Biology 2. Lecture Material. For. Exam 1

Transcription

1 Biology 2 Macroevolution & Systematics 1 Biology 2 Lecture Material For Exam 1 Eukaryotes Halophiles Archaea Thermophiles Univeral Ancestor Methanogens Proteobacteria Chlamydia Bacteria Spirochetes Cyanobacteria Gram + Bacteria

2 Biology 2 Macroevolution & Systematics 2 Microevolution: Biological Species: Ring Species Allopatric Speciation: Evidence of: Favorable Conditions: Sympatric Speciation: Autopolyploidy: Allopolyploidy:

3 Biology 2 Macroevolution & Systematics 3 Hybrid Zones: Reinforcement: Fusion: Stability: Adaptive Radiation: The emergence of numerous species from a common ancestor introduced into an environment, presenting a diversity of new opportunities and problems

4 Biology 2 Macroevolution & Systematics 4 Macroevolution: Gradualism: Punctuated Equilibrium: Origin of Evolutionary Novelty Exaptation (preadaptation): Macroevolution through Major Changes in the Sequences and Regulation of Developmental Genes Effects of Developmental Genes Changes in Rate and Timing Changes in Spatial Patterns The Evolution of Development Changes in Gene Sequence Changes in Gene Regulation Effects of Developmental Genes: Evo-devo Changes in Rate and Timing: Allometric Growth:

5 Biology 2 Macroevolution & Systematics 5 Changes in Rate and Timing (cont.): Heterochrony: Paedeomorphosis: Paedeogenesis: Changes in Spatial Patterns: Homeotic Genes: Hox Genes:

6 Biology 2 Macroevolution & Systematics 6 Changes in Spatial Patterns (cont.): Homeobox: DNA, around 180 base pairs long, found within genes that are involved in the regulation of patterns of anatomical development. The Evolution of Genes Changes in Gene Sequences Changes in Gene Regulation

7 Biology 2 Macroevolution & Systematics 7 Evolutionary Trends: Species Selection (Steven Stanley): Size: Toe Reduction: Tooth shape/size: SYSTEMATICS: Comparing the genes or genomes of two species is the most direct measure of inheritance from shared ancestors. Comparisons can be made by using three methods: DNA-DNA hybridization, restriction maps, and DNA sequencing. Use the information to determine where species A through F belong in the phylogenetic tree. The information below is comparing the number of differences between an amino acid sequence from a blood protein found in rodents. (Assumption: The larger the number, the longer they have been separated from their common ancestor) A B C D E F A B C D E F

8 Biology 2 Macroevolution & Systematics 8 PHYLOGENETIC GROUPINGS: Monophyletic: Paraphyletic: Polyphyletic: Use the diagram below to identify whether the grouping is monophyletic, paraphyletic or polyphyletic. A B C D E F G H 1. A and B 2. A, B and C 3. D, E, and F 4. E, F, G and H 5. F, G, and H 6. E, F, and G SIMILARITIES Homology: Analogy: Molecular Homeoplasy:

9 Biology 2 Macroevolution & Systematics 9 ONTOGENY RECAPITULATES PHYLOGENY (Ernst Haekel) SYSTEMATICS: Classical Evolutionary (Linnaean) Systematics: Cladistics: Assumptions: Synapomorphies: Shared derived characters Plesiomorphies: Shared ancestral (primitive) characters

10 Biology 2 Macroevolution & Systematics 10 Parsimony:

11 Biology 2 Macroevolution & Systematics 11 Cladistic taxonomy and classical evolutionary taxonomy are different methods of interpreting phylogenetic data and classifying organisms. Read each statement below and check whether it relates to the cladistic approach, the classical approach, or both. Cladistic Classical 1. Method of classifying organisms and reconstructing phylogeny 2. Concerned only with the order of branching lineages 3. Produces cladograms 4. Concerned with branching and degree of divergence 5. Differentiates between primitive and derived characters 6. Puts lizards and crocodiles in one class, birds in another 7. Becoming more popular with researchers 8. Says birds are closer to crocodiles than to other reptiles 9. Uses anatomy and molecular biology to determine relationship 10. Places humans in the same family as some other apes 11. Places humans in their own family, separate from apes 12. The approach used 15 years ago 13. Considered to be more objective approach 14. Involves subjective judgements about divergence

12 Biology 2 Macroevolution & Systematics 12 Cladogram In cladistics, similar characteristics that come from a common ancestor are used to divide organisms into groups. A cladogram will begin by grouping organisms based on a characteristic displayed by all the members of the group. Subsequently, the larger group, or clade, will contain increasingly smaller groups (clades) that share the traits of the clades before them, but also exhibit distinct changes as the organism evolves. Draw a cladogram of the organisms below. (a 0 means the organism lacks that characteristic and a 1 means the organism has that characteristic present) Characteristics: no (0), yes (1) 1 is eukaryotic 2 is multicellular 3 has segmented body 4 has jaws 5 has limbs 6 has hair 7 has placenta

13 Biology 2 Macroevolution & Systematics 13 Cladistic Analysis of a DNA Sequence The study group below is an example of three species of chameleons, two from Madagascar and one for Equatorial Guinea. The outgroup is a lizard that is a distant relative of chameleons. The question is are the two Madagascan species (genus: Brookesia) really more closely related to each other over one being more closely related to the Equatorial Guinea species (Chamaeleo). The information below is from a piece of mitochondrial DNA sequence which encodes an amino acid of a protein called NADH dehydrogenase subuit 2. Uromastyx B. theili B. brygooi C. feae AAACCTTAAAAGACACCACAACCATATGAACAACAACACCAACAATCAGCACACTAC AAACACTACAAAATATAACAACTGCATGAACAACATCAACCACAGCAAACATTTTAC AAACACTACAAGACATAACAACAGCATGAACTACTTCAACAACAGCAAATATTACAC AAACCCTACGAGACGCAACAACAATATGATCCACTTCCCCCACAACAAACACAATTT Possible Cladograms B. theili 1. B. brygooi Number of changes C. feae 2. B. brygooi C. feae Number of changes B. theili 3. B. theili C. feae Number of changes B. brygooi

14 Biology 2 Macroevolution & Systematics 14 BACTERIA LECTURE Bacteria Characteristics: Nucleoid Region: No Membrane-bound Organelles: Ribosomes: Plasma Membrane: Cell Wall: Capsule: Flagella: Fimbriae: Pili: Asexual Reproduction:

15 Biology 2 Macroevolution & Systematics 15 Genetic Recombination: Transformation: Transduction: Conjugation: Classification: Shape Gram stain reaction Oxygen requirements Feeding strategies

16 Biology 2 Macroevolution & Systematics 16 Shapes: Gram-Stain: Gram Positive: Gram Negative: Oxygen Requirements: Obligate aerobes: Obligate anaerobes: Facultative anaerobes:

17 Biology 2 Macroevolution & Systematics 17 Feeding Strategies: Feeding Strategy Photoautotrophs Chemoautotrophs Photoheterotrophs Chemoheterotrophs Energy Source Carbon Source Nitrogen Metabolism: Heterocysts: Classification: Bacteria Archaea

18 Biology 2 Macroevolution & Systematics 18 Classification: Group: Proteobacteria Examples: Salmonella Characteristics: Shape: Gram Stain: Oxygen Requirement: Others: Group: Chlamydias Group: Spirochetes E. Coli Chlamydia Treponema pallidum Borrelia burgdorferi Shape: Gram Stain: Oxygen Requirement: Others: Shape: Gram Stain: Oxygen Requirement: Others: Shape: Gram Stain: Oxygen Requirement: Others: Shape: Gram Stain: Oxygen Requirement: Others

19 Biology 2 Macroevolution & Systematics 19 Group: Cyanobacteria Oscillatoria Shape: Gram Stain: Oxygen Requirement: Others: Group: Grampositive bacteria Clostridium Shape: Gram Stain: Oxygen Requirement: Others: Bacillus Anthracis Streptococcus Shape: Gram Stain: Oxygen Requirement: Others: Shape: Gram Stain: Oxygen Requirement: Others: Staphylococcus Shape: Gram Stain: Oxygen Requirement: Others: Domain: Archaea Methanogens Halophiles Thermophiles

20 Biology 2 Macroevolution & Systematics 20 Pathogens: Koch s Postulates: Bioremediation: Virus Structure: Viral Replication:

21 Biology 2 Macroevolution & Systematics 21 Virus Genome Structure: Bacteriophages: Lytic and Lysogenic Cycles: HIV Complex: Treatment:

22 Biology 2 Macroevolution & Systematics 22 Protista Lecture Characteristics: Protozoa: Algae: Fungi-like Origin of Eukaryotes Autogeneous: Endosymbiotic: Secondary Endosymbiosis:

23 Biology 2 Macroevolution & Systematics 23 Phylogeny of Eukarya: LUCA: MESS: Classification: Alveolata Stramenopila Rhizaria Amoebozoans Opisthokonts

24 Biology 2 Macroevolution & Systematics 24 Classification of Protista Supergroup: Excavata S. Characteristics: Clade2 Diplomonads C2. Characteristics Parabasalids Clade2 C2. Characteristics Clade3 C3. Characteristics Euglenozoans Euglenids Kinetoplastids

25 Biology 2 Macroevolution & Systematics 25 Supergroup: SAR S. Characteristics: Clade1 C1. Characteristics Clade2 C2. Characteristics: Alveolates Dinoflagellates Apicomplexans Ciliates Stramenopila Diatoms (Bacillariophyta) Golden Algae (Chrysophyta) Brown Algae (Phaeophyta) Oomycetes

26 Biology 2 Macroevolution & Systematics 26 Supergroup: SAR S. Characteristics: Rhizaria Clade2 C2. Characteristics: Foraminiferans Radiolarians Supergroup: Archaeplastida S. Characteristics Clade2 Red Algae (Rhodophyta) C2. Characteriscs: Chlorophytes Charophytes

27 Biology 2 Macroevolution & Systematics 27 Supergroup: Unikonta S. Characteristics: Clade1 C1. Characteristics Clade2 C2. Characteristics: Amoebozoans Slime Molds Clade3 Plasmodial C3 Characteristics Cellular Gymnamoebas Entamoebas Opisthokonts Nucleariids Choanoflagellates

28 Biology 2 Macroevolution & Systematics 28 FUNGI LECTURE Evolution: General Characteristics: Animal-like Characteristics:

29 Biology 2 Macroevolution & Systematics 29 Fungal Reproduction: Asexual: Sexual: Plasmogamy: Karyogamy: Syngamy: Fungal Classification: Division: Chytrids:

30 Biology 2 Macroevolution & Systematics 30 Division: Zygomycota:

31 Biology 2 Macroevolution & Systematics 31 Division: Glomeromycota Arbuscular Mycorrhizae Division: Ascomycota

32 Biology 2 Macroevolution & Systematics 32 Division: Basidiomycota Microsporidia Lichens: Ecological Impacts: