Introduction to Evolution

Size: px
Start display at page:

Download "Introduction to Evolution"

Transcription

1 Introduction to Evolution

2

3 What is evolution? A basic definition of evolution evolution can be precisely defined as any change in the frequency of alleles within a gene pool from one generation to the next." - Helena Curtis and N. Sue Barnes, Biology, 5th ed Worth Publishers, p.974

4 So what does the definition mean? Evolution is a change in the number of times specific genes that code for specific characteristics occur within an interbreeding population Individuals don t evolve, populations do There is no implied improvement in evolution

5 Genetic Variation and Evolution Evolution: changes through time 1. Species accumulate difference 2. Descendants differ from their ancestors 3. New species arise from existing ones

6 A brief history of Charles Darwin Born on February 12, 1809 in England. From 1831 to 1836 Darwin served as naturalist aboard the H.M.S. Beagle on a British science expedition around the world.

7 A brief history of Charles Darwin He observed variation in related or similar species of plants and animals that were geographically isolated from each other. These observations were the basis for his ideas.

8 Natural Selection Darwin knew nothing of genes What he did have were two observations From these he made inferences that provided the motive force for evolution

9 Natural Selection Observation 1: Organisms generally have more offspring than can survive to adulthood. Observation 2: Offspring are not identical. There is variation in their appearance, size, and other characteristics.

10 Natural Selection Inference: Those organisms that are better adapted to their environment have a greater likelihood of surviving to adulthood and passing these characteristics on to their offspring. Survival of the fittest.

11 Survival of the fittest. Darwin s theory for how long necks evolved in giraffes

12 Natural selection: mechanism of evolutionary change Individuals have specific inherited characteristics They produce more surviving offspring The population includes more individuals with these specific characteristics The population evolves and is better adapted to its present environment

13

14 Fitness in Biology Fitness: A phenotype with greater fitness usually increases in frequency Fitness is a combination of: Survival: how long does an organism live Mating success: how often it mates Number of offspring per mating that survive

15 Hardy Weinberg principle Genotype frequencies in a population remain constant or are in equilibrium from generation to generation unless specific disturbing influences are introduced.

16 Hardy Weinberg principle Those disturbing influences include 1. new mutations 2. gene flow 3. genetic drift 4. selection 5. non-random mating

17 In genetics terms, evolution is any change in the relative frequency of alleles in a gene pool of a population.

18 Points to Make: 1. Gene pool -- all genes (alleles) that are present in a population. 2. Frequency -- the number of times that allele occurs in a gene pool. 3. Evolution is studied and understood at the population level NOT species level. a. Populations evolve not individuals.

19 Why do allele frequencies change?

20

21

22

23

24 5. Non-Random Mating AKA selective mating examples: Inbreeding or mating between relatives Assortative matingchoosing mates with similar phenotypes Competition

25 All living things share a common ancestor. We can draw a Tree of Life to show how every species is related.

26 Evolution is a theory and a fact. The theory of Evolution deals with how Evolution happens. Our understanding of this process is always changing. Evolution is also a fact as there is a huge amount of indisputable evidence for its occurrence. Rodin s The Thinker

27 The genetic make-up of an organism is known as its genotype. An organism s genotype and the environment in which it lives determines its total characteristic traits i.e. its phenotype. commons.wikimedia.org/wiki/image:dna_double_helix_vertikal.png

28 The double-helix structure of DNA was discovered in Watson and Crick and their model of DNA DNA replication en.wikipedia.org/wiki/dna This showed how genetic information is transferred from one cell to another almost without error.

29 Types of mutation Occasional mutations or copying errors can occur when DNA is replicated. Mutations may be caused by radiation, viruses, or carcinogens. Mutant fruit fly Mutations are rare and often have damaging effects. upload.wikimedia.org/wikipedia/commons/7/79/types-of-mutation.png humansystemstherapeutics.com/bb.htm

30 Some mutations will persist and increase genetic variation within a population. Variants of a particular gene are known as alleles. For example, one of the genes for hair color comprises brown/blonde alleles. majorityrights.com/index. php/weblog/comments/racial_variation_in_some_parts_of_the_skull_in

31 Selection of dark gene Mutant alleles spread through a population by sexual reproduction. If an allele exerts a harmful effect, it will reduce the ability of the individual to reproduce and the allele will probably be removed from the population. In contrast, mutants with favorable effects are passed on

32 en.wikipedia.org/wiki/image:biston.betularia.f.carbonaria.7209.jpg en.wikipedia.org/wiki/j._b._s._haldane The Peppered Moth is an example of Natural Selection in action During the Industrial Revolution the trees on which the moth rested became soot-covered. This selected against the allele for pale colour in the population (which were poorly camouflaged from predators) and selected for the dark color allele.

33 The dog is another example of how selection can change the frequency of alleles in a population. Dogs have been artificially selected for certain characteristics for many years, and different breeds have different alleles. Dogs are wolves All breeds of dog belong to the same species, Canis lupus (the wolf) so this is an example of Microevolution as no new species has resulted.

34 However, if two populations of a species become isolated from one another for tens of thousands of years, genetic difference may become marked. If the two populations can no-longer interbreed, new species are born. This is called Macroevolution. Galapagos finches Darwin s Galapagos finches are an example of this process in action.

35 The mosquito was introduced to the London Underground during its construction around London Underground Mosquito en.wikipedia.org/wiki/image:gb-lu-angel-southbound.jpg en.wikipedia.org/wiki/culex Studies indicate several genetic differences from its above-ground ancestors. Interbreeding between populations is difficult suggesting that speciation may be occurring.

36 The basic similarity of all living things suggests that they evolved from a single common ancestor. All living things pass on information from generation to generation using the DNA. DNA for Information Transfer All living things also use a molecule called ATP to carry energy around the organism. en.wikipedia.org/wiki/image:atp-xtal-3d-sticks.png ATP for Energy Transfer

37 HUMAN CHIMPANZEE GORILLA CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCA TGACTGTTGAACGA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA Genetic code of chimps and gorillas is almost identical to humans If evolution is true then we might also expect that closely related organisms will be more similar to one another than more distantly related organisms. Comparison of the human genetic code with that of other organisms show that chimpanzees are nearly genetically identical (differ by less than 1.2%) whereas the mouse differs by 15%.

38 Similar comparisons can be made based on anatomical evidence. The skeleton of humans and gorillas are very similar suggesting they shared a recent common ancestor, but very different from the more distantly related woodlouse Human and Gorilla yet all have a common shared characteristic: bilateral symmetry en.wikipedia.org/wiki/image:primatenskelett-drawing.jpg Woodlouse

39 The pentadactyl limb is ancestral to all vertebrates but modified for different uses en.wikipedia.org/wiki/image:evolution_pl.png

40 As evolution progresses, some structures get side-lined as they are not longer of use. These are known as vestigial structures. The coccyx is a much reduced version of an ancestral tail, which was formerly adapted to aid balance and climbing. The coccyx is a vestigial tail Another vestigial structure in humans is the appendix. en.wikipedia.org/wiki/image:illu_vertebral_column.jpg

41 World Health Org. en.wikipedia.org/wiki/image:eopraptor_sketch5.png NASA origins bacteria complex cells dinosaurs humans The fossil record shows a sequence from simple bacteria to more complicated organisms through tim.

42 Many fossils show a clear transition from one species, or group, to another. Archaeopteryx was found in Germany in It share many characteristics with both dinosaurs and birds. Archaeopteryx en.wikipedia.org/wiki/image:archaeopteryx_lithographica_paris.jpg It provides good evidence that birds arose from dinosaur ancestors

43 Marsupials Geographic spread of organisms also tells of their past evolution. Marsupials occur in two populations today in the Americas and Australia. evolution.berkeley.edu/evosite/lines/ivcexperiments.shtml en.wikipedia.org/wiki/image:kangaroo_and_joey03.jpg This shows the group evolved before the continents drifted apart

44 Staphylococcus Certain bacteria can become resistant to antibiotics This is an example of natural selection in action. The antibiotic acts as an environmental pressure. It weeds out those bacteria with low resistance and only those with high resistance survive to reproduce. en.wikipedia.org/wiki/image:staphylococcus_aureus%2c_50%2c000x%2c_usda%2c_ars%2c_emu.jpg

Evolution commons.wikimedia.org/wiki/image:dna_double_helix_vertikal.png commons.wikimedia.org/wiki/image:charles_darwin_1881.jpg

Evolution commons.wikimedia.org/wiki/image:dna_double_helix_vertikal.png commons.wikimedia.org/wiki/image:charles_darwin_1881.jpg Evolution commons.wikimedia.org/wiki/image:dna_double_helix_vertikal.png commons.wikimedia.org/wiki/image:charles_darwin_1881.jpg The Tree of Life All living things share a common ancestor. We can draw

More information

Evolution and Darwin

Evolution and Darwin Evolution and Darwin Evolution The processes that have transformed life on earth from it s earliest forms to the vast diversity that characterizes it today - Darwin Old Theories of Evolution Jean Baptiste

More information

EVOLUTION change in populations over time

EVOLUTION change in populations over time EVOLUTION change in populations over time HISTORY ideas that shaped the current theory James Hutton (1785) proposes that Earth is shaped by geological forces that took place over extremely long periods

More information

EVOLUTION change in populations over time

EVOLUTION change in populations over time EVOLUTION change in populations over time HISTORY ideas that shaped the current theory James Hutton & Charles Lyell proposes that Earth is shaped by geological forces that took place over extremely long

More information

EL41: Evolution and Extinction of Life on Earth

EL41: Evolution and Extinction of Life on Earth EL41: Evolution and Extinction of Life on Earth Lecture 1.2. How biological evolution works https://www.tangledbankstudios.org/films/mass-extinction Lecture Overview! Topics: Darwinian evolution Adaptations

More information

EVOLUTION. HISTORY: Ideas that shaped the current evolutionary theory. Evolution change in populations over time.

EVOLUTION. HISTORY: Ideas that shaped the current evolutionary theory. Evolution change in populations over time. EVOLUTION HISTORY: Ideas that shaped the current evolutionary theory. Evolution change in populations over time. James Hutton & Charles Lyell proposes that Earth is shaped by geological forces that took

More information

Unit 8: EVOLUTION NOTES

Unit 8: EVOLUTION NOTES Unit 8: EVOLUTION NOTES Canale LE EVOLUTION is the change in gene frequency in a population over time. Generally, organisms change from simple to more complex, and happens over many generations. **Evolution

More information

Darwin s Observations & Conclusions The Struggle for Existence

Darwin s Observations & Conclusions The Struggle for Existence Darwin s Observations & Conclusions The Struggle for Existence 1 Voyage of the Beagle During His Travels, Darwin Made Numerous Observations And Collected Evidence That Led Him To Propose A Revolutionary

More information

THE THEORY OF EVOLUTION

THE THEORY OF EVOLUTION THE THEORY OF EVOLUTION Why evolution matters Theory: A well-substantiated explanation of some aspect of the natural world, based on a body of facts that have been repeatedly confirmed through observation

More information

Theory of Evolution. Evolution The process of change over time. Specifically, a change in the frequency of a gene or allele in a population over time

Theory of Evolution. Evolution The process of change over time. Specifically, a change in the frequency of a gene or allele in a population over time Theory of Evolution Learning Goals Define "Evolution" & "Natural Selection". Describe the 4 steps of Natural Selection, giving an example of each. Explain the importance of "Variation". Does Natural Selection

More information

REVIEW 6: EVOLUTION. 1. Define evolution: Was not the first to think of evolution, but he did figure out how it works (mostly).

REVIEW 6: EVOLUTION. 1. Define evolution: Was not the first to think of evolution, but he did figure out how it works (mostly). Name: REVIEW 6: EVOLUTION 1. Define evolution: 2. Modern Theory of Evolution: a. Charles Darwin: Was not the first to think of evolution, but he did figure out how it works (mostly). However, Darwin didn

More information

Name Date Class. Patterns of Evolution

Name Date Class. Patterns of Evolution Concept Mapping Patterns of Evolution Complete the flowchart about patterns of evolution. These terms may be used more than once: adaptive radiation, change in response to each other, convergent evolution,

More information

Guided Notes: Evolution. is the change in traits through generations over! Occurs in, NOT individual organisms

Guided Notes: Evolution. is the change in traits through generations over! Occurs in, NOT individual organisms Guided Notes: Evolution The Theory of Evolution is the change in traits through generations over! Occurs in, NOT individual organisms How Have Organisms Changed? At the time life emerged, the Earth was

More information

Evolution Unit: What is Evolution?

Evolution Unit: What is Evolution? Evolution Unit: What is Evolution? What is The Theory of Evolution? Evolution is, a change (in the genetic composition) of a population over time. on a larger scale, the entire biological history, from

More information

Name Date Class CHAPTER 15. In your textbook, read about developing the theory of natural selection. For each statement below, write true or false.

Name Date Class CHAPTER 15. In your textbook, read about developing the theory of natural selection. For each statement below, write true or false. Name Date Class Study Guide CHAPTER 15 Section 1: Darwin s Theory of Evolution by Natural Selection In your textbook, read about developing the theory of natural selection. For each statement below, write

More information

Darwin & Natural Selection. Adapted from Mr. Gray & Bristol University

Darwin & Natural Selection. Adapted from Mr. Gray & Bristol University Darwin & Natural Selection Adapted from Mr. Gray & Bristol University Basic Scientific Terms Review Hypothesis: is an educated guess, based on observations. It's a prediction of cause and effect. Theory:

More information

Theory a well supported testable explanation of phenomenon occurring in the natural world.

Theory a well supported testable explanation of phenomenon occurring in the natural world. Evolution Theory of Evolution Theory a well supported testable explanation of phenomenon occurring in the natural world. Evolution the process by which modern organisms changed over time from ancient common

More information

Vocab. ! Evolution - change in a kind of organism over time; process by which modern organisms have descended from ancient organisms

Vocab. ! Evolution - change in a kind of organism over time; process by which modern organisms have descended from ancient organisms Vocab! Evolution - change in a kind of organism over time; process by which modern organisms have descended from ancient organisms! Theory - well-tested explanation that unifies a broad range of observations

More information

THE HISTORY OF THE THEORY. Darwin presented that happens and offered an of how it happens. Theory a broad that has been and

THE HISTORY OF THE THEORY. Darwin presented that happens and offered an of how it happens. Theory a broad that has been and Evolution Notes THE HISTORY OF THE THEORY Why is the evolutionary theory associated with Charles Darwin? Darwin presented that happens and offered an of how it happens. o Evolution the process by which

More information

Lesson 1 Syllabus Reference

Lesson 1 Syllabus Reference Lesson 1 Syllabus Reference Outcomes A student Explains how biological understanding has advanced through scientific discoveries, technological developments and the needs of society. Content The theory

More information

IV. Comparative Anatomy

IV. Comparative Anatomy Whale Evolution: Fossil Record of Evolution Modern toothed whales Rodhocetus kasrani reduced hind limbs could not walk; swam with up-down motion like modern whales Pakicetus attocki lived on land; skull

More information

History of Biological Diversity. Evolution: Darwin s travel

History of Biological Diversity. Evolution: Darwin s travel History of Biological Diversity Evolution: Darwin s travel Developing the Theory of Evolution The Galápagos Islands Darwin noticed that the different islands all seemed to have their own, slightly different

More information

Natural Selection and Evolution

Natural Selection and Evolution Natural Selection and Evolution Our plant has been evolving from its simplest beginnings into a vast range of organisms present today This has happened by natural selection Natural Selection and Evolution

More information

Evolution. Chapters 16 & 17

Evolution. Chapters 16 & 17 Evolution Chapters 16 & 17 Darwin s Voyage Chapter 16 Change over time Evolution Charles Darwin Developed a scientific theory that explains how modern organisms evolved over long periods of time through

More information

Biology Chapter 15 Evolution Notes

Biology Chapter 15 Evolution Notes Biology Chapter 15 Evolution Notes Section 1: Darwin's Theory of Evolution by Natural Selection Charles Darwin- English naturalist that studied animals over a number of years before developing the theory

More information

Evidence of evolution

Evidence of evolution The Theory of Evolution Charles Darwin Evidence for evolution Mechanisms for evolution Natural selection Speciation Evidence of evolution Structural adaptations Mimicry Camouflage Physiological adaptations

More information

What is Evolution? Study of how things change over time

What is Evolution? Study of how things change over time 10.2 15 Darwin s Theory Observations of Evolution What is Evolution? Study of how things change over time 10.2 15 Darwin s Theory Observations of Evolution Theories of Evolution - Lamarck Jean Baptiste

More information

EVOLUTION No matter what your beliefs are, it is always better to have as much information as you can so that you can form your own, educated opinion!

EVOLUTION No matter what your beliefs are, it is always better to have as much information as you can so that you can form your own, educated opinion! EVOLUTION No matter what your beliefs are, it is always better to have as much information as you can so that you can form your own, educated opinion! Standards SB5. Students will evaluate the role of

More information

NOTES CH 17 Evolution of. Populations

NOTES CH 17 Evolution of. Populations NOTES CH 17 Evolution of Vocabulary Fitness Genetic Drift Punctuated Equilibrium Gene flow Adaptive radiation Divergent evolution Convergent evolution Gradualism Populations 17.1 Genes & Variation Darwin

More information

Dichotomous Key for Genus Problematica

Dichotomous Key for Genus Problematica Evolution Summative Assessment DO NOT WRITE ON TEST 1. Industrial melanism describes the change in moth color from pale to dark after pollution from factories resulting in coating tree trunks with a layer

More information

NOTES Ch 17: Genes and. Variation

NOTES Ch 17: Genes and. Variation NOTES Ch 17: Genes and Vocabulary Fitness Genetic Drift Punctuated Equilibrium Gene flow Adaptive radiation Divergent evolution Convergent evolution Gradualism Variation 17.1 Genes & Variation Darwin developed

More information

Chapter 2 Section 1 discussed the effect of the environment on the phenotype of individuals light, population ratio, type of soil, temperature )

Chapter 2 Section 1 discussed the effect of the environment on the phenotype of individuals light, population ratio, type of soil, temperature ) Chapter 2 Section 1 discussed the effect of the environment on the phenotype of individuals light, population ratio, type of soil, temperature ) Chapter 2 Section 2: how traits are passed from the parents

More information

Theory of Evolution. Mr. Rafferty 5-19

Theory of Evolution. Mr. Rafferty 5-19 Theory of Evolution Mr. Rafferty 5-19 Theories of Evolution Theories of Evolution attempt to explain how the similarities and differences among species came about. Early theories stated that new species

More information

Evolution and Natural Selection (16-18)

Evolution and Natural Selection (16-18) Evolution and Natural Selection (16-18) 3 Key Observations of Life: 1) Shared Characteristics of Life (Unity) 2) Rich Diversity of Life 3) Organisms are Adapted to their Environment These observations

More information

Chapter 17: Population Genetics and Speciation

Chapter 17: Population Genetics and Speciation Chapter 17: Population Genetics and Speciation Section 1: Genetic Variation Population Genetics: Normal Distribution: a line graph showing the general trends in a set of data of which most values are near

More information

Biology II. Evolution

Biology II. Evolution Biology II Evolution Observation-Something we know to be true based on one or more of our five senses. Inference- A conclusion which is based on observations Hypothesis- a testable inference usually stated

More information

PRESENTER NOTES: EVOLUTION

PRESENTER NOTES: EVOLUTION PRESENTER NOTES: EVOLUTION INTRODUCTION SLIDE 1. EVOLUTION Presenter notes: Evolution is one of the most important concepts in the Science of Biology. In fact Biology simply does not make sense without

More information

Biology. Evolution: History & Process

Biology. Evolution: History & Process Biology Evolution: History & Process Terms: A species is a group of organisms, or population, that can be interbreed & produce fertile offspring. Variations are the differences found within species. Ex:

More information

THE THEORY OF EVOLUTION

THE THEORY OF EVOLUTION THE THEORY OF EVOLUTION Name: Period: Date: I. Evolution- A brief overview EVOLUTION IS: 1. 2. Descent with modifications 3. Plants and animals of today are forms of plants and animals of the past 4. Organisms

More information

Evolution Test Review

Evolution Test Review Name Evolution Test Review Period 1) A group of interbreeding organisms (a species) living in a given area is called population 2) Give an example of a species. Ex. One wolf Give an example of a population.

More information

I. Theories of Evolution Evolution: Adaptation: Jean Baptiste de Lamarck: a) Use & Disuse: b) Inheritance of Acquired Characteristics:

I. Theories of Evolution Evolution: Adaptation: Jean Baptiste de Lamarck: a) Use & Disuse: b) Inheritance of Acquired Characteristics: I. Theories of Evolution Evolution: Adaptation: Jean Baptiste de Lamarck: a) Use & Disuse: b) Inheritance of Acquired Characteristics: Figure 1: Lamarckian Evolution III. Darwin & Evolution The Voyage

More information

Evolution. Year Scientist Theory/Experiment Conclusion

Evolution. Year Scientist Theory/Experiment Conclusion Evolution Origin of Life Year Scientist Theory/Experiment Conclusion 1927 Lemaitre Big Bang theory The universe expanded from explosion of a primordial, hot substance. 1924 Oparin and Chemical evolution

More information

of EVOLUTION???????????? states that existing forms of life on earth have arisen from earlier forms over long periods of time.

of EVOLUTION???????????? states that existing forms of life on earth have arisen from earlier forms over long periods of time. Evolution The WHAT theory IS of EVOLUTION???????????? states that existing forms of life on earth have arisen from earlier forms over long periods of time. Some of the strongest evidence to support evolution

More information

Gene Pool Genetic Drift Geographic Isolation Fitness Hardy-Weinberg Equilibrium Natural Selection

Gene Pool Genetic Drift Geographic Isolation Fitness Hardy-Weinberg Equilibrium Natural Selection CONCEPT 1 EVOLUTION 1. Natural Selection a. Major mechanism of change over time Darwin s theory of evolution b. There is variation among phenotypes genetic mutations play a role in increasing variation

More information

Evolution. Species Changing over time

Evolution. Species Changing over time Evolution Species Changing over time Objectives I can differentiate between natural selection and artificial selection and I can give examples of each. I can explain several reasons for genetic variation

More information

CH 16: Evolution of Population

CH 16: Evolution of Population CH 16: Evolution of Population 16.1 Genes and Variation A. Introduction 1. Darwin s theory of evolution by natural selection explained how 2. What Darwin did not know was how were passed down through each

More information

Darwin s Theory of Natural Selection

Darwin s Theory of Natural Selection Darwin s Theory of Natural Selection Question: Has Life Ever Changed? In 1700 s, scientists examined fossils that showed how extinct species look very different than they do today. Scientists began to

More information

Section 15 3 Darwin Presents His Case

Section 15 3 Darwin Presents His Case Section 15 3 Darwin Presents His Case (pages 378 386) Key Concepts How is natural variation used in artificial selection? How is natural selection related to a species fitness? What evidence of evolution

More information

Chapter Review USING KEY TERMS UNDERSTANDING KEY IDEAS. Skills Worksheet. Multiple Choice

Chapter Review USING KEY TERMS UNDERSTANDING KEY IDEAS. Skills Worksheet. Multiple Choice Skills Worksheet Chapter Review USING KEY TERMS Complete each of the following sentences by choosing the correct term from the word bank. adaptation evolution species natural selection generation time

More information

Biology II. Evolution

Biology II. Evolution Biology II Evolution Observation-Something we know to be true based on one or more of our five senses. Inference- A conclusion which is based on observations Hypothesis- a testable inference usually stated

More information

19. When allele frequencies change as a result of the migration of a small subgroup of a population

19. When allele frequencies change as a result of the migration of a small subgroup of a population CP Biology: Evolution Name: Per: Directions: Use your textbook to help you answer the practice questions for each chapter. It is important that you READ the chapter sections and not just search for the

More information

Population Genetics & Evolution

Population Genetics & Evolution The Theory of Evolution Mechanisms of Evolution Notes Pt. 4 Population Genetics & Evolution IMPORTANT TO REMEMBER: Populations, not individuals, evolve. Population = a group of individuals of the same

More information

EQ: How are genetic variations caused and how do they lead to natural selection?

EQ: How are genetic variations caused and how do they lead to natural selection? EQ: How are genetic variations caused and how do they lead to natural selection? What is natural selection Individuals that have physical or behavioral traits that better suit their environment are more

More information

Evidence for Evolution

Evidence for Evolution Evidence for Evolution Evolution Biological evolution is descent with modification. It is important to remember that: Humans did not evolve from chimpanzees. Humans and chimpanzees are evolutionary cousins

More information

Changes Over Time EVOLUTION

Changes Over Time EVOLUTION Changes Over Time EVOLUTION Charles Darwin The Father of Evolution History Darwin s World (1809-1875) Height of the British colonial period. Beginning of the Industrial Revolution. New Ideas: Taxonomy

More information

Natural Selection. Charles Darwin & Alfred Russell Wallace

Natural Selection. Charles Darwin & Alfred Russell Wallace Natural Selection Charles Darwin & Alfred Russell Wallace Darwin s Influences Darwin observed such variations in species on his voyage as a naturalist on the HMS Beagle Darwin s Influences Kept vast diaries

More information

Evolution and Natural Selection

Evolution and Natural Selection Evolution and Natural Selection What Evolution is NOT Change in a gene pool over time What Evolution IS Evolution unites all fields of biology! Cell biology Genetics/DNA Ecology Biodiversity/Taxonomy Carolus

More information

Changes through time. Survival of the Fittest

Changes through time. Survival of the Fittest Changes through time Survival of the Fittest Evidence that life has changed and is now changing Fossil Record Fossils are remains or traces of organisms that lived in the past. Fossil Record Fossils are

More information

Evolution. Species Changing over time

Evolution. Species Changing over time Evolution Species Changing over time Charles Darwin Evolution by Means of Natural Selection Reasons for Change Mutation A mutation could cause parents with genes for bright green coloration to have offspring

More information

Evidence of Species Change

Evidence of Species Change Evidence of Species Change Evidence of Evolution What is evolution? Evolution is change over time Scientific theory of evolution explains how living things descended from earlier organisms Evidence of

More information

Darwin s Theory of Evolution

Darwin s Theory of Evolution EVOLUTION Darwin s Theory of Evolution n Evolution, or change over time, is the process by which modern organisms have descended from ancient organisms. n A scientific theory is a well-supported testable

More information

LIFE SCIENCE CHAPTER 7 FLASHCARDS

LIFE SCIENCE CHAPTER 7 FLASHCARDS LIFE SCIENCE CHAPTER 7 FLASHCARDS What did Darwin NOT understand about the process of evolution? A. the slowness of the process B. the role of genetics C. the importance of separation D. the importance

More information

CH_15_Evolution.notebook. February 28, Cellular Evolution. Jean Baptiste de Lamarck. Endosymbiont Theory. Charles Darwin

CH_15_Evolution.notebook. February 28, Cellular Evolution. Jean Baptiste de Lamarck. Endosymbiont Theory. Charles Darwin Cellular Evolution The first cells were prokaryotic They did not need oxygen (the atmosphere did not contain oxygen until 1.8 billion years ago) Eukaryotic cells were found in the fossil record about 2

More information

Evolution (Chapters 15 & 16)

Evolution (Chapters 15 & 16) Evolution (Chapters 15 & 16) Before You Read... Use the What I Know column to list the things you know about evolution. Then list the questions you have about evolution in the What I Want to Find Out column.

More information

Evolutionary change. Evolution and Diversity. Two British naturalists, one revolutionary idea. Darwin observed organisms in many environments

Evolutionary change. Evolution and Diversity. Two British naturalists, one revolutionary idea. Darwin observed organisms in many environments Evolutionary change Evolution and Diversity Ch 13 How populations evolve Organisms change over time In baby steps Species (including humans) are descended from other species Two British naturalists, one

More information

Microevolution (Ch 16) Test Bank

Microevolution (Ch 16) Test Bank Microevolution (Ch 16) Test Bank Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Which of the following statements describes what all members

More information

Evolution of Populations

Evolution of Populations Evolution of Populations Gene Pools 1. All of the genes in a population - Contains 2 or more alleles (forms of a gene) for each trait 2. Relative frequencies - # of times an allele occurs in a gene pool

More information

Enduring Understanding: Change in the genetic makeup of a population over time is evolution Pearson Education, Inc.

Enduring Understanding: Change in the genetic makeup of a population over time is evolution Pearson Education, Inc. Enduring Understanding: Change in the genetic makeup of a population over time is evolution. Objective: You will be able to identify the key concepts of evolution theory Do Now: Read the enduring understanding

More information

Study guide for test on end of chapter 2 and beginning of chapter 3

Study guide for test on end of chapter 2 and beginning of chapter 3 Study guide for test on end of chapter 2 and beginning of chapter 3 Chapter 2 questions: You should review: 1. 2 sets of notes: Evidence for Evolution (be able to name 3 of the 5) and What can affect evolution

More information

EVOLUTION. Evolution - changes in allele frequency in populations over generations.

EVOLUTION. Evolution - changes in allele frequency in populations over generations. EVOLUTION Evolution - changes in allele frequency in populations over generations. Sources of genetic variation: genetic recombination by sexual reproduction (produces new combinations of genes) mutation

More information

Station 1. What is Evolution? What causes Evolution? A primary example of Evolution, is different bird beak sizes. What caused this to occur?

Station 1. What is Evolution? What causes Evolution? A primary example of Evolution, is different bird beak sizes. What caused this to occur? Station 1 What is Evolution? What causes Evolution? A primary example of Evolution, is different bird beak sizes. What caused this to occur? Station 2 What is Survival of the Fittest? How is fitness measured?

More information

Evolution. Darwin s Voyage

Evolution. Darwin s Voyage Evolution Darwin s Voyage Charles Darwin Explorer on an observation trip to the Galapagos Islands. He set sail on the HMS Beagle in 1858 from England on a 5 year trip. He was a naturalist (a person who

More information

It all depends on barriers that prevent members of two species from producing viable, fertile hybrids.

It all depends on barriers that prevent members of two species from producing viable, fertile hybrids. Name: Date: Theory of Evolution Evolution: Change in a over a period of time Explains the great of organisms Major points of Origin of Species Descent with Modification o All organisms are related through

More information

Chapter 16: Evolutionary Theory

Chapter 16: Evolutionary Theory Chapter 16: Evolutionary Theory Section 1: Developing a Theory Evolution: Artificial Selection: Evolution: I. A Theory to Explain Change Over Time B. Charles Darwin C. Theory: D. Modern evolutionary theory

More information

Chapter 15 Evolution

Chapter 15 Evolution Section 1: Darwin s Theory of Natural Selection Section 2: Evidence of Section 3: Shaping ary Theory Click on a lesson name to select. 15.1 Darwin s Theory of Natural Selection Darwin on the HMS Beagle

More information

EVOLUTION BY NATURAL SELECTION. This presentation contains copyrighted material under the educational fair use exemption to the U.S. copyright law.

EVOLUTION BY NATURAL SELECTION. This presentation contains copyrighted material under the educational fair use exemption to the U.S. copyright law. EVOLUTION BY NATURAL SELECTION This presentation contains copyrighted material under the educational fair use exemption to the U.S. copyright law. Ancient ideas of evolution! Plato! Every organism was

More information

Biology. Slide 1 of 41. End Show. Copyright Pearson Prentice Hall

Biology. Slide 1 of 41. End Show. Copyright Pearson Prentice Hall Biology 1 of 41 Do Now: Why do the colors of moths change over time? Write a detailed explanation on the scrap paper provided. 2 of 41 Why do the colors of moths change over time? 3 of 41 4 of 41 Evolution

More information

What is Evolution? Evolution Unit Vocabulary. Answer: Evidence of Evolution. What is a Gene Pool? Change over time.

What is Evolution? Evolution Unit Vocabulary. Answer: Evidence of Evolution. What is a Gene Pool? Change over time. What is Evolution? Evolution Unit Vocabulary Practice Quiz Change over time. Evidence of Evolution The gradual development of something, especially from simple to more complex. Can be big or very small

More information

Chapter 16. Table of Contents. Section 1 Genetic Equilibrium. Section 2 Disruption of Genetic Equilibrium. Section 3 Formation of Species

Chapter 16. Table of Contents. Section 1 Genetic Equilibrium. Section 2 Disruption of Genetic Equilibrium. Section 3 Formation of Species Population Genetics and Speciation Table of Contents Section 1 Genetic Equilibrium Section 2 Disruption of Genetic Equilibrium Section 3 Formation of Species Section 1 Genetic Equilibrium Objectives Identify

More information

Adaptation and Change

Adaptation and Change Adaptation and Change An adaptation is any structure or behavioral trait that improves an organism's success at reproducing and surviving. Most adaptations serve one of three purposes: 1. help an organism

More information

Mechanisms of Evolution. Adaptations. Old Ideas about Evolution. Behavioral. Structural. Biochemical. Physiological

Mechanisms of Evolution. Adaptations. Old Ideas about Evolution. Behavioral. Structural. Biochemical. Physiological Mechanisms of Evolution Honors Biology 2012 1 Adaptations Behavioral Structural Biochemical Physiological 2 Old Ideas about Evolution Aristotle (viewed species perfect and unchanging) Lamarck suggested

More information

e.g. population: 500, two alleles: Red (R) and White (r). Total: 1000 genes for flower color in the population

e.g. population: 500, two alleles: Red (R) and White (r). Total: 1000 genes for flower color in the population The Evolution of Populations What is Evolution? A change over time in the genetic composition of a population Human evolution The gene pool Is the total aggregate of genes for a particular trait in a population

More information

Thursday, March 21, 13. Evolution

Thursday, March 21, 13. Evolution Evolution What is Evolution? Evolution involves inheritable changes in a population of organisms through time Fundamental to biology and paleontology Paleontology is the study of life history as revealed

More information

Evolution. Just a few points

Evolution. Just a few points Evolution Just a few points Just What is a Species??? Species: a group of organisms that share similar characteristics can interbreed with one another produce fertile offspring Population: One species

More information

Boardworks Ltd The first wellknown. evolution:

Boardworks Ltd The first wellknown. evolution: 1 of 7 2 of 7 The first wellknown theory of evolution: 3 of 7 Lamarck s theory of evolution: The Theory of Use/Disuse and Acquired Traits Jean-Baptiste Lamarck (1744-1829) was a French botanist who believed

More information

Evolution Unit Ch in Miller & Levine Biology textbook

Evolution Unit Ch in Miller & Levine Biology textbook Evolution Unit Ch. 15-17 in Miller & Levine Biology textbook Evolution: theory of how modern organisms have descended from ancient organisms; a.k.a. "a change over time" Charles Darwin is one of the many

More information

Are individuals in a population of a species the same?

Are individuals in a population of a species the same? LEARNING OUTCOMES Define the term variation. Discuss the fact that variation occurs within, as well as between, species. Describe the differences between continuous and discontinuous variation, using examples

More information

UNIT V. Chapter 11 Evolution of Populations. Pre-AP Biology

UNIT V. Chapter 11 Evolution of Populations. Pre-AP Biology UNIT V Chapter 11 Evolution of Populations UNIT 4: EVOLUTION Chapter 11: The Evolution of Populations I. Genetic Variation Within Populations (11.1) A. Genetic variation in a population increases the chance

More information

Evolution. Changes over Time

Evolution. Changes over Time Evolution Changes over Time TEKS Students will analyze and evaluate B. 7 C how natural selection produces change in populations, not individuals B. 7 E/F effects of genetic mechanisms and their relationship

More information

The Theory of Evolution

The Theory of Evolution Name Date Class CHAPTER 13 DIRECTED READING The Theory of Evolution Section 13-1: The Theory of Evolution by Natural Selection Darwin Proposed a Mechanism for Evolution Mark each statement below T if it

More information

Face area (cm 2 ) Brain surface area (cm 2 ) Cranial capacity (cm 3 ) 1, Jaw Angle ( º )

Face area (cm 2 ) Brain surface area (cm 2 ) Cranial capacity (cm 3 ) 1, Jaw Angle ( º ) Honors Biology Test : Evolution GOOD LUCK! You ve learned so much! Multiple Choice: Identify the choice that best completes the statement or answers the question. (2 pts each) 1. As we move through the

More information

1. E, or change over time, is the process by which modern organisms have descended from ancient organisms

1. E, or change over time, is the process by which modern organisms have descended from ancient organisms Name Date Period EVOLUTION STARTS WITH? 1. E, or change over time, is the process by which modern organisms have descended from ancient organisms 2. A scientific T is a well supported, testable explanation

More information

1.A- Natural Selection

1.A- Natural Selection 1.A- Natural Selection Big Idea 1: The process of evolution drives the diversity and unity of life. EU 1.A- Evolution is change in the genetic makeup of a population over time. EU 1.B- Organisms are linked

More information

Chapters 17, 19.2, & 16.4 EVOLUTION

Chapters 17, 19.2, & 16.4 EVOLUTION Chapters 17, 19.2, & 16.4 EVOLUTION STANDARD #2 EXPLAIN THE PROCESS OF NATURAL SELECTION A. Explain how genes make evolution possible (17.1) B. Describe what cause a gene pool to change over time (17.2)

More information

UNIT 4: EVOLUTION Chapter 10: Principles of Evolution. I. Early Ideas about Evolution (10.1) A. Early scientists proposed ideas about evolution

UNIT 4: EVOLUTION Chapter 10: Principles of Evolution. I. Early Ideas about Evolution (10.1) A. Early scientists proposed ideas about evolution UNIT IV Chapter 10 Principles of Evolution UNIT 4: EVOLUTION Chapter 10: Principles of Evolution I. Early Ideas about Evolution (10.1) A. Early scientists proposed ideas about evolution 1. Evolution- process

More information

Biology 2017 Mr. Johnson

Biology 2017 Mr. Johnson Class Notes For EVOLUTION Biology 2017 Mr. Johnson Evolution genetic change over time *Theory = explanation based on much evidence (do not confuse with hypothesis ) *Not goal-oriented (can change and

More information

EVOLUTION. - Selection, Survival, and Drift

EVOLUTION. - Selection, Survival, and Drift EVOLUTION - Selection, Survival, and Drift Evolution Darwin on the HMS Beagle Darwin s role on the ship was as a geologist and companion to the captain. His goal was to collect biological and geological

More information

Outline. Evolution: Evidence, Selection and Adaptation. Key Concepts: One of the key words of our modern time is Evolution

Outline. Evolution: Evidence, Selection and Adaptation. Key Concepts: One of the key words of our modern time is Evolution Evolution: Evidence, Selection and Adaptation One of the key words of our modern time is Evolution u 1. Key concepts Outline u 2. Early Beliefs, and New Discoveries u 3. Darwin developed the theory of

More information

Answers Evolution. Year 10 Science Chapter 3. p39 1 Evolve means to develop gradually.

Answers Evolution. Year 10 Science Chapter 3. p39 1 Evolve means to develop gradually. Answers Evolution Year 10 Science Chapter 3 p39 1 Evolve means to develop gradually. 2 The basic idea of biological evolution is that all species on Earth share a common ancestor. The common ancestor,

More information

DUE TODAY DUE TODAY. HOMEWORK: Student Weekly Grade Tracking #25. CLASSWORK: Blood Typing Lab Ernie s Exit (Turn in) Admit Ticket

DUE TODAY DUE TODAY. HOMEWORK: Student Weekly Grade Tracking #25. CLASSWORK: Blood Typing Lab Ernie s Exit (Turn in) Admit Ticket Admit Ticket WOR KS HEE T Read Blood Types Sheet Complete Blood Type Worksheets DUE TODAY DUE TODAY HOMEWORK: Student Weekly Grade Tracking #25 CLASSWORK: Blood Typing Lab Ernie s Exit (Turn in) http://www.powerpointhintergrund.com/uploads/new-year-ppt-background-8.jpg

More information