Evolution and pathogenicity in the deadly chytrid pathogen of amphibians. Erica Bree Rosenblum UC Berkeley
|
|
|
- Ada Blair
- 5 years ago
- Views:
Transcription
1 Evolution and pathogenicity in the deadly chytrid pathogen of amphibians Erica Bree Rosenblum UC Berkeley
2 Emerging infectious disease
3 Emerging infectious disease EID events have risen significantly over time after controlling for reporting bias - Jones et al. Nature 2008 # EID events Decade Host Pathogen Environment Why are EID events on the rise?
4 EIDs can be due to changes in Disease outcome depends on host-pathogen-environment interaction The Pathogen The Host The Environment
5 Novelty in the microbial pathogen world But what is novelty?
6 Novelty in the microbial pathogen world * Novel pathogens don t just appear - they evolve Importance of studying a pathogen s evolutionary history
7 Novelty in the microbial pathogen world * Novel pathogens can be novel in multiple ways (changes in host range, changes in virulence, etc) Importance of studying novelty at multiple levels
8 Novelty in the microbial pathogen world Evolutionary and functional novelty in an emerging fungal pathogen of amphibians
9 Bd and amphibian declines
10 Bd and amphibian declines
11 Bd and amphibian declines Frog photo: Joel Sartore
12 Bd and amphibian declines Bd occurs on every continent with amphibians, infecting >500 species Published occurrence Unpublished occurrence Map courtesy of
13 Bd and amphibian declines Genetic and spatio-temporal data demonstrate that Bd is a novel, emerging pathogen, which has spread around the world quickly
14 Bd and amphibian declines Chytrids are basal fungi and are mostly sapbrobes Bd is the only chytrid that infects vertebrates Ascomycota Basidiomycota Zygomycota Chytridiomycota Metazoa
15 Bd and amphibian declines Bd kills frogs by disrupting the structure and function of their skin Bd may also have an immune evasion/ suppression strategy Rosenblum et al PLoS ONE Rosenblum et al Molecular Ecology
16 Novelty in the microbial pathogen world But there are persistent unanswered questions about the origin and spread of Bd and the interaction between Bd and its amphibian hosts Where did Bd come from and what makes it so deadly?
17 Genomics in non-model species Many of our questions cannot be answered using ecological approaches, and we cannot manipulate Bd to use cellular approaches So we are using genomics approaches to understand Bd evolution and pathogenicity
18 Genomics in non-model species
19 Genomics and EIDs With technological advances we can conduct genomic studies even for timecritical studies in non-model species
20 Genomics and EIDs Comparative genomics Functional genomics AGTCGTAGCCGCTATC! AGTCGTAGCCGCTATC! AGCCGTAGCCGCTATG! AGCCGTAACTGCTTTG! CGCTGCAACTGCTTTG! CGCTTCAACTGCTTTG! DNA transcription RNA Gene expression: (microarrays, RNAseq)
21 Using genomics to understand novelty Understanding evolutionary and functional novelty in Bd
22 Using genomics to understand novelty Understanding evolutionary and functional novelty in Bd
23 Novelty at the phylogenetic level It vs They? Bd has a single species name, but there may be important genetic and/or functional variation
24 Novelty at the phylogenetic level Sequence genomes of 28 Bd isolates from around the world and the genome of the closest known non-pathogenic chytrid JGI genome project backbone, Illumina resequencing ~30x coverage per isolate, ~25Mb genomes
25 Novelty at the phylogenetic level Dummy Data: Expectations given Bd s recent discovery and spread * * * * N. America (West) N. America (East) Latin America Asia Africa * Bullfrog isolate
26 Novelty at the phylogenetic level Rooted tree based on >100,000 SNPs N. America (West) N. America disomy (East) Latin America trisomy Asia tetrasomy Africa * Bullfrog isolate 0.07 LOH 5: 1.3 LOH 1: 0.6 LOH 1: 2.4 LOH 5: 1.0 LFT001_10 UM142 CJB5.2 CJB7 JEL271 JEL627 CLFT021 CLFT023 JEL275 JEL433 CLFT024 EV001 JEL408 NCRC LBAbercrom JEL310 JEL427 JEL429 JEL289 SRS812 MexMkt CLFT026 JEL267 JEL359 JEL238 TST75 MLA1 CJB4 * * * * Bd s evolutionary history is more complicated than expected No clear pointsource for origin or linear history of spread chromosome
27 Novelty at the phylogenetic level Rooted tree based on >100,000 SNPs N. America (West) N. America disomy (East) Latin America trisomy Asia tetrasomy Africa * Bullfrog isolate 0.07 LOH 5: 1.3 LOH 1: 0.6 LOH 1: 2.4 LOH 5: 1.0 LFT001_10 UM142 CJB5.2 CJB7 JEL271 JEL627 CLFT021 CLFT023 JEL275 JEL433 CLFT024 EV001 JEL408 NCRC LBAbercrom JEL310 JEL427 JEL429 JEL289 SRS812 MexMkt CLFT026 JEL267 JEL359 JEL238 TST75 MLA1 CJB4 * * * * No geographic or host specific population structure Confirms rapid spread and broad host range chromosome
28 Novelty at the phylogenetic level Rooted tree based on >100,000 SNPs N. America (West) N. America disomy (East) Latin America trisomy Asia tetrasomy Africa * Bullfrog isolate 0.07 LOH 5: 1.3 LOH 1: 0.6 LOH 1: 2.4 LOH 5: 1.0 LFT001_10 UM142 CJB5.2 CJB7 JEL271 JEL627 CLFT021 CLFT023 JEL275 JEL433 CLFT024 EV001 JEL408 NCRC LBAbercrom JEL310 JEL427 JEL429 JEL289 SRS812 MexMkt CLFT026 JEL267 JEL359 JEL238 TST75 MLA1 CJB4 * * * * Tree has more structure than expected There are 2 highly divergent Bd lineages chromosome
29 Novelty at the phylogenetic level Rooted tree based on >100,000 SNPs N. America (West) N. America disomy (East) Latin America trisomy Asia tetrasomy Africa * Bullfrog isolate 0.07 LOH 5: 1.3 LOH 1: 0.6 LOH 1: 2.4 LOH 5: 1.0 LFT001_10 UM142 CJB5.2 CJB7 JEL271 JEL627 CLFT021 CLFT023 JEL275 JEL433 CLFT024 EV001 JEL408 NCRC LBAbercrom JEL310 JEL427 JEL429 JEL289 SRS812 MexMkt CLFT026 JEL267 JEL359 JEL238 TST75 MLA1 CJB4 * * * * Basal lineage with isolates from Latin America Large clade with most of the global diversity Likely more diversity to be discovered with more sampling chromosome
30 Using genomics to understand Bd novelty Understanding evolutionary and functional novelty in Bd
31 Chytrid comparative genomics Massive expansions of gene families in Bd Ascomycota Basidiomycota Zygomycota Bd is a unique chytrid with functions no other chytrid has acquired Chytridiomycota Metazoa
32 Chytrid comparative genomics Massive expansions of protease gene families in Bd Fungalysin metallopeptidase Serine protease Rosenblum et al PNAS
33 Chytrid functional genomics vs Zoospores Sporangia vs Lab broth Frog skin
34 Chytrid functional genomics Many proteases are induced by exposure to host tissue Fungalysin metallopeptidase Serine protease zoospore sporangia frog skin
35 Chytrid comparative genomics When did the gene family expansions occur? Ascomycota Basidiomycota Zygomycota Chytridiomycota Metazoa
36 Chytrid comparative genomics
37 Chytrid comparative genomics Confirmed that Hp does not degrade host tissue Negative control Hp treatment Bd treatment Joneson, Stajich, Shiu, Rosenblum PLoS Pathogens
38 Chytrid comparative genomics Demonstrated that the dramatic protease gene family expansions are recent and mostly Bd-specific Fungalysin peptidase Serine protease Aspartyl protease Crinkler Joneson, Stajich, Shiu, Rosenblum PLoS Pathogens
39 Using genomics to understand Bd novelty Genomics approaches have been key for: Understanding Bd s complex history & identifying key evolutionary transition points Identifying candidate Bd pathogenicity factors & understanding Bd s novel functions Understanding evolution of pathogens and mechanisms of pathogenesis can inform strategies for addressing microbial threats
40 Acknowledgements NSF-NIH EID Program (EF ) NIH COBRE Program (P20 RR S2) NSF CAREER Program (DEB ) Key Rosenblum Lab Personnel Thomas Poorten Suzanne Joneson Jamie Voyles Lydia Gentry Karen Pohl Image: Tom Poorten Additional Collaborators Jason Stajich Shin-Han Shiu Timothy James Kelly Zamudio Katy Richards-Hrdlicka Dan Ilut David Rodriguez Michael Eisen Matt Settles Joint Genome Institute
[Byline: Erica Bree Rosenblum1*, Jamie Voyles2, Thomas J. Poorten1, Jason E. Stajich3,4
2010-02-03-35 Chytrid fungus, frogs - worldwide: review article To: (05) Zoonoses, general; (23) Veterinary education ************************************************* CHYTRID FUNGUS, FROGS - WORLDWIDE:
Genetic Drift in Human Evolution
Genetic Drift in Human Evolution (Part 2 of 2) 1 Ecology and Evolutionary Biology Center for Computational Molecular Biology Brown University Outline Introduction to genetic drift Modeling genetic drift
Rapid speciation following recent host shift in the plant pathogenic fungus Rhynchosporium
Rapid speciation following recent host shift in the plant pathogenic fungus Rhynchosporium Tiziana Vonlanthen, Laurin Müller 27.10.15 1 Second paper: Origin and Domestication of the Fungal Wheat Pathogen
Genomic Transition to Pathogenicity in Chytrid Fungi
Genomic Transition to Pathogenicity in Chytrid Fungi Suzanne Joneson 1, Jason E. Stajich 2, Shin-Han Shiu 3, Erica Bree Rosenblum 1 * 1 Department of Biological Sciences, University of Idaho, Moscow, Idaho,
Amphibian populations around the world have been experiencing
Global gene expression profiles for life stages of the deadly amphibian pathogen Batrachochytrium dendrobatidis Erica Bree Rosenblum a,b,1, Jason E. Stajich c, Nicole Maddox a, and Michael B. Eisen a,d
Chapters AP Biology Objectives. Objectives: You should know...
Objectives: You should know... Notes 1. Scientific evidence supports the idea that evolution has occurred in all species. 2. Scientific evidence supports the idea that evolution continues to occur. 3.
EVOLUTION change in populations over time
EVOLUTION change in populations over time HISTORY ideas that shaped the current theory James Hutton & Charles Lyell proposes that Earth is shaped by geological forces that took place over extremely long
BIOLOGY Grades Summer Units: 10 high school credits UC Requirement Category: d. General Description:
Summer 2015 Units: 10 high school credits UC Requirement Category: d General Description: BIOLOGY Grades 9-12 Summer session biology will be an intense, fast paced course. Students will gain an understanding
EVOLUTION change in populations over time
EVOLUTION change in populations over time HISTORY ideas that shaped the current theory James Hutton (1785) proposes that Earth is shaped by geological forces that took place over extremely long periods
BEFORE TAKING THIS MODULE YOU MUST ( TAKE BIO-4013Y OR TAKE BIO-
2018/9 - BIO-4001A BIODIVERSITY Autumn Semester, Level 4 module (Maximum 150 Students) Organiser: Dr Harriet Jones Timetable Slot:DD This module explores life on Earth. You will be introduced to the major
Valley Central School District 944 State Route 17K Montgomery, NY Telephone Number: (845) ext Fax Number: (845)
Valley Central School District 944 State Route 17K Montgomery, NY 12549 Telephone Number: (845)457-2400 ext. 18121 Fax Number: (845)457-4254 Advance Placement Biology Presented to the Board of Education
Warm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab
Date: Agenda Warm-Up- Review Natural Selection and Reproduction for quiz today!!!! Notes on Evidence of Evolution Work on Vocabulary and Lab Ask questions based on 5.1 and 5.2 Quiz on 5.1 and 5.2 How
AP Biology Essential Knowledge Cards BIG IDEA 1
AP Biology Essential Knowledge Cards BIG IDEA 1 Essential knowledge 1.A.1: Natural selection is a major mechanism of evolution. Essential knowledge 1.A.4: Biological evolution is supported by scientific
1 of 13 8/11/2014 10:32 AM Units: Teacher: APBiology, CORE Course: APBiology Year: 2012-13 Chemistry of Life Chapters 1-4 Big Idea 1, 2 & 4 Change in the genetic population over time is feedback mechanisms
Kingdom Fungi. Announcements
Kingdom Fungi Announcements Friday lab: Fungi & Lichen Bring a Lichen to ID! Do prelab Quiz #4 Friday Study Prokaryotes & Protists Mushroom Fest extra credit due Fri Email me or bring to lab Endosymbiosis
AP Biology Curriculum Framework
AP Biology Curriculum Framework This chart correlates the College Board s Advanced Placement Biology Curriculum Framework to the corresponding chapters and Key Concept numbers in Campbell BIOLOGY IN FOCUS,
EVOLUTION. HISTORY: Ideas that shaped the current evolutionary theory. Evolution change in populations over time.
EVOLUTION HISTORY: Ideas that shaped the current evolutionary theory. Evolution change in populations over time. James Hutton & Charles Lyell proposes that Earth is shaped by geological forces that took
Microbiota: Its Evolution and Essence. Hsin-Jung Joyce Wu "Microbiota and man: the story about us
Microbiota: Its Evolution and Essence Overview q Define microbiota q Learn the tool q Ecological and evolutionary forces in shaping gut microbiota q Gut microbiota versus free-living microbe communities
Workshop on Kingdom Fungi
Workshop on Kingdom Fungi by Dana Krempels Introduction Kingdom Fungi is an ostensibly monophyletic assemblage of ecologically important organisms that not only perform the vital function of decomposition,
Cladistics and Bioinformatics Questions 2013
AP Biology Name Cladistics and Bioinformatics Questions 2013 1. The following table shows the percentage similarity in sequences of nucleotides from a homologous gene derived from five different species
Comparative analysis of anti-bd bacteria from six Malagasy frog species of Ranomafana National Park
James Madison University JMU Scholarly Commons Senior Honors Projects, 2010-current Honors College Spring 2015 Comparative analysis of anti-bd bacteria from six Malagasy frog species of Ranomafana National
Course Descriptions Biology
Course Descriptions Biology BIOL 1010 (F/S) Human Anatomy and Physiology I. An introductory study of the structure and function of the human organ systems including the nervous, sensory, muscular, skeletal,
STRUCTURE, CHARACTERISTICS AND REPRODUCTION OF FUNGI I
STRUCTURE, CHARACTERISTICS AND REPRODUCTION OF FUNGI I Charles Okolie, PhD Room 311 (on level 4), First College Building, Landmark University, Omu-Aran, Kwara State, Nigeria. Internal Tel. extension: 4048
The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome. The minimal prokaryotic genome
Dr. Dirk Gevers 1,2 1 Laboratorium voor Microbiologie 2 Bioinformatics & Evolutionary Genomics The bacterial species in the genomic era CTACCATGAAAGACTTGTGAATCCAGGAAGAGAGACTGACTGGGCAACATGTTATTCAG GTACAAAAAGATTTGGACTGTAACTTAAAAATGATCAAATTATGTTTCCCATGCATCAGG
The Tempo of Macroevolution: Patterns of Diversification and Extinction
The Tempo of Macroevolution: Patterns of Diversification and Extinction During the semester we have been consider various aspects parameters associated with biodiversity. Current usage stems from 1980's
SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION. Using Anatomy, Embryology, Biochemistry, and Paleontology
SCIENTIFIC EVIDENCE TO SUPPORT THE THEORY OF EVOLUTION Using Anatomy, Embryology, Biochemistry, and Paleontology Scientific Fields Different fields of science have contributed evidence for the theory of
Evolutionary factors and synthetic biology
Evolutionary factors and synthetic biology NAS Joint Session on Climate Change and Ecology Owain Edwards Group Leader, Environmental Synthetic Genomics, CSIRO, Perth, Australia Domain Leader, Biocontrol
Essential knowledge 1.A.2: Natural selection
Appendix C AP Biology Concepts at a Glance Big Idea 1: The process of evolution drives the diversity and unity of life. Enduring understanding 1.A: Change in the genetic makeup of a population over time
HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS
HORIZONTAL TRANSFER IN EUKARYOTES KIMBERLEY MC GRAIL FERNÁNDEZ GENOMICS OVERVIEW INTRODUCTION MECHANISMS OF HGT IDENTIFICATION TECHNIQUES EXAMPLES - Wolbachia pipientis - Fungus - Plants - Drosophila ananassae
Properties of Life. Levels of Organization. Levels of Organization. Levels of Organization. Levels of Organization. The Science of Biology.
The Science of Biology Chapter 1 Properties of Life Living organisms: are composed of cells are complex and ordered respond to their environment can grow and reproduce obtain and use energy maintain internal
8/23/2014. Phylogeny and the Tree of Life
Phylogeny and the Tree of Life Chapter 26 Objectives Explain the following characteristics of the Linnaean system of classification: a. binomial nomenclature b. hierarchical classification List the major
VCE BIOLOGY Relationship between the key knowledge and key skills of the Study Design and the Study Design
VCE BIOLOGY 2006 2014 Relationship between the key knowledge and key skills of the 2000 2005 Study Design and the 2006 2014 Study Design The following table provides a comparison of the key knowledge (and
Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley
Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley B.D. Mishler Feb. 14, 2018. Phylogenetic trees VI: Dating in the 21st century: clocks, & calibrations;
SCOTCAT Credits: 20 SCQF Level 7 Semester 1 Academic year: 2018/ am, Practical classes one per week pm Mon, Tue, or Wed
Biology (BL) modules BL1101 Biology 1 SCOTCAT Credits: 20 SCQF Level 7 Semester 1 10.00 am; Practical classes one per week 2.00-5.00 pm Mon, Tue, or Wed This module is an introduction to molecular and
A population of organisms that can interbreed to produce fertile offspring is a(n) a. evolved population b. adaptive radiation c. niche d.
A population of organisms that can interbreed to produce fertile offspring is a(n) a. evolved population b. adaptive radiation c. niche d. species A population of organisms that can interbreed to produce
The Science of Biology. Chapter 1
The Science of Biology Chapter 1 Properties of Life Living organisms: are composed of cells are complex and ordered respond to their environment can grow and reproduce obtain and use energy maintain internal
How we study diversity: phylogenetic tree. Fungi vs. Animals. Fungi vs. Plants 3/8/18
Ya Yang yangya@umn.edu How we study diversity: phylogenetic tree Office Hours: Monday 10-12 AM 714 Biological Sciences Center Fungi are eukaryotic organisms that are more closely related to animals than
Big Idea 1: The process of evolution drives the diversity and unity of life.
Big Idea 1: The process of evolution drives the diversity and unity of life. understanding 1.A: Change in the genetic makeup of a population over time is evolution. 1.A.1: Natural selection is a major
Horizontal transfer and pathogenicity
Horizontal transfer and pathogenicity Victoria Moiseeva Genomics, Master on Advanced Genetics UAB, Barcelona, 2014 INDEX Horizontal Transfer Horizontal gene transfer mechanisms Detection methods of HGT
AP Curriculum Framework with Learning Objectives
Big Ideas Big Idea 1: The process of evolution drives the diversity and unity of life. AP Curriculum Framework with Learning Objectives Understanding 1.A: Change in the genetic makeup of a population over
Nature Genetics: doi: /ng Supplementary Figure 1. Icm/Dot secretion system region I in 41 Legionella species.
Supplementary Figure 1 Icm/Dot secretion system region I in 41 Legionella species. Homologs of the effector-coding gene lega15 (orange) were found within Icm/Dot region I in 13 Legionella species. In four
no.1 Raya Ayman Anas Abu-Humaidan
no.1 Raya Ayman Anas Abu-Humaidan Introduction to microbiology Let's start! As you might have concluded, microbiology is the study of all organisms that are too small to be seen with the naked eye, Ex:
Prereq: Concurrent 3 CH
0201107 0201101 General Biology (1) General Biology (1) is an introductory course which covers the basics of cell biology in a traditional order, from the structure and function of molecules to the structure
TE content correlates positively with genome size
TE content correlates positively with genome size Mb 3000 Genomic DNA 2500 2000 1500 1000 TE DNA Protein-coding DNA 500 0 Feschotte & Pritham 2006 Transposable elements. Variation in gene numbers cannot
AP Biology Notes Outline Enduring Understanding 1.B. Big Idea 1: The process of evolution drives the diversity and unity of life.
AP Biology Notes Outline Enduring Understanding 1.B Big Idea 1: The process of evolution drives the diversity and unity of life. Enduring Understanding 1.B: Organisms are linked by lines of descent from
Estimating Evolutionary Trees. Phylogenetic Methods
Estimating Evolutionary Trees v if the data are consistent with infinite sites then all methods should yield the same tree v it gets more complicated when there is homoplasy, i.e., parallel or convergent
UoN, CAS, DBSC BIOL102 lecture notes by: Dr. Mustafa A. Mansi. The Phylogenetic Systematics (Phylogeny and Systematics)
- Phylogeny? - Systematics? The Phylogenetic Systematics (Phylogeny and Systematics) - Phylogenetic systematics? Connection between phylogeny and classification. - Phylogenetic systematics informs the
Genetic Variation: The genetic substrate for natural selection. Horizontal Gene Transfer. General Principles 10/2/17.
Genetic Variation: The genetic substrate for natural selection What about organisms that do not have sexual reproduction? Horizontal Gene Transfer Dr. Carol E. Lee, University of Wisconsin In prokaryotes:
PHYLOGENY WHAT IS EVOLUTION? 1/22/2018. Change must occur in a population via allele
PHYLOGENY EXERCISE 1 AND 2 WHAT IS EVOLUTION? The theory that all living organisms on earth are related and have a common ancestor. These organism have changed over time and are continuing to change. Changes
Robust demographic inference from genomic and SNP data
Robust demographic inference from genomic and SNP data Laurent Excoffier Isabelle Duperret, Emilia Huerta-Sanchez, Matthieu Foll, Vitor Sousa, Isabel Alves Computational and Molecular Population Genetics
Course Syllabus. Department: Science and Technology. Date: February 3, I. Course Prefix and Number: BIO 122. Course Name: General Biology II
Department: Science and Technology Date: February 3, 2012 I. Course Prefix and Number: BIO 122 Course Name: General Biology II Course Syllabus Credit Hours and Contact Hours: 4 Credit hours and 5 Contact
Lecture 11 Friday, October 21, 2011
Lecture 11 Friday, October 21, 2011 Phylogenetic tree (phylogeny) Darwin and classification: In the Origin, Darwin said that descent from a common ancestral species could explain why the Linnaean system
Evidences of Evolution. Read Section 8.2 on pp of your textbook
Evidences of Evolution Read Section 8.2 on pp. 332 338 of your textbook There are 5 key evidences for evolution: 1. Fossil record 2. Biogeography 3. Anatomical evidence (homologous structures, vestigial
Phylogeny 9/8/2014. Evolutionary Relationships. Data Supporting Phylogeny. Chapter 26
Phylogeny Chapter 26 Taxonomy Taxonomy: ordered division of organisms into categories based on a set of characteristics used to assess similarities and differences Carolus Linnaeus developed binomial nomenclature,
Modeling Disease Transmission in Long-tailed Macaques on Bali
Modeling Disease Transmission in Long-tailed Macaques on Bali Kelly Lane Gerhard Niederwieser Ryan Kennedy University of Notre Dame Macaque Background Coexisted in temples across the island for at least
BIOLOGY YEAR AT A GLANCE RESOURCE ( )
BIOLOGY YEAR AT A GLANCE RESOURCE (2016-17) DATES TOPIC/BENCHMARKS QUARTER 1 LAB/ACTIVITIES 8/22 8/25/16 I. Introduction to Biology Lab 1: Seed Germination A. What is Biology B. Science in the real world
Invasion genomics and adaptation in Australian fireweed. Andrew Lowe Peter Prentis, Elly Dormontt University of Adelaide, Australia
Invasion genomics and adaptation in Australian fireweed Andrew Lowe Peter Prentis, Elly Dormontt University of Adelaide, Australia S. vulgaris var. vulgaris S. squalidus S. eboracensis Oliver Payne & Nick
The Prokaryotic World
The Prokaryotic World A. An overview of prokaryotic life There is no doubt that prokaryotes are everywhere. By everywhere, I mean living in every geographic region, in extremes of environmental conditions,
Computational Biology: Basics & Interesting Problems
Computational Biology: Basics & Interesting Problems Summary Sources of information Biological concepts: structure & terminology Sequencing Gene finding Protein structure prediction Sources of information
Campbell Biology AP Edition 11 th Edition, 2018
A Correlation and Narrative Summary of Campbell Biology AP Edition 11 th Edition, 2018 To the AP Biology Curriculum Framework AP is a trademark registered and/or owned by the College Board, which was not
BIOLOGY YEAR AT A GLANCE RESOURCE ( ) REVISED FOR HURRICANE DAYS
BIOLOGY YEAR AT A GLANCE RESOURCE (2017-18) REVISED FOR HURRICANE DAYS DATES TOPIC/BENCHMARKS QUARTER 1 LAB/ACTIVITIES 8/21 8/24/17 I. Introduction to Biology A. What is Biology B. Science in the real
CLASSIFICATION UNIT GUIDE DUE WEDNESDAY 3/1
CLASSIFICATION UNIT GUIDE DUE WEDNESDAY 3/1 MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 2/13 2/14 - B 2/15 2/16 - B 2/17 2/20 Intro to Viruses Viruses VS Cells 2/21 - B Virus Reproduction Q 1-2 2/22 2/23
Figure 1. Consider this cladogram. Let s examine it with all three species concepts:
Biology 1B Evolution Lecture 9 - Speciation Processes Species identification - the grey zone Figure 1 Consider this cladogram. Let s examine it with all three species concepts: For each species, we can
Enduring understanding 1.A: Change in the genetic makeup of a population over time is evolution.
The AP Biology course is designed to enable you to develop advanced inquiry and reasoning skills, such as designing a plan for collecting data, analyzing data, applying mathematical routines, and connecting
Biology II : Embedded Inquiry
Biology II : Embedded Inquiry Conceptual Strand Understandings about scientific inquiry and the ability to conduct inquiry are essential for living in the 21 st century. Guiding Question What tools, skills,
15.3 Darwin Presents his Case. Biology Mr. Hines
15.3 Darwin Presents his Case Biology Mr. Hines Darwin returned to England with a wealth of new data. He brought many specimens from the Galapagos to further his studies and to present his data to others.
Diseases of cacao in Colombia: What we know and what we need to know.
Diseases of cacao in Colombia: What we know and what we need to know. Bryan A. Bailey a, Shahin S. Ali a, Mary D. Strem a, Alina Campbell b, Osman GuAerrez b, Dapeng Zhang a, Lyndel W. Meinhardt a a Sustainable
California Biology Handbook... CA1
California Biology Handbook........................... CA1 The California Biology Handbook includes correlations of the Biology/Life Science standards to the content in Biology: The Dynamics of Life. Also
Bioinformatics. Dept. of Computational Biology & Bioinformatics
Bioinformatics Dept. of Computational Biology & Bioinformatics 3 Bioinformatics - play with sequences & structures Dept. of Computational Biology & Bioinformatics 4 ORGANIZATION OF LIFE ROLE OF BIOINFORMATICS
Phylogeny & Systematics: The Tree of Life
Phylogeny & Systematics: The Tree of Life An unexpected family tree. What are the evolutionary relationships among a human, a mushroom, and a tulip? Molecular systematics has revealed that despite appearances
Pathogenic fungi genomics, evolution and epidemiology! John W. Taylor University of California Berkeley, USA
Pathogenic fungi genomics, evolution and epidemiology! John W. Taylor University of California Berkeley, USA Adaptation! Divergence Divergence Adaptation Darwin 1859 Mendel 1866 1830 1850 1870 1890 1910
Predicting Protein Functions and Domain Interactions from Protein Interactions
Predicting Protein Functions and Domain Interactions from Protein Interactions Fengzhu Sun, PhD Center for Computational and Experimental Genomics University of Southern California Outline High-throughput
AP Biology Notes Outline Enduring Understanding 1.C. Big Idea 1: The process of evolution drives the diversity and unity of life.
AP Biology Notes Outline Enduring Understanding 1.C Big Idea 1: The process of evolution drives the diversity and unity of life. Enduring Understanding 1.C: Life continues to evolve within a changing environment.
Introduction. Abstract
Temperature alters reproductive life history patterns in Batrachochytrium dendrobatidis, a lethal pathogen associated with the global loss of amphibians Jamie Voyles 1,4, Leah R. Johnson 2,3, Cheryl J.
SPECIES OF ARCHAEA ARE MORE CLOSELY RELATED TO EUKARYOTES THAN ARE SPECIES OF PROKARYOTES.
THE TERMS RUN AND TUMBLE ARE GENERALLY ASSOCIATED WITH A) cell wall fluidity. B) cell membrane structures. C) taxic movements of the cell. D) clustering properties of certain rod-shaped bacteria. A MAJOR
Take a quiz to assess your understanding of the material. Due : 29 Jan 2015 Duration : 20 min Scoring : 20 Points Earned :
Biology Core Sem 2 Activity Points % of Total Discuss 75 4% Exam 100 6% Final Exam 100 6% Journal 100 6% Lab 250 14% Practice 125 7% Quiz 740 43% Test (CST) 250 14% Total Points for the Course : 1740 Unit
The Origin of Species
The Origin of Species What you need to know The difference between microevolution and macroevolution. The biological concept of species. Prezygotic and postzygotic barriers that maintain reproductive isolation
CHAPTERS 24-25: Evidence for Evolution and Phylogeny
CHAPTERS 24-25: Evidence for Evolution and Phylogeny 1. For each of the following, indicate how it is used as evidence of evolution by natural selection or shown as an evolutionary trend: a. Paleontology
Modes of Macroevolution
Modes of Macroevolution Macroevolution is used to refer to any evolutionary change at or above the level of species. Darwin illustrated the combined action of descent with modification, the principle of
Origins of Life. Fundamental Properties of Life. Conditions on Early Earth. Evolution of Cells. The Tree of Life
The Tree of Life Chapter 26 Origins of Life The Earth formed as a hot mass of molten rock about 4.5 billion years ago (BYA) -As it cooled, chemically-rich oceans were formed from water condensation Life
ZSL SCIENCE AND CONSERVATION EVENT. The Meeting Rooms, Zoological Society of London, Regent s Park, London NW1 4RY AGENDA
TUESDAY 13 MARCH 2018 ZSL SCIENCE AND CONSERVATION EVENT The Meeting Rooms, Zoological Society of London, Regent s Park, London NW1 4RY AGENDA Ecosystems under the microscope: why microbes matter for conservation
Fei Lu. Post doctoral Associate Cornell University
Fei Lu Post doctoral Associate Cornell University http://www.maizegenetics.net Genotyping by sequencing (GBS) is simple and cost effective 1. Digest DNA 2. Ligate adapters with barcodes 3. Pool DNAs 4.
COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry.
North Carolina Draft Standard Course of Study and Grade Level Competencies, Biology BIOLOGY COMPETENCY GOAL 1: The learner will develop abilities necessary to do and understand scientific inquiry. 1.01
A. Incorrect! In the binomial naming convention the Kingdom is not part of the name.
Microbiology Problem Drill 08: Classification of Microorganisms No. 1 of 10 1. In the binomial system of naming which term is always written in lowercase? (A) Kingdom (B) Domain (C) Genus (D) Specific
Readings Lecture Topics Class Activities Labs Projects Chapter 1: Biology 6 th ed. Campbell and Reese Student Selected Magazine Article
Unit Subtopics and Duration Unit 1: Principles of Science Themes in science Research and Lab techniques 6 days Readings Lecture Topics Class Activities Labs Projects Chapter 1: Biology 6 th ed. Campbell
An Integrated Approach for the Assessment of Chromosomal Abnormalities
An Integrated Approach for the Assessment of Chromosomal Abnormalities Department of Biostatistics Johns Hopkins Bloomberg School of Public Health June 6, 2007 Karyotypes Mitosis and Meiosis Meiosis Meiosis
Bio1B Evolution 12 Last lecture: Speciation: outcomes of secondary contact Fossil record - significance & interpretation (Ch 18)
Bio1B Evolution 12 Last lecture: Speciation: outcomes of secondary contact Fossil record - significance & interpretation (Ch 18) Today Extinction - Background extinction rates vs big 5 mass extinctions
The big 5 mass extinctions. The asteroid impact hypothesis - Luiz & Walter Alvarez, UC Berkeley (see Science, 5th March, p1214)
Bio1B Evolution 12 Last lecture: Speciation: outcomes of secondary contact Fossil record - significance & interpretation (Ch 18) Today Extinction - Background extinction rates vs big 5 mass extinctions
Alligator mississippiensis.
Alligator mississippiensis http://www.birdsasart.com/bn201.htm Core Case Study: Why Should We Care about the American Alligator? Largest reptile in North America 1930s: Hunters and poachers Importance
CAIMS 2018 Annual Meeting
CAIMS 2018 Annual Meeting June 4-7, 2018, Ryerson University, Toronto, Ontario, Canada Local Organizers: D. Delic, K. Georgiou, J.P. Pascal, K. Rohlf, K. Wilkie, F. Xanthos Department of Mathematics, Ryerson
Handling Fungal data in MoBeDAC
Handling Fungal data in MoBeDAC Jason Stajich UC Riverside Fungal Taxonomy and naming undergoing a revolution One fungus, one name http://www.biology.duke.edu/fungi/ mycolab/primers.htm http://www.biology.duke.edu/fungi/
Changing Planet: Changing Mosquito Genes
Changing Planet: Changing Mosquito Genes Name Background As the climate changes around the globe, organisms will need to adapt in order to survive. But what does it mean to adapt? When you put on a sweater
Only skin deep: shared genetic response to the deadly chytrid fungus in susceptible frog species
Molecular Ecology (2012) 21, 3110 3120 doi: 10.1111/j.1365-294X.2012.05481.x FROM THE COVER Only skin deep: shared genetic response to the deadly chytrid fungus in susceptible frog species ERICA BREE ROSENBLUM,*
Mechanisms behind the successful invasion of American Bullfrogs (Rana catesbeiana) in the Northwest United States
Mechanisms behind the successful invasion of American Bullfrogs (Rana catesbeiana) in the Northwest United States Tiffany Garcia, Rebbecca Hill, Sarah Abdulkarim, and Chris Funk Department of Fisheries
The Origin of Species
LECTURE PRESENTATIONS For CAMPBELL BIOLOGY, NINTH EDITION Jane B. Reece, Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Robert B. Jackson Chapter 24 The Origin of Species Lectures
California Subject Examinations for Teachers
California Subject Examinations for Teachers TEST GUIDE SCIENCE SUBTEST II: LIFE SCIENCES Subtest Description This document contains the Life Sciences subject matter requirements arranged according to
Piecing It Together. 1) The envelope contains puzzle pieces for 5 vertebrate embryos in 3 different stages of
Piecing It Together 1) The envelope contains puzzle pieces for 5 vertebrate embryos in 3 different stages of development. Lay out the pieces so that you have matched up each animal name card with its 3
Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium. November 12, 2012
Lecture 22: Signatures of Selection and Introduction to Linkage Disequilibrium November 12, 2012 Last Time Sequence data and quantification of variation Infinite sites model Nucleotide diversity (π) Sequence-based
Bio1B Evolution 12 Last lecture: Fossil record
Bio1B Evolution 12 Last lecture: Fossil record Fossil record - significance & interpretation Extinction - Background extinction rates and the big 5 mass extinction The K/T boundary - asteroid hypothesis;
Bio1B Evolution 13 Last lecture:
Bio1B Evolution 13 Last lecture: Macro-evolution (cont.) Mass extinctions Species selection Transitional forms - tetrapods, birds: exaptation Today Human evolution Evolutionary origins of Homo sapiens: