Bootstraps and testing trees. Alog-likelihoodcurveanditsconfidenceinterval
|
|
- Baldric Carroll
- 5 years ago
- Views:
Transcription
1 ootstraps and testing trees Joe elsenstein epts. of Genome Sciences and of iology, University of Washington ootstraps and testing trees p.1/20 log-likelihoodcurveanditsconfidenceinterval ln L Transition / transversion ratio (This is for the 14-species primates data available for download). ootstraps and testing trees p.2/20
2 onstraints on a tree for a clock onstraints for a clock v 1 v 2 v 4 v 5 v 1 = v 2 v 6 v 3 v v 4 = 5 v 8 v 1 + v v 6 = 3 v 7 v v = v 4 + v 8 oes not constrain the branch length on the unrooted tree ootstraps and testing trees p.3/20 Likelihood-ratio test of molecular clock Mouse Human himp Gorilla Orang Gibbon ovine log likelihood Without clock With clock parameters 11 6 ifference χ 2 = df = 5 (This is for this 7-species subset of the primates data). (non significant) ootstraps and testing trees p.4/20
3 Likelihood surface for three clocklike trees 204 ln Likelihood x x x 0.10 bigger x bigger (These are profile likelihoods" as they show the largest likelihood for that value of x,maximizingovertheotherbranchlengthinthetree.) ootstraps and testing trees p.5/20 Two trees to be tested using KHT test Mouse Tree I ovine Gibbon Orang Gorilla himp Human Mouse Tree II ovine Gibbon Orang Gorilla himp Human ootstraps and testing trees p.6/20
4 Table of differences in log-likelihood Tree I II site ln L iff ootstraps and testing trees p.7/20 Histogram of those differences ifference in log likelihood at site o sign test, or t-test, or similar nonparametric tests. ootstraps and testing trees p.8/20
5 ootstrap sampling (with mixtures of normals) estimate of θ (unknown) true value of θ empirical distribution of sample ootstrap replicates (unknown) true distribution istribution of estimates of parameters ootstraps and testing trees p.9/20 ootstrap sampling To infer the error in a quantity, θ, estimatedfromasampleofpoints x 1, x 2,...,x n we can o the following R times (R =1000or so) raw a bootstrap sample" by sampling n times with replacement from the sample. all these x 1, x 2,...,x n.notethatsomeofthe original points are represented more than once in the bootstrap sample, some once, some not at all. stimate θ from each of the bootstrap samples, call these ˆθ k (k = 1, 2,...,R) When all R bootstrap samples have been done, the distribution of ˆθ i estimates the distribution one would get if one were able to draw repeated samples of n data points from the unknown true distribution. ootstraps and testing trees p.10/20
6 ootstrap sampling of phylogenies Original ata sites sequences ootstrap sample #1 sites stimate of the tree sequences sample same number of sites, with replacement ootstrap sample #2 sequences sites sample same number of sites, with replacement ootstrap estimate of the tree, #1 (and so on) ootstrap estimate of the tree, #2 ootstraps and testing trees p.11/20 nalyzing bootstraps with phylogenies The sites are assumed to have evolved independently given the tree. They are the entities that are sampled (the x i ). The trees play the role of the parameter. One ends up with a cloud of R sampled trees. There are many possible ways. The one I will describe here is the most useful, but not the only way we could go. To summarize this cloud, we ask, for each branch in the tree, how frequently it appears among the cloud of trees. We make a tree that summarizes this for all the most frequently occurring branches. This is the majority rule consensus tree of the bootstrap estimates of the tree. ootstraps and testing trees p.12/20
7 Partitions from branches in an (unrooted) tree and so on for all the other external (tip) branches ootstraps and testing trees p.13/20 The majority-rule consensus tree Trees: How many times each (non tip) partition of species is found: Majority rule consensus tree of the unrooted trees: ootstraps and testing trees p.14/20
8 ootstrap sampling of a phylogeny ovine Mouse Squir Monk himp Human Gorilla Orang Gibbon Rhesus Mac Jpn Macaq rab.mac arbmacaq Tarsier Lemur In this example, parsimony was used to infer the tree. ootstraps and testing trees p.15/20 Potential problems with the bootstrap Sites may not evolve independently Sites may not come from a common distribution (but you can consider them to be sampled from a mixture of possible distributions) If do not know which branch is of interest at the outset, a multiple-tests" problem means that the most extreme P values are overstated Pvaluesarebiased(tooconservative) ootstrapping does not correct biases in phylogeny methods ootstraps and testing trees p.16/20
9 elete-half jackknife P values ovine Mouse Squir Monk himp Human Gorilla Orang Gibbon Rhesus Mac Jpn Macaq rab.mac arbmacaq 59 Tarsier Lemur In this example, parsimony was used to infer the tree. ootstraps and testing trees p.17/20 diagramoftheparametricbootstrap computer simulation estimation of tree data set #1 T 1 estimate of tree data set #2 T 2 original data data set #3 T 3 data set #100 T 100 ootstraps and testing trees p.18/20
10 References ootstraps etc. fron, ootstrap methods: another look at the jackknife. nnals of Statistics 7: [The original bootstrap paper] Margush, T. and. R. McMorris onsensus n-trees. ulletin of Mathematical iology 43: i. [Majority-rule consensus trees] elsenstein, J onfidence limits on phylogenies: an approach using the bootstrap. volution 39: [The bootstrap first applied to phylogenies] Zharkikh,., and W.-H. Li Statistical properties of bootstrap estimation of phylogenetic variability from nucleotide sequences. I. our taxa with a molecular clock. Molecular iology and volution 9: [iscovery and explanation of bias in P values] Künsch, H. R The jackknife and the bootstrap for general stationary observations. nnals of Statistics 17: [The block-bootstrap] Wu,.. J Jackknife, bootstrap and other resampling plans in regression analysis. nnals of Statistics 14: [The delete-half jackknife] fron, ootstrap confidence intervals for a class of parametric problems. iometrika 72: [The parametric bootstrap] ootstraps and testing trees p.19/20 (more references) Templeton,. R Phylogenetic inference from restriction endonuclease cleavage site maps with particular reference to the evolution of humans and the apes. volution 37: [The first paper on the KHT test] Goldman, N Statistical tests of models of N substitution. Journal of Molecular volution 36: [Parametric bootstrapping for testing models] Shimodaira, H. and M. Hasegawa Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Molecular iology and volution 16: [orrection of KHT test for multiple hypothesis] Prager,. M. and.. Wilson ncient origin of lactalbumin from lysozyme: analysis of N and amino acid sequences. Journal of Molecular volution 27: [winning-sites test] Hasegawa, M. and H. Kishino ccuracies of the simple methods for estimating the bootstrap probability of a maximum-likelihood tree. Molecular iology and volution 11: [RLL probabilities] ootstraps and testing trees p.20/20
Lecture 27. Phylogeny methods, part 7 (Bootstraps, etc.) p.1/30
Lecture 27. Phylogeny methods, part 7 (Bootstraps, etc.) Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 27. Phylogeny methods, part 7 (Bootstraps, etc.) p.1/30 A non-phylogeny
More informationWeek 8: Testing trees, Bootstraps, jackknifes, gene frequencies
Week 8: Testing trees, ootstraps, jackknifes, gene frequencies Genome 570 ebruary, 2016 Week 8: Testing trees, ootstraps, jackknifes, gene frequencies p.1/69 density e log (density) Normal distribution:
More informationWeek 7: Bayesian inference, Testing trees, Bootstraps
Week 7: ayesian inference, Testing trees, ootstraps Genome 570 May, 2008 Week 7: ayesian inference, Testing trees, ootstraps p.1/54 ayes Theorem onditional probability of hypothesis given data is: Prob
More information= 1 = 4 3. Odds ratio justification for maximum likelihood. Likelihoods, Bootstraps and Testing Trees. Prob (H 2 D) Prob (H 1 D) Prob (D H 2 )
4 1 1/3 1 = 4 3 1 4 1/3 1 = 1 12 Odds ratio justification for maximum likelihood Likelihoods, ootstraps and Testing Trees Joe elsenstein the data H 1 Hypothesis 1 H 2 Hypothesis 2 the symbol for given
More informationInference of phylogenies, with some thoughts on statistics and geometry p.1/31
Inference of phylogenies, with some thoughts on statistics and geometry Joe Felsenstein University of Washington Inference of phylogenies, with some thoughts on statistics and geometry p.1/31 Darwin s
More informationInferring phylogeny. Today s topics. Milestones of molecular evolution studies Contributions to molecular evolution
Today s topics Inferring phylogeny Introduction! Distance methods! Parsimony method!"#$%&'(!)* +,-.'/01!23454(6!7!2845*0&4'9#6!:&454(6 ;?@AB=C?DEF Overview of phylogenetic inferences Methodology Methods
More informationPhylogenetic inference
Phylogenetic inference Bas E. Dutilh Systems Biology: Bioinformatic Data Analysis Utrecht University, March 7 th 016 After this lecture, you can discuss (dis-) advantages of different information types
More informationInferring Molecular Phylogeny
Dr. Walter Salzburger he tree of life, ustav Klimt (1907) Inferring Molecular Phylogeny Inferring Molecular Phylogeny 55 Maximum Parsimony (MP): objections long branches I!! B D long branch attraction
More informationConstructing Evolutionary/Phylogenetic Trees
Constructing Evolutionary/Phylogenetic Trees 2 broad categories: istance-based methods Ultrametric Additive: UPGMA Transformed istance Neighbor-Joining Character-based Maximum Parsimony Maximum Likelihood
More informationMolecular phylogeny How to infer phylogenetic trees using molecular sequences
Molecular phylogeny How to infer phylogenetic trees using molecular sequences ore Samuelsson Nov 2009 Applications of phylogenetic methods Reconstruction of evolutionary history / Resolving taxonomy issues
More informationMolecular phylogeny How to infer phylogenetic trees using molecular sequences
Molecular phylogeny How to infer phylogenetic trees using molecular sequences ore Samuelsson Nov 200 Applications of phylogenetic methods Reconstruction of evolutionary history / Resolving taxonomy issues
More informationConstructing Evolutionary/Phylogenetic Trees
Constructing Evolutionary/Phylogenetic Trees 2 broad categories: Distance-based methods Ultrametric Additive: UPGMA Transformed Distance Neighbor-Joining Character-based Maximum Parsimony Maximum Likelihood
More informationPhylogenetics. Applications of phylogenetics. Unrooted networks vs. rooted trees. Outline
Phylogenetics Todd Vision iology 522 March 26, 2007 pplications of phylogenetics Studying organismal or biogeographic history Systematics ating events in the fossil record onservation biology Studying
More informationMETHODS FOR DETERMINING PHYLOGENY. In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task.
Chapter 12 (Strikberger) Molecular Phylogenies and Evolution METHODS FOR DETERMINING PHYLOGENY In Chapter 11, we discovered that classifying organisms into groups was, and still is, a difficult task. Modern
More informationEVOLUTIONARY DISTANCES
EVOLUTIONARY DISTANCES FROM STRINGS TO TREES Luca Bortolussi 1 1 Dipartimento di Matematica ed Informatica Università degli studi di Trieste luca@dmi.units.it Trieste, 14 th November 2007 OUTLINE 1 STRINGS:
More informationDr. Amira A. AL-Hosary
Phylogenetic analysis Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic Basics: Biological
More informationC3020 Molecular Evolution. Exercises #3: Phylogenetics
C3020 Molecular Evolution Exercises #3: Phylogenetics Consider the following sequences for five taxa 1-5 and the known outgroup O, which has the ancestral states (note that sequence 3 has changed from
More informationPhylogenetics Todd Vision Spring Some applications. Uncultured microbial diversity
Phylogenetics Todd Vision Spring 2008 Tree basics Sequence alignment Inferring a phylogeny Neighbor joining Maximum parsimony Maximum likelihood Rooting trees and measuring confidence Software and file
More informationAmira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Phylogenetic analysis Phylogenetic Basics: Biological
More informationIntegrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley
Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley B.D. Mishler Feb. 14, 2018. Phylogenetic trees VI: Dating in the 21st century: clocks, & calibrations;
More informationWhy IQ-TREE? Bui Quang Minh Australian National University. Workshop on Molecular Evolution Woods Hole, 24 July 2018
Why IQ-R? ui Quang Minh ustralian National University Workshop on Molecular volution Woods Hole, 24 July 2018 hanks to plenty of users for feedback and bug reports! ypical phylogenetic analysis under maximum
More informationBootstrap confidence levels for phylogenetic trees B. Efron, E. Halloran, and S. Holmes, 1996
Bootstrap confidence levels for phylogenetic trees B. Efron, E. Halloran, and S. Holmes, 1996 Following Confidence limits on phylogenies: an approach using the bootstrap, J. Felsenstein, 1985 1 I. Short
More informationPhylogenetics: Bayesian Phylogenetic Analysis. COMP Spring 2015 Luay Nakhleh, Rice University
Phylogenetics: Bayesian Phylogenetic Analysis COMP 571 - Spring 2015 Luay Nakhleh, Rice University Bayes Rule P(X = x Y = y) = P(X = x, Y = y) P(Y = y) = P(X = x)p(y = y X = x) P x P(X = x 0 )P(Y = y X
More information9/30/11. Evolution theory. Phylogenetic Tree Reconstruction. Phylogenetic trees (binary trees) Phylogeny (phylogenetic tree)
I9 Introduction to Bioinformatics, 0 Phylogenetic ree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & omputing, IUB Evolution theory Speciation Evolution of new organisms is driven by
More informationConsensus Methods. * You are only responsible for the first two
Consensus Trees * consensus trees reconcile clades from different trees * consensus is a conservative estimate of phylogeny that emphasizes points of agreement * philosophy: agreement among data sets is
More informationLikelihood Ratio Tests for Detecting Positive Selection and Application to Primate Lysozyme Evolution
Likelihood Ratio Tests for Detecting Positive Selection and Application to Primate Lysozyme Evolution Ziheng Yang Department of Biology, University College, London An excess of nonsynonymous substitutions
More informationHypothesis testing and phylogenetics
Hypothesis testing and phylogenetics Woods Hole Workshop on Molecular Evolution, 2017 Mark T. Holder University of Kansas Thanks to Paul Lewis, Joe Felsenstein, and Peter Beerli for slides. Motivation
More informationPOPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics
POPULATION GENETICS Winter 2005 Lecture 17 Molecular phylogenetics - in deriving a phylogeny our goal is simply to reconstruct the historical relationships between a group of taxa. - before we review the
More information"Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky
MOLECULAR PHYLOGENY "Nothing in biology makes sense except in the light of evolution Theodosius Dobzhansky EVOLUTION - theory that groups of organisms change over time so that descendeants differ structurally
More informationPhylogenetic Tree Reconstruction
I519 Introduction to Bioinformatics, 2011 Phylogenetic Tree Reconstruction Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Evolution theory Speciation Evolution of new organisms is driven
More informationPrinciples of Phylogeny Reconstruction How do we reconstruct the tree of life? Basic Terminology. Looking at Trees. Basic Terminology.
Principles of Phylogeny Reconstruction How do we reconstruct the tree of life? Phylogeny: asic erminology Outline: erminology Phylogenetic tree: Methods Problems parsimony maximum likelihood bootstrapping
More informationPhylogenetic Analysis. Han Liang, Ph.D. Assistant Professor of Bioinformatics and Computational Biology UT MD Anderson Cancer Center
Phylogenetic Analysis Han Liang, Ph.D. Assistant Professor of Bioinformatics and Computational Biology UT MD Anderson Cancer Center Outline Basic Concepts Tree Construction Methods Distance-based methods
More informationEvaluating phylogenetic hypotheses
Evaluating phylogenetic hypotheses Methods for evaluating topologies Topological comparisons: e.g., parametric bootstrapping, constrained searches Methods for evaluating nodes Resampling techniques: bootstrapping,
More informationScientific ethics, tree testing, Open Tree of Life. Workshop on Molecular Evolution Marine Biological Lab, Woods Hole, MA.
Scientific ethics, tree testing, Open Tree of Life Workshop on Molecular Evolution 2018 Marine Biological Lab, Woods Hole, MA. USA Mark T. Holder University of Kansas next 22 slides from David Hillis Data
More informationA (short) introduction to phylogenetics
A (short) introduction to phylogenetics Thibaut Jombart, Marie-Pauline Beugin MRC Centre for Outbreak Analysis and Modelling Imperial College London Genetic data analysis with PR Statistics, Millport Field
More informationA Statistical Test of Phylogenies Estimated from Sequence Data
A Statistical Test of Phylogenies Estimated from Sequence Data Wen-Hsiung Li Center for Demographic and Population Genetics, University of Texas A simple approach to testing the significance of the branching
More informationMarkov chain Monte-Carlo to estimate speciation and extinction rates: making use of the forest hidden behind the (phylogenetic) tree
Markov chain Monte-Carlo to estimate speciation and extinction rates: making use of the forest hidden behind the (phylogenetic) tree Nicolas Salamin Department of Ecology and Evolution University of Lausanne
More informationMaximum Likelihood Tree Estimation. Carrie Tribble IB Feb 2018
Maximum Likelihood Tree Estimation Carrie Tribble IB 200 9 Feb 2018 Outline 1. Tree building process under maximum likelihood 2. Key differences between maximum likelihood and parsimony 3. Some fancy extras
More informationEstimating Divergence Dates from Molecular Sequences
Estimating Divergence Dates from Molecular Sequences Andrew Rambaut and Lindell Bromham Department of Zoology, University of Oxford The ability to date the time of divergence between lineages using molecular
More informationPHYLOGENY ESTIMATION AND HYPOTHESIS TESTING USING MAXIMUM LIKELIHOOD
Annu. Rev. Ecol. Syst. 1997. 28:437 66 Copyright c 1997 by Annual Reviews Inc. All rights reserved PHYLOGENY ESTIMATION AND HYPOTHESIS TESTING USING MAXIMUM LIKELIHOOD John P. Huelsenbeck Department of
More informationSTAT440/840: Statistical Computing
First Prev Next Last STAT440/840: Statistical Computing Paul Marriott pmarriott@math.uwaterloo.ca MC 6096 February 2, 2005 Page 1 of 41 First Prev Next Last Page 2 of 41 Chapter 3: Data resampling: the
More informationAssessing Phylogenetic Hypotheses and Phylogenetic Data
Assessing Phylogenetic Hypotheses and Phylogenetic Data We use numerical phylogenetic methods because most data includes potentially misleading evidence of relationships We should not be content with constructing
More informationLetter to the Editor. Department of Biology, Arizona State University
Letter to the Editor Traditional Phylogenetic Reconstruction Methods Reconstruct Shallow and Deep Evolutionary Relationships Equally Well Michael S. Rosenberg and Sudhir Kumar Department of Biology, Arizona
More informationSubstitution = Mutation followed. by Fixation. Common Ancestor ACGATC 1:A G 2:C A GAGATC 3:G A 6:C T 5:T C 4:A C GAAATT 1:G A
GAGATC 3:G A 6:C T Common Ancestor ACGATC 1:A G 2:C A Substitution = Mutation followed 5:T C by Fixation GAAATT 4:A C 1:G A AAAATT GAAATT GAGCTC ACGACC Chimp Human Gorilla Gibbon AAAATT GAAATT GAGCTC ACGACC
More informationTheory of Evolution Charles Darwin
Theory of Evolution Charles arwin 858-59: Origin of Species 5 year voyage of H.M.S. eagle (83-36) Populations have variations. Natural Selection & Survival of the fittest: nature selects best adapted varieties
More informationPhylogenetics: Building Phylogenetic Trees
1 Phylogenetics: Building Phylogenetic Trees COMP 571 Luay Nakhleh, Rice University 2 Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary model should
More informationMolecular evolution. Joe Felsenstein. GENOME 453, Autumn Molecular evolution p.1/49
Molecular evolution Joe Felsenstein GENOME 453, utumn 2009 Molecular evolution p.1/49 data example for phylogeny inference Five DN sequences, for some gene in an imaginary group of species whose names
More informationConcepts and Methods in Molecular Divergence Time Estimation
Concepts and Methods in Molecular Divergence Time Estimation 26 November 2012 Prashant P. Sharma American Museum of Natural History Overview 1. Why do we date trees? 2. The molecular clock 3. Local clocks
More informationBootstrap, Jackknife and other resampling methods
Bootstrap, Jackknife and other resampling methods Part III: Parametric Bootstrap Rozenn Dahyot Room 128, Department of Statistics Trinity College Dublin, Ireland dahyot@mee.tcd.ie 2005 R. Dahyot (TCD)
More informationPhylogenetic Trees. Phylogenetic Trees Five. Phylogeny: Inference Tool. Phylogeny Terminology. Picture of Last Quagga. Importance of Phylogeny 5.
Five Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu v Distance Methods v Character Methods v Molecular Clock v UPGMA v Maximum Parsimony
More informationBootstrap Method for Dependent Data Structure and Measure of Statistical Precision
Journal of Mathematics and Statistics 6 (): 84-88, 00 ISSN 549-3644 00 Science Publications ootstrap Method for Dependent Data Structure and Measure of Statistical Precision T.O. Olatayo, G.N. Amahia and
More information"PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION" Integrative Biology 200B Spring 2009 University of California, Berkeley
"PRINCIPLES OF PHYLOGENETICS: ECOLOGY AND EVOLUTION" Integrative Biology 200B Spring 2009 University of California, Berkeley B.D. Mishler Jan. 22, 2009. Trees I. Summary of previous lecture: Hennigian
More informationProbability Distribution of Molecular Evolutionary Trees: A New Method of Phylogenetic Inference
J Mol Evol (1996) 43:304 311 Springer-Verlag New York Inc. 1996 Probability Distribution of Molecular Evolutionary Trees: A New Method of Phylogenetic Inference Bruce Rannala, Ziheng Yang Department of
More informationInferring Molecular Phylogeny
r. Walter Salzburger The tree of life, ustav Klimt (1907) Inferring Molecular Phylogeny Inferring Molecular Phylogeny 2 1. Molecular Markers Inferring Molecular Phylogeny 3 Immunological comparisons! Nuttall
More informationThanks to Paul Lewis and Joe Felsenstein for the use of slides
Thanks to Paul Lewis and Joe Felsenstein for the use of slides Review Hennigian logic reconstructs the tree if we know polarity of characters and there is no homoplasy UPGMA infers a tree from a distance
More informationSTATS 200: Introduction to Statistical Inference. Lecture 29: Course review
STATS 200: Introduction to Statistical Inference Lecture 29: Course review Course review We started in Lecture 1 with a fundamental assumption: Data is a realization of a random process. The goal throughout
More informationAssessing an Unknown Evolutionary Process: Effect of Increasing Site- Specific Knowledge Through Taxon Addition
Assessing an Unknown Evolutionary Process: Effect of Increasing Site- Specific Knowledge Through Taxon Addition David D. Pollock* and William J. Bruno* *Theoretical Biology and Biophysics, Los Alamos National
More informationThe Causes and Consequences of Variation in. Evolutionary Processes Acting on DNA Sequences
The Causes and Consequences of Variation in Evolutionary Processes Acting on DNA Sequences This dissertation is submitted for the degree of Doctor of Philosophy at the University of Cambridge Lee Nathan
More informationHypothesis Testing with the Bootstrap. Noa Haas Statistics M.Sc. Seminar, Spring 2017 Bootstrap and Resampling Methods
Hypothesis Testing with the Bootstrap Noa Haas Statistics M.Sc. Seminar, Spring 2017 Bootstrap and Resampling Methods Bootstrap Hypothesis Testing A bootstrap hypothesis test starts with a test statistic
More informationMolecular phylogeny - Using molecular sequences to infer evolutionary relationships. Tore Samuelsson Feb 2016
Molecular phylogeny - Using molecular sequences to infer evolutionary relationships Tore Samuelsson Feb 2016 Molecular phylogeny is being used in the identification and characterization of new pathogens,
More informationStandard Errors, Prediction Error and Model Tests in Additive Trees 1
Chapter 3 Standard Errors, Prediction Error and Model Tests in Additive Trees 1 Abstract Theoretical standard errors and confidence intervals are given for the estimates of branch lengths in psychometric
More informationAssessing Congruence Among Ultrametric Distance Matrices
Journal of Classification 26:103-117 (2009) DOI: 10.1007/s00357-009-9028-x Assessing Congruence Among Ultrametric Distance Matrices Véronique Campbell Université de Montréal, Canada Pierre Legendre Université
More informationPhylogenetics: Building Phylogenetic Trees. COMP Fall 2010 Luay Nakhleh, Rice University
Phylogenetics: Building Phylogenetic Trees COMP 571 - Fall 2010 Luay Nakhleh, Rice University Four Questions Need to be Answered What data should we use? Which method should we use? Which evolutionary
More informationAdditive distances. w(e), where P ij is the path in T from i to j. Then the matrix [D ij ] is said to be additive.
Additive distances Let T be a tree on leaf set S and let w : E R + be an edge-weighting of T, and assume T has no nodes of degree two. Let D ij = e P ij w(e), where P ij is the path in T from i to j. Then
More informationThe bootstrap. Patrick Breheny. December 6. The empirical distribution function The bootstrap
Patrick Breheny December 6 Patrick Breheny BST 764: Applied Statistical Modeling 1/21 The empirical distribution function Suppose X F, where F (x) = Pr(X x) is a distribution function, and we wish to estimate
More informationHow to read and make phylogenetic trees Zuzana Starostová
How to read and make phylogenetic trees Zuzana Starostová How to make phylogenetic trees? Workflow: obtain DNA sequence quality check sequence alignment calculating genetic distances phylogeny estimation
More informationTree of Life iological Sequence nalysis Chapter http://tolweb.org/tree/ Phylogenetic Prediction ll organisms on Earth have a common ancestor. ll species are related. The relationship is called a phylogeny
More informationEmily Blanton Phylogeny Lab Report May 2009
Introduction It is suggested through scientific research that all living organisms are connected- that we all share a common ancestor and that, through time, we have all evolved from the same starting
More informationMolecular Clocks. The Holy Grail. Rate Constancy? Protein Variability. Evidence for Rate Constancy in Hemoglobin. Given
Molecular Clocks Rose Hoberman The Holy Grail Fossil evidence is sparse and imprecise (or nonexistent) Predict divergence times by comparing molecular data Given a phylogenetic tree branch lengths (rt)
More informationConfidence Intervals in Ridge Regression using Jackknife and Bootstrap Methods
Chapter 4 Confidence Intervals in Ridge Regression using Jackknife and Bootstrap Methods 4.1 Introduction It is now explicable that ridge regression estimator (here we take ordinary ridge estimator (ORE)
More informationThe Nonparametric Bootstrap
The Nonparametric Bootstrap The nonparametric bootstrap may involve inferences about a parameter, but we use a nonparametric procedure in approximating the parametric distribution using the ECDF. We use
More informationPolitical Science 236 Hypothesis Testing: Review and Bootstrapping
Political Science 236 Hypothesis Testing: Review and Bootstrapping Rocío Titiunik Fall 2007 1 Hypothesis Testing Definition 1.1 Hypothesis. A hypothesis is a statement about a population parameter The
More informationAccuracy and Power of the Likelihood Ratio Test in Detecting Adaptive Molecular Evolution
Accuracy and Power of the Likelihood Ratio Test in Detecting Adaptive Molecular Evolution Maria Anisimova, Joseph P. Bielawski, and Ziheng Yang Department of Biology, Galton Laboratory, University College
More informationModern Phylogenetics. An Introduction to Phylogenetics. Phylogenetics and Systematics. Phylogenetic Tree of Whales
Modern Phylogenetics n Introduction to Phylogenetics ret Larget larget@stat.wisc.edu epartments of otany and of Statistics University of Wisconsin Madison January 27, 2010 Phylogenies are usually estimated
More informationHow should we go about modeling this? Model parameters? Time Substitution rate Can we observe time or subst. rate? What can we observe?
How should we go about modeling this? gorilla GAAGTCCTTGAGAAATAAACTGCACACACTGG orangutan GGACTCCTTGAGAAATAAACTGCACACACTGG Model parameters? Time Substitution rate Can we observe time or subst. rate? What
More informationLab 9: Maximum Likelihood and Modeltest
Integrative Biology 200A University of California, Berkeley "PRINCIPLES OF PHYLOGENETICS" Spring 2010 Updated by Nick Matzke Lab 9: Maximum Likelihood and Modeltest In this lab we re going to use PAUP*
More informationPreliminaries. Download PAUP* from: Tuesday, July 19, 16
Preliminaries Download PAUP* from: http://people.sc.fsu.edu/~dswofford/paup_test 1 A model of the Boston T System 1 Idea from Paul Lewis A simpler model? 2 Why do models matter? Model-based methods including
More informationBayesian Models for Phylogenetic Trees
Bayesian Models for Phylogenetic Trees Clarence Leung* 1 1 McGill Centre for Bioinformatics, McGill University, Montreal, Quebec, Canada ABSTRACT Introduction: Inferring genetic ancestry of different species
More informationBetter Bootstrap Confidence Intervals
by Bradley Efron University of Washington, Department of Statistics April 12, 2012 An example Suppose we wish to make inference on some parameter θ T (F ) (e.g. θ = E F X ), based on data We might suppose
More informationDATING LINEAGES: MOLECULAR AND PALEONTOLOGICAL APPROACHES TO THE TEMPORAL FRAMEWORK OF CLADES
Int. J. Plant Sci. 165(4 Suppl.):S7 S21. 2004. Ó 2004 by The University of Chicago. All rights reserved. 1058-5893/2004/1650S4-0002$15.00 DATING LINEAGES: MOLECULAR AND PALEONTOLOGICAL APPROACHES TO THE
More information8/23/2014. Phylogeny and the Tree of Life
Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major
More informationBayesian Inference using Markov Chain Monte Carlo in Phylogenetic Studies
Bayesian Inference using Markov Chain Monte Carlo in Phylogenetic Studies 1 What is phylogeny? Essay written for the course in Markov Chains 2004 Torbjörn Karfunkel Phylogeny is the evolutionary development
More informationCHAPTERS 24-25: Evidence for Evolution and Phylogeny
CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology
More informationStatistics - Lecture One. Outline. Charlotte Wickham 1. Basic ideas about estimation
Statistics - Lecture One Charlotte Wickham wickham@stat.berkeley.edu http://www.stat.berkeley.edu/~wickham/ Outline 1. Basic ideas about estimation 2. Method of Moments 3. Maximum Likelihood 4. Confidence
More informationUnderstanding relationship between homologous sequences
Molecular Evolution Molecular Evolution How and when were genes and proteins created? How old is a gene? How can we calculate the age of a gene? How did the gene evolve to the present form? What selective
More informationWhat Is Conservation?
What Is Conservation? Lee A. Newberg February 22, 2005 A Central Dogma Junk DNA mutates at a background rate, but functional DNA exhibits conservation. Today s Question What is this conservation? Lee A.
More informationFrequentist Properties of Bayesian Posterior Probabilities of Phylogenetic Trees Under Simple and Complex Substitution Models
Syst. Biol. 53(6):904 913, 2004 Copyright c Society of Systematic Biologists ISSN: 1063-5157 print / 1076-836X online DOI: 10.1080/10635150490522629 Frequentist Properties of Bayesian Posterior Probabilities
More informationOn Improving the Output of. a Statistical Model
On Improving the Output of Mark Delgado 4/19/2016 a Statistical Model Using GFS single point outputs for a linear regression model and improve forecasting i. Introduction Forecast Modelling Using computers
More informationModeling Trait Evolutionary Processes with More Than One Gene
University of New Mexico UNM Digital Repository Mathematics & Statistics ETDs Electronic Theses and Dissertations Spring 4-3-207 Modeling Trait Evolutionary Processes with More Than One Gene Huan Jiang
More information7. Tests for selection
Sequence analysis and genomics 7. Tests for selection Dr. Katja Nowick Group leader TFome and Transcriptome Evolution Bioinformatics group Paul-Flechsig-Institute for Brain Research www. nowicklab.info
More informationEstimation of species divergence dates with a sloppy molecular clock
Estimation of species divergence dates with a sloppy molecular clock Ziheng Yang Department of Biology University College London Date estimation with a clock is easy. t 2 = 13my t 3 t 1 t 4 t 5 Node Distance
More informationLecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM)
Bioinformatics II Probability and Statistics Universität Zürich and ETH Zürich Spring Semester 2009 Lecture 4: Evolutionary Models and Substitution Matrices (PAM and BLOSUM) Dr Fraser Daly adapted from
More informationPhylogenetics in the Age of Genomics: Prospects and Challenges
Phylogenetics in the Age of Genomics: Prospects and Challenges Antonis Rokas Department of Biological Sciences, Vanderbilt University http://as.vanderbilt.edu/rokaslab http://pubmed2wordle.appspot.com/
More informationRELATING PHYSICOCHEMMICAL PROPERTIES OF AMINO ACIDS TO VARIABLE NUCLEOTIDE SUBSTITUTION PATTERNS AMONG SITES ZIHENG YANG
RELATING PHYSICOCHEMMICAL PROPERTIES OF AMINO ACIDS TO VARIABLE NUCLEOTIDE SUBSTITUTION PATTERNS AMONG SITES ZIHENG YANG Department of Biology (Galton Laboratory), University College London, 4 Stephenson
More informationBayesian Phylogenetics:
Bayesian Phylogenetics: an introduction Marc A. Suchard msuchard@ucla.edu UCLA Who is this man? How sure are you? The one true tree? Methods we ve learned so far try to find a single tree that best describes
More informationCladistics and Bioinformatics Questions 2013
AP Biology Name Cladistics and Bioinformatics Questions 2013 1. The following table shows the percentage similarity in sequences of nucleotides from a homologous gene derived from five different species
More informationBranch-Length Prior Influences Bayesian Posterior Probability of Phylogeny
Syst. Biol. 54(3):455 470, 2005 Copyright c Society of Systematic Biologists ISSN: 1063-5157 print / 1076-836X online DOI: 10.1080/10635150590945313 Branch-Length Prior Influences Bayesian Posterior Probability
More informationLecture 4. Models of DNA and protein change. Likelihood methods
Lecture 4. Models of DNA and protein change. Likelihood methods Joe Felsenstein Department of Genome Sciences and Department of Biology Lecture 4. Models of DNA and protein change. Likelihood methods p.1/36
More informationPhylogenetics. BIOL 7711 Computational Bioscience
Consortium for Comparative Genomics! University of Colorado School of Medicine Phylogenetics BIOL 7711 Computational Bioscience Biochemistry and Molecular Genetics Computational Bioscience Program Consortium
More informationBootstrapping phylogenies: Large deviations and dispersion effects
Biometrika (1996), 83, 2, pp. 315-328 Printed in Great Britain Bootstrapping phylogenies: Large deviations and dispersion effects BY MICHAEL A. NEWTON Department of Statistics, University of Wisconsin-Madison,
More information