAGTXCAACTAGCGG CACTGGTCAGXTCCTATATGGTCAACTGCTCXCTACCGATAGCCGCTAGTTGXGTAGTAATACCAGATGGAGTXGGTTTGCTGA CCACACTTGCXTCCTATATGGTCAACTGCTCXCTGACCAGTGTCAGCAAACCXGTAGTAATACCAGATGGAGTXGTGTGCGTGC TCGCTGAGTAXTCCTTTTTTTTTTTTTTCTCXGCAAGTGTGGGCACGCACACXGTATTTTTTTTTTTTTTAGTXCACAAATCTG CACTGGTCAGXTCCTTTTTTTTTTTTTTCTCXCTACCGATAGCCGCTAGTTGXGTATTTTTTTTTTTTTTAGTXGGTTTGCTGA CCACACTTGCXTCCTTTTTTTTTTTTTTCTCXCTGACCAGTGTCAGCAAACCXGTATTTTTTTTTTTTTTAGTXGTGTGCGTGC CTATCGGTAGXTCCTATATGGTCAACTGCTCXTACTCAGCGACAGATTTGTGXAAAACTCTGCCGTAAGAGGAXCAACTAGCGG CACTGGTCAGXTCCTATATGGTCAACTGCTCXCTACCGATAGCCGCTAGTTGXGCCTGGCCTTGGTCCATTTGXGGTTTGCTGA CCACACTTGCXTCCTATATGGTCAACTGCTCXCTGACCAGTGTCAGCAAACCXTAACAGGATTAGCAGAGCGAXGTGTGCGTGC CCACACTTGCXTCCTATATGGTCAACTGCTCXCTACCGATAGCCGCTAGTTGXGTAGTAATACCAGATGGAGTXGTGTGCGTGC TACCGGATCGXTCCTATATGGTCAACTGCTCXCTGACCAGTGTCAGCAAACCXGTAGTAATACCAGATGGAGTXCCGTAATTGC CCACACTTGCXTCCTATATGGTCAACTGCTCXCGATCCGGTAGCAATTACGGXGTAGTAATACCAGATGGAGTXGTGTGCGTGC S2
3 Figure S1. Denaturing PAGE (12%, TBE buffer) analysis of clip strands. Figure S2. Denaturing PAGE (15%, TBE) analysis of other strands: (left) stained by GelRed; (right) overlay of three-channel fluorescence scan showing orthogonal excitation and emission between dyes and lack of emission from quencher. S3
4 Assembly of DNA Cubes For gel studies, DNA nanostructures were assembled using 5 M stock solutions in 1x TAMg buffer of the particular strands needed in each case, added in stoichiometric quantities. The strands were mixed together and then annealed slowly from 90 to 4 C over four hours in an Eppendorf Mastercycler pro Thermal Cycler. Before loading on gels, 1 L of glycerine solution per 6 L of sample was mixed in to ensure that the DNA sank to the bottom of the appropriate lane. The prisms discussed in this manuscript are given names according to their shape (TP, C, or PP), and the number of A sequences they display. They were assembled using the following combinations: Table S2. Structure and strand composition of DNA prisms. Prism Diagram Clips used C1 1-TT, 2-AB, 3-TT, 4-TT C2 1-TT, 2-AB, 3-TT, 4-AB C2 1-TT, 2-AA, 3-TT, 4-TT C3 C4 1-AB, 2-AB, 3-AB, 4-TT 1-AB, 2-AB, 3-AB, 4-AB C4 1-TT, 2-AA, 3-TT, 4-AA C6 C8 1-AA, 2-AA, 3-AA, 4-TT 1-AA, 2-AA, 3-AA, 4-AA C4* 1-AB, 2-AC, 3-AD, 4-AE TP PP 1-AB, 2-AB, TP3-AB 1-AB, 2-AB, 3-AB, PP4-AB, PP5-AB S4
5 Figure S3. Native PAGE (6%, TAMg buffer) showing step-wise assembly of DNA prisms. Mixtures are simply mixed at room temperature, except when designated with a, meaning that they were subjected to a 4 hour anneal from 95 to 4 C. Left: TP, centre: C4, right: PP. All three gels are run under identical conditions, and the first two bands (1-AB, and 1-AB + 2-AB) are kept constant to enable accurate comparison. Figure S4. Native PAGE (5%, TAMg buffer) showing DNA cubes with different single stranded regions. Minor variations in mobility are to be expected. S5
6 Dynamic Light Scattering Samples for DLS were prepared at 0.5 µm with respect to total DNA strand concentration. 15µL aliquots were then analysed on a DynaPro (model MS) molecular-sizing instrument using a laser wavelength of 824 nm. Transmission Electron Microscopy Samples (2 μl at 0.5 µm w.r.t. total DNA) were deposited on carbon film coated copper EM grids for one minute, followed by blotting off the excess liquid with the edge of a filter paper, and washing three times with 20 µl of water, before drying under vacuum. The samples were imaged using a Tecnai 12 microscope (FEI electron optics) equipped with a Lab6 filament at 120kV. Images were acquired using a Gatan 792 Bioscan 1k x 1k Wide Angle Multiscan CCD Camera (Gatan Inc.). Contrast was adjusted automatically - note that in the presence of any high-contrast foreign matter, this results in the micelles being almost invisible. Images were analysed using ImageJ, which required manually setting threshold levels and placing limits on the size and circularity of features to ensure correct particle picking. The area values obtained were converted into radii (for comparison with DLS), making the assumption that the features are circular, which can be readily validated by eye. High resolution images were acquired using a FEI Tecnai G2 F20 operating at 120 kv equipped with a Gatan Ultrascan k x 4k CCD Camera System Model 895, after staining the grids for 1 minute with uranyl formate. Atomic Force Microscopy Samples (5 μl at 0.5 µm w.r.t. total DNA) were deposited for on freshly cleaved mica for ca. 5 seconds, followed by wicking off excess liquid with the edge of a filter paper, and washing with 5 x 50 µl water, blowing-off of excess liquid under a stream of air, and drying under vacuum for 20 minutes. Measurements were acquired using a Multimode 8 scanning probe microscope and Nanoscope V controller (Bruker, Santa Barbara, CA), running NanoScope 8 in PeakForce tapping with silicon nitride probes (Bruker type ScanAsyst) of nominal spring constant of 0.4 N/m, resonant frequency of 70 khz and tip radius < 5 nm. Images were processed using NanoScope Analysis Fluorescence Measurements Fluorescence scans of gels were taken using a BioRad ChemiDoc MP, with BioRad Image Lab 5.0 software, and the settings below. Table S3. Excitation and emission settings for gel imaging of fluorophores. Experiment A488 Cy3 Cy5 A488 Cy3 Cy3 Cy5 A488 Cy5 Illumination Blue epi Green epi Red epi Blue epi Green epi Blue epi Measured λ filter 530/28 nm 605/50 nm 695/55 nm 605/50 nm 695/55 nm 695/55 nm Fluorescence spectra were recorded on a BioTek Synergy HT microplate reader using 60 ul of sample with a fixed DNA cube concentration of µm, and dyes or polymers in stoichiometric ratios as appropriate. A488 was excited at 488 nm, Cy3 at 545 nm, and Cy5 at 646 nm. Emission was measured from 500 (A488), 555 (Cy3), or 655 (Cy5) nm up to 800 nm. Each well was scanned with every excitation wavelength in triplicate. S6
7 Figure S5. Further AFM images and analysis of structures arising from C4/HE 7. Height = 2.2 ± 0.4 nm, diameter = 25.5 ± 4.6 nm (184 features measured). Note preponderance of triangular and linear (aspect ratio = 2) structures suggesting dimeric and tetrahedral (or possibly trigonal planar) structures. S7
8 Figure S6. AFM images of structures arising from C4/HE 8. Height = 2.4 ± 0.3 nm, diameter = 27.9 ± 5.2 nm (184 features measured). Note presence of quadrilateral structures in addition to triangular and linear structures, suggesting projections of octahedral products. S8
9 Figure S7. Native PAGE (5%, TAMg buffer) of products arising from C4 and HE x at varying ratios. Figure S8. Native PAGE (5%, TAMg buffer) analysis of effect of Mg 2+ concentraion upon assembly of C4/HE 7 self-assembly. S9
10 Figure S9. The double-stranded regions of the cube (20 base pairs = 6.8 nm) are expected to be aligned with the radius of the micelle (17.4 nm), meaning that the polymers occupy a sphere of radius 10.6 nm. The surface area of such a sphere upon which the cubes must sit is 4πr 2 = 1412 nm 2. The area of the face of cube is less certain, since there are flexible single-stranded regions. Assuming that this effect is not significant, side length would be nm to accommodate the width of the duplexes as well as their length, giving an area of 81.0 nm 2. This would fit just over 17 times onto the surface of the polymer sphere. A compression of the cube side area is possible, which would increase this number, however since squares do not pack well onto the surface of a sphere, and there ratio of the total radius taken up by cubes would be higher if duplex width is accounted for, the value is more likely to be lower. S10
11 Figure S10. PAGE analysis of ExoVII degradation assay. Left: Native (5%, TAMg buffer), right: denaturing (12%, TBE buffer). S11
12 C4/H 12 micelle +30 base strand: R H = 19.7 nm (13.4% PD) C4/H 12 micelle +60 base strand: R H = 21.0 nm (13.8% PD) C4/H 12 micelle +100 base strand: R H = 24.0 nm (28.6% PD) Figure S11. DLS correlation functions and size distributions for micelles of prisms with extension strands after incubation of the preannealed micelle with 1.1 equivalents of the extension strand for 30 minutes at 37 C. (0.5 µm total DNA, TAMg buffer, 25 C). For comparison: the C4/H 12 micelle has R h of 17.4 nm. S12
13 Normalised particle count C4/H 12 micelle + 30 base strands: R = 16.6 ± 2.8 nm (493 particle counted) C4/H 12 micelle + 60 base strands: R = 18.3 ± 2.0 nm (241 particles counted) C4/H 12 micelle base strands: R = 20.3 ± 3.8 nm (98 particles counted) Radius (nm) Figure S12. TEM images and size analysis of micelles hybridised to extension strands. S13
14 TP/HE 12 micelle: R H = 16.6 nm (12.4% PD) C4/HE 12 micelle: R H = 17.4 nm (8.5% PD) PP/HE 12 micelle: R H = 18.6 nm (21.0% PD) Figure S13. DLS correlation functions and size distributions for micelles of prisms (0.5 µm total DNA, TAMg buffer, 25 C). For comparison: DNA cubes have R h of about 6 nm, 2, 3 while micelles of HE 12-DNA are sized at 11 nm 1 S14
15 Particle count More Radius (nm) Figure S 14. TEM images of TP/HE 12 micelle, with size analysis. Radius = 12.0 ± 1.7 nm (742 particles measured). S15
16 Particle count More Radius (nm) Figure S15. Further TEM images of C4/HE 12 micelle, with size analysis. Radius = 13.2 ± 1.9 (174 particles measured). S16
17 Particle count More Radius (nm) Figure S16. TEM images of PP/HE 12 micelle, with size analysis. Radius = 12.8 ± 1.7 (483 particles measured) S17
18 Figure S17. AFM images of TP/HE 12 micelles. Measuring 157 particles: height = 7.45 ± 0.56 nm; diameter = ± 2.00 nm. S18
19 Figure S18. Further AFM images of C4/HE 12 micelles. Measuring 97 particles: height = 6.06 ± 2.18 nm; diameter = ± 8.78 nm. S19
20 Figure S19. AFM images of PP/HE 12 micelles. Measuring 90 particles: height = 8.00 ± 1.04 nm; diameter = ± 1.17 nm. S20
21 Figure S20. Native PAGE (5%, TAMg buffer) of displacment of DNA prisms from micellar superstructures. Displacment was achieved by incubating the prism/micelles with 1.2 equivalents of A20 which is complementary to the full length of the side of the prism. The difference in mobility between the displacement product band and the prism is expected, being due to the presence of the A20. S21
22 Figure S21. Further TEM images of crosslinked C4/HE 12 micelles. In this experiment, since the linking strands (XL1 and XL2) are complementary to the A sequence, HE 12-DNA with the complement the B-sequence was used. The initial micelle created in this way is otherwise identical to that made using the HE 12-DNA with the A sequence. S22
23 Figure S22. Additional AFM images of concentration-mediated superstructures of C4/HE 12 micelles, and height cross-section analysis. The average height over 194 features (7.7 ± 1.9 nm) is similar to that of individual micelles (6 nm). The separation between peaks (ca. 30 nm) is slightly less than the measured diameter of free micelles (42 nm), which is expected given the greater influence of tip convolution on individual features and potential compression of the micelles as they pack. S23
24 Figure S23. Fluorescence scans of native PAGE (5%, TAMg buffer) analysis of dyes appended to free C4 DNA cubes. Dye strands (1.0 eqv) were incubated with pre-formed cubes for 30 minutes at 37 C. Lane 0 = no dyes, 1 = Alexa488, 2 = Cy3, 3 = Cy5, 4 = EQ, 5 = Alexa488 + Cy3, 6 = Cy3 + Cy5, 7 = Alexa488 + Cy5, 8 = Alexa488 + EQ, 9 = Cy3 + EQ, 10 = Cy5 + EQ, 11 = Alexa488 + Cy3 + Cy, 12 = Alexa488 + Cy3 + Cy5 + EQ. Left: 2-dye FRET. Red channel = excitation of Alexa488, observing emission of Cy3, blue channel = excitation of Cy3, observing emission of Cy5. Centre: 3-dye FRET, exciting Alexa488 and observing Cy5 emission. Right: Visualising DNA using GelRed. Figure S24. Fluorescence scans of native AGE (2.5%, TAMg buffer) analysis of dyes appended to C4/HE 12 micelles. Dye strands (1.0 eqv) were incubated with pre-formed micelles for 30 minutes at 37 C. Lane 0 = no dyes, 1 = Alexa488, 2 = Cy3, 3 = Cy5, 4 = EQ, 5 = Alexa488 + Cy3, 6 = Cy3 + Cy5, 7 = Alexa488 + Cy5, 8 = Alexa488 + EQ, 9 = Cy3 + EQ, 10 = Cy5 + EQ, 11 = Alexa488 + Cy3 + Cy, 12 = Alexa488 + Cy3 + Cy5 + EQ. (a) 2-dye FRET. Red channel = excitation of Alexa488, observing emission of Cy3, blue channel = excitation of Cy3, observing emission of Cy5. (b) 3-dye FRET, exciting Alexa488 and observing Cy5 emission. (c) Visualising DNA using GelRed. (d) Individual dye emission scan (green = Alexa488, red = Cy3, blue = Cy5) of whole double-decker AGE gel. In images (a) to (c) and in Fig. 4c the lower level (lanes 8 12) has been positioned next to the top level (lanes 0 7). No scaling or contrast enhancement was applied in this manipulation. S24
25 C-A488 M-A488 C-Cy3 M-Cy3 C-Cy5 M-Cy Figure S25. Direct fluorescence spectra of dyes on C4 (designated C) and C4/HE 12 micelles (M). Alexa 488 λ ex = 488 nm, Cy3 λ ex =545 nm, Cy5 λ ex =645 nm C-A488-Cy3 M-A488-Cy3 C-Cy3-Cy5 M-Cy3-Cy5 C-A488-Cy5 M-A488-Cy Figure S26. Two-dye FRET fluorescence spectra of dyes on C4 (designated C) and C4/HE 12 micelles (M). Alexa 488-Cy3 λ ex = 488 nm, Cy3-Cy5 λ ex = 545 nm, Alexa488-Cy5 λ ex = 488 nm. S25
26 C-A488-EQ M-A488-EQ C-Cy3-EQ M-Cy3-EQ C-Cy5-EQ M-Cy5-EQ Figure S27. Difference fluorescence spectra quenched dyes on C4 (designated C) and C4/HE 12 micelles (M), minus the appropriate unquenched spectra. Alexa 488 λ ex = 488 nm, Cy3 λ ex =545 nm, Cy5 λ ex =645 nm C-A488-Cy3-Cy5 C-A488-Cy3-Cy5-EQ M-A488-Cy3-Cy5 M-A488-Cy3-Cy5-EQ C quench difference M quench difference Figure S28. Three-dye FRET fluorescence spectra of dyes on C4 (designated C) and C4/HE 12 micelles (M), in the presence and absence of quencher. λ ex = 488 nm. Quench difference lines are the subtraction of the quenched system from the unquenched version, illustrating which dyes are preferentially quenched. References 1. Edwardson, T.G.W., Carneiro, K.M.M., Serpell, C.J. & Sleiman, H.F. An Efficient and Modular Route to Sequence-Defined Polymers Appended to DNA. Angew. Chem. Int. Ed. 53, (2014). 2. McLaughlin, C.K. et al. Three-Dimensional Organization of Block Copolymers on DNA-Minimal Scaffolds. J. Am. Chem. Soc. 134, (2012). 3. Edwardson, T.G.W., Carneiro, K.M.M., McLaughlin, C.K., Serpell, C.J. & Sleiman, H.F. Site-specific positioning of dendritic alkyl chains on DNA cages enables their geometry-dependent self-assembly. Nature Chem. 5, (2013). S26
Site specific positioning of dendritic alkyl chains on DNA cages enables their geometry-dependent self assembly
DOI: 10.1038/NCHEM.1745 Site specific positioning of dendritic alkyl chains on DNA cages enables their geometry-dependent self assembly Thomas G.W. Edwardson, Karina M.M. Carneiro, Christopher K. McLaughlin,
More informationThe photoluminescent graphene oxide serves as an acceptor rather. than a donor in the fluorescence resonance energy transfer pair of
Supplementary Material (ESI) for Chemical Communications This journal is (c) The Royal Society of Chemistry 20XX The photoluminescent graphene oxide serves as an acceptor rather than a donor in the fluorescence
More informationSupplementary information
Supplementary information doi: 10.1038/nchem.290 Metal-Nucleic Acid Cages Hua Yang, Christopher K. Mclaughlin, Faisal A. Aldaye, Graham D. Hamblin, Andrzej Z. Rys, Isabelle Rouiller, Hanadi F. Sleiman*
More informationFast ph-assisted functionalization of silver nanoparticles with monothiolated DNA
Supporting Information for Fast ph-assisted functionalization of silver nanoparticles with monothiolated DNA Xu Zhang ab, Mark R. Servos b, and Juewen Liu* a a Department of Chemistry and Waterloo Institute
More informationSupporting Information
Supporting Information α,β-d-cna Preorganization of unpaired loop moiety stabilize DNA hairpin Christelle Dupouy, Pierre Millard, Arnaud Boissonnet and Jean-Marc Escudier* Laboratoire de Synthèse et Physico-Chimie
More informationSupporting Information. Self-assembled nanofibers from Leucine Derived Amphiphiles as Nanoreactors for Growth of ZnO Nanoparticles
Supporting Information Self-assembled nanofibers from Leucine Derived Amphiphiles as Nanoreactors for Growth of ZnO Nanoparticles Karen T. Johnson, Theodore E. Gribb, Evan M. Smoak, and Ipsita A. Banerjee*
More informationSolution reduction synthesis of amine terminated carbon quantum dots
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Solution reduction synthesis of amine terminated carbon quantum dots Keith Linehan and Hugh
More informationHigh-Purity Separation of Gold Nanoparticle Dimers and Trimers
-Supporting Information- High-Purity Separation of Gold Nanoparticle Dimers and Trimers Gang Chen, Yong Wang, Li Huey Tan, Miaoxin Yang, Lee Siew Tan, Yuan Chen and Hongyu Chen* Division of Chemistry and
More informationThe sacrificial role of graphene oxide in stabilising Fenton-like catalyst GO Fe 3 O 4
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 The sacrificial role of graphene oxide in stabilising Fenton-like catalyst GO Fe 3 O 4 Nor Aida
More informationSupporting Information
Supporting Information A Generic Method for Rational Scalable Synthesis of Monodisperse Metal Sulfide Nanocrystals Haitao Zhang, Byung-Ryool Hyun, Frank W. Wise, Richard D. Robinson * Department of Materials
More informationSupplementary Material (ESI) for Chemical Communications This journal is (c) The Royal Society of Chemistry Supporting information for:
Supporting information for: Preparation of 1-D Nanoparticle Superstructures with Tailorable Thicknesses using Gold-Binding Peptide Conjugates: New Insights into Fabrication Process and Mechanism Leekyoung
More informationConvenient Synthesis of Nucleoside 5 -Triphosphates for RNA Transcription. Supplemental Materials
Supplementary Material (ESI) for Chemical Communications This journal is The Royal Society of Chemistry 2010 Convenient Synthesis of ucleoside 5 -Triphosphates for RA Transcription Julianne Caton-Williams,
More informationSupporting Information for. PNA FRET Pair Miniprobes for Quantitative. Fluorescent in Situ Hybridization to Telomeric DNA in Cells and Tissue
Supporting Information for PNA FRET Pair Miniprobes for Quantitative Fluorescent in Situ Hybridization to Telomeric DNA in Cells and Tissue Orenstein, et al Page S2... PNA synthesis procedure Page S3...
More informationDopamine-Mediated Continuous Assembly of Biodegradable Capsules
Dopamine-Mediated Continuous Assembly of Biodegradable Capsules Christopher J. Ochs, Tam Hong, Georgina K. Such, Jiwei Cui, Almar Postma, and Frank Caruso* [*] Prof. F. Caruso, C. J. Ochs, T. Hong, Dr.
More information- Supporting Information - Controlled Assembly of Eccentrically Encapsulated Gold Nanoparticles
- Supporting Information - S1 Controlled Assembly of Eccentrically Encapsulated Gold Nanoparticles Tao Chen, Miaoxin Yang, Xinjiao Wang, Li Huey Tan, Hongyu Chen* Division of Chemistry and Biological Chemistry,
More informationProgrammed ph-driven Reversible Association and Dissociation of Inter-Connected. Circular DNA Dimer Nanostructures
Supporting information Programmed ph-driven Reversible Association and Dissociation of Inter-Connected Circular DNA Dimer Nanostructures Yuwei Hu, Jiangtao Ren, Chun-Hua Lu, and Itamar Willner* Institute
More informationSupporting information
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2014 Supporting information Self-assembled nanopatch with peptide-organic multilayers and mechanical
More informationInstantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a ph-assisted and Surfactant-Free Route
Supporting Information Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a ph-assisted and Surfactant-Free Route Xu Zhang,, Mark R. Servos and Juewen Liu *
More informationCopyright WILEY-VCH Verlag GmbH, D Weinheim, Supporting Information for Angew. Chem. Int. Ed. Z 18050
Copyright WILEY-VCH Verlag GmbH, D-69451 Weinheim, 2001. Supporting Information for Angew. Chem. Int. Ed. Z 18050 Protein Affinity Labeling Mediated by Genetically Encoded Peptide Tags Frank Amini, Thomas
More informationSupporting Information. Synthesis, Structural and Photophysical Properties of. Pentacene Alkanethiolate Monolayer-Protected Gold
Supporting Information Synthesis, Structural and Photophysical Properties of Pentacene Alkanethiolate Monolayer-Protected Gold Nanoclusters and Nanorods: Supramolecular Intercalation and Photoinduced Electron
More informationph-induced Morphology-shifting of DNA-b-Poly(propylene oxide) Assemblies
Supporting Information for ph-induced Morphology-shifting of DNA-b-Poly(propylene oxide) Assemblies Zhiyong Zhao, a Liying Wang, a Yu Liu, a Zhongqiang Yang, b Yan-Mei He, a Zhibo Li, a Qing-Hua Fan* a
More informationSupporting Information for
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2017 Supporting Information for
More informationSupporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting Information Self-healing supramolecular heterometallic gels based on synergistic effect
More informationImpact of multivalent charge presentation on peptide
Supporting Information File 1 for Impact of multivalent charge presentation on peptide nanoparticle aggregation Daniel Schöne 1, Boris Schade 2, Christoph Böttcher 2 and Beate Koksch* 1 Address: 1 Institute
More informationTEM image of derivative 1 and fluorescence spectra of derivative 1 upon addition of
Electronic Supplementary Material (ESI) for Green Chemistry. This journal is The Royal Society of Chemistry 2016 Supramolecular ensemble of PBI derivative and Cu 2 O NPs: Potential photo catalysts for
More informationA BODIPY-based fluorescent probe for the differential
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 15 Supporting information A BODIPY-based fluorescent probe for the differential recognition of Hg(II)
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry C. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Polymorphism and microcrystal shape
More informationYujuan Zhou, Kecheng Jie and Feihe Huang*
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 A redox-responsive selenium-containing pillar[5]arene-based macrocyclic amphiphile: synthesis,
More informationSupporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting Information High-k Polymer/Graphene Oxide Dielectrics for Low-Voltage Flexible Nonvolatile
More informationDumpling-Like Nanocomplex of Foldable Janus Polymer Sheet and Sphere
Dumpling-Like Nanocomplex of Foldable Janus Polymer Sheet and Sphere Lei Gao, Ke Zhang, and Yongming Chen* Supporting Information Experimental Section Materials The triblock terpolymer, P2VP 310 -b-ptepm
More informationSelf-assembly of PEGylated Gold Nanoparticles. with Satellite Structures as Seeds
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 216 Electronic Supplementary Information for Self-assembly of PEGylated Gold Nanoparticles with Satellite
More informationHybrid Gold Superstructures: Synthesis and. Specific Cell Surface Protein Imaging Applications
Supporting Information Hybrid Gold Nanocube@Silica@Graphene-Quantum-Dot Superstructures: Synthesis and Specific Cell Surface Protein Imaging Applications Liu Deng, Ling Liu, Chengzhou Zhu, Dan Li and Shaojun
More informationSupporting Information
Supporting Information Phenyl-Modified Carbon Nitride Quantum Dots with Distinct Photoluminescence Behavior Qianling Cui, Jingsan Xu,* Xiaoyu Wang, Lidong Li,* Markus Antonietti, and Menny Shalom anie_201511217_sm_miscellaneous_information.pdf
More informationPorphyrin and Fullerene Covalently Functionalized. Graphene Hybrid Materials with Large Nonlinear. Optical Properties
Supporting Information for Porphyrin and Fullerene Covalently Functionalized Graphene Hybrid Materials with Large Nonlinear Optical Properties Zhi-Bo Liu, Yan-Fei Xu, Xiao-Yan Zhang, Xiao-Liang Zhang,
More informationSupporting Information. 2-(4-Tolylsulfonyl)ethoxymethyl(TEM) - A New 2 -OH. Protecting Group For Solid Support RNA Synthesis
Supporting Information 2-(4-Tolylsulfonyl)ethoxymethyl(TEM) - A ew 2 -H Protecting Group For Solid Support RA Synthesis Chuanzheng Zhou, Dmytro Honcharenko and Jyoti Chattopadhyaya* Department of Bioorganic
More informationElectronic supplementary information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 Electronic supplementary information Heterogeneous nucleation and growth of highly crystalline
More informationA Biosensor for the Detection of Single Base Mismatches in microrna
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 215 Supporting Information A Biosensor for the Detection of Single Base Mismatches in microrna Jieon
More informationModification of Peptides, Oligonucleotides and Other Small Biomolecules with Tide Fluor (TF) Dye Succinimidyl Esters
Modification of Peptides, Oligonucleotides and Other Small Biomolecules with Tide Fluor (TF) Dye Succinimidyl Esters Introduction The sulfonated cyanine dyes have improved fluorescence quantum yield than
More informationLow Molecular Weight Gelator Dextran Composites
Low Molecular Weight Gelator Dextran Composites Lin Chen, a Steven Revel, a Kyle Morris, b David G. Spiller, c Louise Serpell, b and Dave J. Adams*,a a Department of Chemistry, University of Liverpool,
More informationSupporting Information
Supporting Information A Low-Temperature Solid-Phase Method to Synthesize Highly Fluorescent Carbon Nitride Dots with Tunable Emission Juan Zhou, Yong Yang, and Chun-yang Zhang* Single-Molecule Detection
More informationSupplementary information
Supplementary information Self-assembled light-driven photosynthetic-respiratory electron transport chain hybrid proton pump David Hvasanov, a Joshua R. Peterson a and Pall Thordarson *a a School of Chemistry,
More informationMulti-step Conformation Selection in Amyloid Assembly
Multi-step Conformation Selection in Amyloid Assembly Ming-Chien Hsieh 1, Chen Liang 2, Anil K. Mehta 2, David G. Lynn 2, and Martha A. Grover 1 1 School of Chemical & Biomolecular Engineering, Georgia
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/NCHEM.2451 Reprogramming the assembly of unmodified DNA with a small molecule Nicole Avakyan 1, Andrea A. Greschner 1, 2, Faisal Aldaye 1, Christopher J. Serpell 1, 3, Violeta Toader, 1 Anne
More informationHeteroagglomeration of nanosilver with colloidal SiO2 and clay
, 14, 1 8 Supplementary material Heteroagglomeration of nanosilver with colloidal SiO2 and clay Sébastien Maillette, A Caroline Peyrot, A Tapas Purkait, B Muhammad Iqbal, B Jonathan G. C. Veinot B and
More informationSupporting Information
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2015 Supporting Information Materials The peptides were designed and synthesized as reported
More informationSupplemental Materials and Methods
Supplemental Materials and Methods Time-resolved FRET (trfret) to probe for changes in the Box A/A stem upon complex assembly U3 MINI was folded and the decay of Fl fluorescence was measured at 20 ºC (see
More informationSupporting Information
Supporting Information Controlled Radical Polymerization and Quantification of Solid State Electrical Conductivities of Macromolecules Bearing Pendant Stable Radical Groups Lizbeth Rostro, Aditya G. Baradwaj,
More informationSupporting Information s for
Supporting Information s for # Self-assembling of DNA-templated Au Nanoparticles into Nanowires and their enhanced SERS and Catalytic Applications Subrata Kundu* and M. Jayachandran Electrochemical Materials
More informationSupporting Information
Supporting Information Wiley-VCH 2008 69451 Weinheim, Germany Electronic Supporting Information A Highly Selective Luminescence Switch-on Probe to Histidine/Histidine-rich proteins and Its Application
More informationNumber-controlled spatial arrangement of gold nanoparticles with
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Number-controlled spatial arrangement of gold nanoparticles with DNA dendrimers Ping Chen,*
More informationE.Z.N.A. MicroElute Clean-up Kits Table of Contents
E.Z.N.A. MicroElute Clean-up Kits Table of Contents Introduction... 2 Kit Contents... 3 Preparing Reagents/Storage and Stability... 4 Guideline for Vacuum Manifold... 5 MicroElute Cycle-Pure - Spin Protocol...
More informationHigh-Performance Semiconducting Polythiophenes for Organic Thin Film. Transistors by Beng S. Ong,* Yiliang Wu, Ping Liu and Sandra Gardner
Supplementary Materials for: High-Performance Semiconducting Polythiophenes for Organic Thin Film Transistors by Beng S. Ong,* Yiliang Wu, Ping Liu and Sandra Gardner 1. Materials and Instruments. All
More informationLong Distance Radical Cation Hopping in DNA: The Effect of Thymine-Hg(II)-Thymine Base Pairs
Long Distance Radical Cation Hopping in DNA: The Effect of Thymine-Hg(II)-Thymine Base Pairs Joshy Joseph and Gary B. Schuster* School of Chemistry and Biochemistry, Georgia Institute of Technology, Atlanta,
More informationElectronic Supplementary Information (ESI)
Electronic Supplementary Information (ESI) A thin-layered chromatography plate prepared from naphthalimide-based receptor immobilized SiO 2 nanoparticles as a portable chemosensor and adsorbent for Pb
More informationData Sheet. Azide Cy5 RNA T7 Transcription Kit
Cat. No. Size 1. Description PP-501-Cy5 10 reactions à 40 µl For in vitro use only Quality guaranteed for 12 months Store all components at -20 C. Avoid freeze and thaw cycles. DBCO-Sulfo-Cy5 must be stored
More informationBottom-up Optimization of SERS Hot Spots. Supplementary Information
Bottom-up Optimization of SERS Hot Spots Laura Fabris, * Department of Materials Science and Engineering, Institute for Advanced Materials Devices ad Nanotechnology, Rutgers, The State University of New
More informationHigh photostability and enhanced fluorescence of gold nanoclusters by silver doping-supporting information
High photostability and enhanced fluorescence of gold nanoclusters by silver doping-supporting information Size measurements Figure S1 P2 FTIR measurements Figure S2 P2 XPS measurements Figure S3 P3 Photo-physical
More informationReal-time and Selective Detection of Single Nucleotide DNA Mutations Using Surface Engineered Microtoroids
Supporting Information for: Real-time and Selective Detection of Single Nucleotide DNA Mutations Using Surface Engineered Microtoroids Pelin Toren,, Erol Ozgur,, and Mehmet Bayindir, *,, Institute of Materials
More informationUnprecedented dinuclear silver(i)-mediated base
Electronic Supplementary Material (ESI) for Dalton Transactions. This journal is The Royal Society of Chemistry 204 Electronic Supplementary Information Unprecedented dinuclear silver(i)-mediated base
More informationSupporting Information for: Emulsion-assisted synthesis of monodisperse binary metal nanoparticles
Supporting Information for: Emulsion-assisted synthesis of monodisperse binary metal nanoparticles Zhen Yin, Ding Ma* and Xinhe Bao* Synthesis of the PdCu nanoparticles: All synthesis was carried out under
More informationMultifunctional polyphosphazene-coated multi-walled carbon. nanotubes for the synergistic treatment of redox-responsive
Electronic Supplementary Material (ESI) for Polymer Chemistry. This journal is The Royal Society of Chemistry 2017 Supporting information for Multifunctional polyphosphazene-coated multi-walled carbon
More informationSupporting Information
Supporting Information Tuning Supramolecular Structure and Functions of Peptide bola-amphiphile by Solvent Evaporation-Dissolution Anhe Wang,, Lingyun Cui,, Sisir Debnath, Qianqian Dong, Xuehai Yan, Xi
More informationReconfigurable DNA Origami Nanocapsule for ph- Controlled Encapsulation and Display of Cargo
Supporting Information Reconfigurable DNA Origami Nanocapsule for ph- Controlled Encapsulation and Display of Cargo Heini Ijäs, Iiris Hakaste, Boxuan Shen, Mauri A. Kostiainen, and Veikko Linko* Biohybrid
More informationSupporting Information. Near infrared light-powered Janus mesoporous silica nanoparticle motors
Supporting Information Near infrared light-powered Janus mesoporous silica nanoparticle motors Mingjun Xuan,, Zhiguang Wu,, Jingxin Shao, Luru Dai, Tieyan Si,, * and Qiang He, * State Key Laboratory of
More informationSynthesis of Colloidal Au-Cu 2 S Heterodimers via Chemically Triggered Phase Segregation of AuCu Nanoparticles
SUPPORTING INFORMATION Synthesis of Colloidal Au-Cu 2 S Heterodimers via Chemically Triggered Phase Segregation of AuCu Nanoparticles Nathan E. Motl, James F. Bondi, and Raymond E. Schaak* Department of
More informationElectronic Supplementary Information
Electronic Supplementary Information Selective Diels-Alder cycloaddition on semiconducting single-walled carbon nanotubes for potential separation application Jiao-Tong Sun, Lu-Yang Zhao, Chun-Yan Hong,
More informationControlling Multicompartment Morphologies Using Solvent Conditions and Chemical Modification
Supporting Information to Controlling Multicompartment Morphologies Using Solvent Conditions and Chemical Modification by Tina I. Löbling, Olli Ikkala, André H. Gröschel *, Axel H. E. Müller * Materials
More informationProtocol for 2D-E. Protein Extraction
Protocol for 2D-E Protein Extraction Reagent 1 inside the ReadyPrep TM Sequential Extraction kit (in powder form) 50ml of deionized water is used to dissolve all the Reagent 1. The solution is known as
More informationElectronic Supplementary Information. Low-temperature Benchtop-synthesis of All-inorganic Perovskite Nanowires
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Low-temperature Benchtop-synthesis of All-inorganic Perovskite
More informationElectronic Supplementary Information (ESI) From metal-organic framework to hierarchical high surface-area hollow octahedral carbon cages
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) From metal-organic framework to hierarchical high surface-area
More informationDr. OligoTM DNA / RNA / OLIGO SYNTHESIZERS
Dr. OligoTM DNA / RNA / OLIGO SYNTHESIZERS High Throughput Oligo Synthesis Synthesize Cleave Deprotect Desalt Elute Dr. Oligo TM The Dr. Oligo TM High Throughput Oligo Synthesizer is available in four
More informationapplied as UV protective films
Nanocomposite gels via in-situ photoinitiation and disassembly of TiO 2 -Clay composites with polymers applied as UV protective films Chuanan Liao, Qing Wu, Teng Su, Da Zhang, Qingsheng Wu and Qigang Wang*
More information1+2 on GHD (5 µl) Volume 1+2 (µl) 1 on GHD 1+2 on GHD
1+2 on GHD (20 µl) 1+2 on GHD (15 µl) 1+2 on GHD (10 µl) 1+2 on GHD (5 µl) Volume 1+2 (µl) 1 on GHD 1+2 on GHD Supplementary Figure 1 UV-Vis measurements a. UV-Vis spectroscopy of drop-casted volume of
More informationDNA Condensation With Spermine Dendrimers: Interactions in Solution, Charge Inversion, and Morphology Control Supporting Information
DNA Condensation With Spermine Dendrimers: Interactions in Solution, Charge Inversion, and Morphology Control Supporting Information Dennis Kurzbach,a Caroline Velte,a Philipp Arnold b, Gönül Kizilsavas
More informationSynthesis of 2 ) Structures by Small Molecule-Assisted Nucleation for Plasmon-Enhanced Photocatalytic Activity
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Synthesis of Au@UiO-66(NH 2 ) Structures by Small Molecule-Assisted
More informationSupporting Information. Methylation on CpG Repeats Modulates Hydroxymethylcytosine Induced Duplex Destabilization
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2016 Supporting Information Methylation on CpG Repeats Modulates Hydroxymethylcytosine Induced Duplex
More informationSupporting Information
Supporting Information Verification of specific G-quadruplex structure by using a novel cyanine dye supramolecular assembly: I. Recognizing mixed G-quadruplex in human telomeres Qianfan Yang, Junfeng Xiang,
More informationIRDye 800CW Protein Labeling Kit Low MW
IRDye 800CW Protein Labeling Kit Low MW Developed for: Aerius, and Odyssey Family of Imagers Please refer to your manual to confirm that this protocol is appropriate for the applications compatible with
More informationSupplementary Data. Development of Tumor-Targeted Near Infrared Probes for Fluorescence Guided Surgery
Supplementary Data Development of Tumor-Targeted Near Infrared Probes for Fluorescence Guided Surgery Lindsay E. Kelderhouse, Venkatesh Chelvam, Charity Wayua, Sakkarapalayam Mahalingam, Scott Poh, Sumith
More informationExploiting the Interaction of Pyranine-3 with Poly(L-Lysine) to Mediate Nanoparticle Assembly: Fabrication of Dynamic ph-responsive Nanocontainers
Exploiting the Interaction of Pyranine-3 with Poly(L-Lysine) to Mediate Nanoparticle Assembly: Fabrication of Dynamic ph-responsive Nanocontainers Arlin Jose Amali, a Shashi Singh, b Nandini Rangaraj,
More informationSynergy of Two Assembly Languages in DNA Nanostructures: Self- Assembly of Sequence-Defined Polymers on DNA Cages
This is an open access article published under an ACS AuthorChoice License, which permits copying and redistribution of the article or any adaptations for non-commercial purposes. pubs.acs.org/jacs Synergy
More informationRational design of a ratiometric fluorescent probe with a large emission shift for the facile detection of Hg 2+
Rational design of a ratiometric fluorescent probe with a large emission shift for the facile detection of Hg 2+ Weimin Xuan, a Chen Chen, b Yanting Cao, a Wenhan He, a Wei Jiang, a Kejian Li, b* and Wei
More informationPolycondensation of Polymer Brushes via DNA Hybridization
S1 Supporting Online Material for Polycondensation of Polymer Brushes via DNA Hybridization Xueguang Lu, Eleanor Watts, Fei Jia, Xuyu Tan, and Ke Zhang* Department of Chemistry and Chemical Biology, Northeastern
More informationControlling the Catalytic Functions of DNAzymes within Constitutional. Dynamic Networks of DNA Nanostructures
Supporting Information Controlling the Catalytic Functions of DNAzymes within Constitutional Dynamic Networks of DNA Nanostructures Shan Wang,, Liang Yue,, Zohar Shpilt, Alessandro Cecconello, Jason S.
More informationSupplementary Figure 1 Pairing alignments, turns and extensions within the structure of the ribozyme-product complex. (a) The alignment of the G27
Supplementary Figure 1 Pairing alignments, turns and extensions within the structure of the ribozyme-product complex. (a) The alignment of the G27 A40 non-canonical pair stacked over the A41 (G1-C26) three-base
More informationElectronic Supplementary Information. Selective detection of Al 3+ and citric acid with a fluorescent amphiphile
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Selective detection of Al 3+ and citric
More informationSupporting Information
Supporting Information Materials and Methods: Tris-hydroxymethylaminomethane (Tris) was purchased from USB. All the other reagents used in the experiments were purchased from Sigma. All the DNA oligonucleotides
More informationFluorescent Bilayer Nanocoils from an Asymmetric Perylene Diimide with Ultrasensitivity for Amine Vapors
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Fluorescent Bilayer Nanocoils from an Asymmetric Perylene Diimide with Ultrasensitivity for Amine
More informationSurfactant-free exfoliation of graphite in aqueous solutions
Surfactant-free exfoliation of graphite in aqueous solutions Karen B. Ricardo, Anne Sendecki, and Haitao Liu * Department of Chemistry, University of Pittsburgh, Pittsburgh, PA 15260, U.S.A 1. Materials
More informationSupporting Materials Ultra-small Sub-10 nm Near Infrared Fluorescent Mesoporous Silica Nanoparticles
Supporting Materials Ultra-small Sub-10 nm Near Infrared Fluorescent Mesoporous Silica Nanoparticles Kai Ma, Hiroaki Sai and Ulrich Wiesner* Department of Materials Science and Engineering, Cornell University,
More informationIn-gel digestion of immunoprecipitated proteins separated by SDS-PAGE
In-gel digestion of immunoprecipitated proteins separated by SDS-PAGE (Lamond Lab / April 2008)! Perform all the pipetting steps in a laminar flow hood. We routinely do our digestions in our TC room hoods.
More informationNANOSCIENCE: TECHNOLOGY AND ADVANCED MATERIALS
UNIVERSITY OF SOUTHAMPTON PHYS6014W1 SEMESTER 2 EXAMINATIONS 2012-2013 NANOSCIENCE: TECHNOLOGY AND ADVANCED MATERIALS DURATION 120 MINS (2 Hours) This paper contains 8 questions Answer ALL questions in
More informationA Fluorescence Turn-On Sensor for the Detection of Palladium Ions that Operates Through In-Situ Generation of Palladium Nanoparticles
This journal is The Royal Society of Chemistry 214 Supporting Information for A Fluorescence Turn-On Sensor for the Detection of Palladium Ions that Operates Through In-Situ Generation of Palladium Nanoparticles
More information3D Motion of DNA-Au Nanoconjugates in Graphene Liquid Cell EM
Supporting Information for 3D Motion of DNA-Au Nanoconjugates in Graphene Liquid Cell EM Qian Chen,,, Jessica Smith,, Jungwon Park,,1, Kwanpyo Kim,,2, Davy Ho, Haider I. Rasool,,!Alex Zettl,, A. Paul Alivisatos,,*!
More informationSupporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting Information All inorganic cesium lead halide perovskite nanocrystals for photodetector
More informationSpecifically colorimetric recognition of calcium, strontium, barium. ions using 2-mercaptosuccinic acid-functionalized gold nanoparticles
Electronic Supporting Information (ESI) for Specifically colorimetric recognition of calcium, strontium, barium ions using 2-mercaptosuccinic acid-functionalized gold nanoparticles and its use in reliable
More informationSupplementary Information
Supplementary Information Supramolecular polymerization of hydrogen-bonded rosettes with anthracene chromophores: regioisomeric effect on nanostructures Deepak D. Prabhu, Keisuke Aratsu, Mitsuaki Yamauchi,
More informationFabrication and characterization of poly (ethylene oxide) templated nickel oxide nanofibers for dye degradation
Electronic Supplementary Material (ESI) for Environmental Science: Nano. This journal is The Royal Society of Chemistry 2014 Supplementary Information Fabrication and characterization of poly (ethylene
More informationA New Solvatochromic Fluorophore for Exploring Nonpolar Environments Created by Biopolymers
Electronic Supplementary Information A New Solvatochromic Fluorophore for Exploring Nonpolar Environments Created by Biopolymers Abulfazl Fakhari M. and Steven E. Rokita Contribution from the Department
More informationO-Allylation of phenols with allylic acetates in aqueous medium using a magnetically separable catalytic system
Supporting information for -Allylation of phenols with allylic acetates in aqueous medium using a magnetically separable catalytic system Amit Saha, John Leazer* and Rajender S. Varma* Sustainable Technology
More information