Name 2015-Biology Final Exam STUDY GUIDE

Transcription

1 Name 2015-Biology Final Exam STUDY GUIDE Chapter 10 - Cell Growth and Division Describe why cells divide instead of growing larger o DNA overload -Problem: o Surface area:volume ratio-problem: o Division resolves these two problems by: Describe the relationship between chromatin, chromosomes, sister chromatids, and centromeres o Chromatin: o Chromosomes: o Sister chromatids: o Centromere: Define mitosis and cytokinesis o Mitosis: Four phases: o Cytokinesis: Describe the role of the centrioles and the spindle o Spindle: helps separate chromosomes o Centrioles:

2 Describe what happens at each phase of the cell cycle & be able to recognize pictures of interphase, prophase, metaphase, anaphase, and telophase Interhase Prophase Metaphase Anaphase Telophase Cytokinesis Describe what happens when a cell cannot control its rate of division o When a cell cannot control its rate of division, this is known as: o Caused by Chapter 11 Introduction to Genetics Genetic terms ( give Examples) o Heterozygous o Homozygous o Hybrid o Allele o Trait o Phenotype o Genotype

3 Define meiosis and explain why we need it to occur o Meiosis: o Involves 2 divisions: o Need to occur so cells can be made each one unique from other o are produced Define homologous chromosomes Distinguish between diploid cells and haploid cells o Diploid: o Haploid: Describe crossing over o Crossing-over: o Takes place during: Describe the end result of meiosis o Discuss how meiosis increases genetic variation o Describe the similarities and differences between mitosis and meiosis o Differences o Similarities

4 Describe Mendel s conclusions (principle of dominance, principle of segregation, principle of independent assortment) o : states that some alleles of dominant and others recessive, e.g., an allele for tallness from the tall parent and an allele for shortness from the short parent o : genes for different traits can segregate independently during the formation of gametes o :separation of alleles during gamete formation o Used pea plants to study inheritance of traits Know how to determine genotype and phenotype Genotype: 1. example Phenotype: 1. example: Distinguish between heterozygous and homozygous genotypes Heterozygous example: Homozygous example: Punnett squares use mathematical probability to help predict genotype/phenotype combinations in genetic crosses Know how to work through a Punnett square problem (1 factor cross 4 squares) Example G = Green g= yellow -phenotype ratio (green:yellow) genotype ratio (GG:Gg:gg) G g G g

5 Describe inheritance patterns that exist aside from simple dominance incomplete dominance multiple alleles codominance polyenic traits Be able to work Punnett square problems for incomplete dominance, multiple alleles, and codominance Chapter 12 & 13 DNA and RNA Summarize the relationship between genes and DNA o Experiment->concluded the transforming factor is a gene because disease inherited by offspring of bacteria-> which lead to Avery s experiment-> where DNA was proven the transforming factor because no transformation occurred when breaking down DNA-> which lead to experiment-> the genetic material is DNA, not protein o Key Roles of DNA: Describe the contributions of scientist ; Built 3D molecular model of the Double Helix - 2 strands of nucleotide sequences wound around each other s x-ray diffraction image of DNA was used to determine the physical structure of DNA o Shown copy of X-ray, clues in pattern helped Watson/Crick to build model explaining specific structure/properties of DNA Describe the overall structure of the DNA molecule o Chemical components of DNA: nucleic acid made up of joined into long strands by covalent bonds o Nucleotides: build blocks of nucleic acids which are made up of: 5-carbon sugar called, a phosphate group, a nitrogenous base (,,, or )

6 o Nucleotides joined by covalent bonds formed between sugar of one nucleotide and phosphate group of next one o Double-helix model Explains Chargaff s rule of base pairing and how 2 strands of DNA are held together Observation proved rule that [A]=[ ] and [G]=[ ] Tells how DNA can function as genetic carrier o Two strands! o bonds form between bases of opposite strands, providing enough force to hold 2 bases together but weak enough to be broken during replication Summarize the events of DNA replication o Process of Replication RNA o Contains the base and the sugar Describe the differences between DNA and RNA o Sugar in RNA is in DNA it is deoxyribose o RNA is and DNA is double-stranded o RNA contains uracil in place of DNA s thymine Describe the similarities in both DNA and RNA o o Describe the function of the 3 types of RNA o : carries instructions for polypeptide synthesis from nucleus to ribosomes in the cytoplasm (single stranded) o : forms an important part of both subunits of the ribosomes where proteins are assembled o : carries amino acids to ribosome and matches them to the coded mrna message

7 Protein Synthesis involves messenger RNA, Protein ribosomal RNA, and transfer RNA o Transcription Describe what happens: What is produced at the end? o Translation Describe what happens: What is produced at the end? o Amino Acid: building blocks of proteins : long chain of amino acids that makes proteins. Protein: formed from Polypeptide & determine appearance & function of cell & organism Example: DNA sequence: T A C CGTCTCGTATTGTACGCTGCAACT Transcribe: Translate: Describe the different types of point mutations and how they affect the amino acid sequence o Mutations: o involves a single nucleotide mutation Affect one nucleotide or a few nucleotide Include substitutions, insertions, and deletions Substitutions: one base is replaced by another. Changes only one amino acid mutations Involves the deletion or the insertion of a base Remember sequence read in groups of three so when you add or delete a base, change reading frame of the genetic message Changing every amino acid after that point

8 o Chromosomal mutations: Inversion Deletion Duplication Tranlocation Chapter 14 The Human Genome Know how to read pedigrees and determine pattern of inheritance and genotypes of individuals from info given Define karyotype and distinguish between sex chromosome and autosomes o Karyotype: o Sex Chromosome: o Autosome: Explain how sex is determined o Sex Chromosomes: 46,XX, female/ 46,XY, male o Females have copies of the X chromosome; males have one X and one Y chromosome o Probability of a human sperm will carry an X chromosome is Know Human blood type genotypes and phenotypes o Sample problem: A woman with type A blood marries a man with AB blood type. What are the possible blood type for their children if the woman is homozygous for her type A blood. Draw punnett square, state genotypic and phenotypic ratios Sex-linked genes: Describe some sex-linked disorders and explain why they are more common in males than in females o o o Male only receives sex-linked alleles from his o Male needs copy of the sex-linked allele to exhibit the recessive trait o Female must inherit recessive alleles one from each parent to exhibit the trait

9 o -Sample problem: A woman with normal vision who s father was colorblind wants to have children with a man with normal vision. Do a punnet square to show the cross and the possible genotypes and phenotypes of their children. Define nondisjunction and explain how it results in chromosomal disorders o Nondisjunction: down syndrome turner s syndrome klinefelter s syndrome Chapter 16 - Evolution Describe the pattern Darwin, who developed the theory of evolution observed organisms of the Galapagos Islands o Species vary globally Noticed that different,, animals species inhabited separated, but ecologically similar, habitats around the globe Organisms well suited to environment Puzzled by where different species lived is change in species over time o Species vary locally Noticed that different, yet related, animal species often occupied different habitats within a local area Isabela Island Tortoise: hard shell, short neck, yellower, food a lot & close to ground Hood Island Tortoise: natural selection led to the physical changes in the Tortoise s shells curved, open around long necks, reach island s scarce food, dinosaur hands Tortoise use neck to reach vegetation is an example of a species adapting to the environment o Species change over time Noticed that some fossils of extinct animals were similar to living species Fossils: Geological forces. Ex: seasons lately off, more natural disasters, Japan Earthquake, earth still changing

10 Discuss the theories that shaped Darwin s thinking, including those of Hutton and Lyell, Lamarck and Malthus o Hutton and Lyell Concluded that : o Lamarck Hutton presented his hypotheses about how geological processes shaped the Earth Connected number of geological process & features Deep time: idea that our planet s history stretches so long ago that difficult for mind to imagine o Influenced Darwin deep time enough time for natural selection to act=descent with modification/common descent Lyell published Principles of Geology with all his ideas Helped Darwin understand significance of Earthquake in South America which lifted the rocky shoreline, meters out of the sea observing fossils in below sea level rocks that could be made into mountains Suggested organisms could change during lifetimes by selectively using or not using various parts of bodies (wrong!) Suggested individuals could pass acquired traits on to offspring, enabling species to change overtime (right!) States that new organs in species appear as result of actions of organisms as use/fail to use body structures Inheritance of acquired traits: traits you could get during your lifetime that could be passed onto offspring (inaccurate!) *Today we know it s traits that get passed on o Malthus Reasoned that if human population grew unchecked, there wouldn t be enough living space & food for all Helped Darwin to create the survival of the fittest showing how the human population would eventually die out, things can t survive/reproduce

11 Describe how natural variation is used in artificial selection o Nature provide variations, humans select those find useful o Artificial selection: o Darwin recognized that natural variation provided raw material for evolution o Ex: Explain how natural selection is related to species fitness o Fitness: Adaptations suited to environment can survive/produce fitness Adaptations not suited to environment die/low offspring fitness Survival of the fittest: o Results: o Fossil Record All fossil evidence, taken together, shows how organisms have changed Shows how organisms change over time, in timeline Many recently discovered fossils form series that trace the evolution of modern species from extinct ancestors Challenging: missing species, knowing which ones related to each other, but so different, confuse similar organisms with each other, use bones: which could decay & don t know everything about organism from bones o Anatomy : structures in related organisms that have been inherited from common ancestor Evolutionary theory explains the existence of these adapted to different purposes as result of descent with modification from common ancestor : structure that is inherited from ancestors but is no longer used and reduced in size (support not by Darwin) Example: o Embryology Vertebrate embryos show similar pattern of development Patterns of embryological development provide further evidence that organisms have descended from common ancestor

12 o Molecular Biology All living things share the same basic DNA The more DNA in common, the closely related 2 things are Approximate 98.8% of DNA is same in humans and chimps At molecular level, universal genetic code & homologous molecules provide evidence of common decent to trace evolution State Darwin s theory of evolution by natural selection : o Named process of evolution natural selection because similar to artificial selection o More individuals are born than can survive (struggle for existence) o Natural heritable (variation & adaptation) Some variants better suited to environment than others Successful adaptations increase survival chance Adaptation: o Variable fitness among individuals (survival of fittest) Realized that measure of success for organism not only survival, but also Chapter 17 Evolution of Populations Explain the term gene pool o Gene pool: Identify the main sources of inheritable variation in a population o Produce changes in phenotype affect fitness If cause genetic diseases=lethal, lower fitness by decreasing individual s ability to survive & reproduce or increase this o Genetic Recombination in Sexual Reproduction: Chromosomes sort independently Heritable differences are due not to mutation but to genetic recombination or gene shuffling during meiosis I

13 Paired chromosomes swap lengths of DNA at random during meiosis Increases # of new genotypes created in each generation Members of species different one and other ending up with traits from both parents Describe genetic drift, describing the founder effect as an example o Genetic drift: : changes in allele frequencies as result of migration of small subgroup of population Lead to changes in a gene pool because population because # of individuals from a parent population may create a new population, carry alleles in other frequencies than the parent population, new pool has different frequencies than the original Explain how natural selection affects single-gene and polygenic traits o Selection on Single gene traits Lead to changes in allele frequencies and to changes in phenotype frequencies o Selection on traits Affect relative fitness of phenotypes and produce one of 3 types of selection : form of natural selection in which individuals at one end of distribution curve have higher fitness than individuals near middle of curve : form of natural selection in which individuals near center of distribution curve have higher fitness than individuals at either end of curve : Describe the Hardy-Weinberg principle and list the five conditions needed to maintain genetic equilibrium o Genetic equilibrium: o Hardy-Weinberg principle: allele frequencies in population will remain constant unless 1 or more factors cause frequencies to change, what equilibrium looks like & what prevents it

14 o 5 conditions to maintain for genetic equilibrium of Hardy-Weinberg principle 1. Random mating Describe speciation; define species o Species: o Speciation: Describe reproductive isolation and describe the three isolating mechanisms o Reproductive isolation: 1. Courtship, mating, what attracts them, behaviors Temporal Isolation Define allele frequency and calculate allele frequency o Allele frequency: o Calculate allele frequency Frequency of dominant B allele is 40%, and frequency of recessive b allele is ; nothing to do with dominance, recessive occurs more frequently than dominant Chapter 19 History of Life The Fossil Record The Fossil Record shows the structure of ancient organisms, their environment and lived and are now extinct. Most sedimentary rocks form when sediments settle to the bottom of a body of water. Radiometric Dating uses the proportion of radioactive isotopes to find the absolute age of a sample. Carbon 14 has a half-life of years before it decays and can be used to accurately date fossils.

15 Describe the basic path of evolution of life on Earth 1. Organic Compounds Mainly made of: Carbon dioxide, nitrogen, & water vapor Lesser compounds of: Carbon monoxide, hydrogen sulfide, & hydrogen cyanide Contained little or NO s Experiment: suggested how mixtures of organic compounds necessary for life arisen from simpler compounds on early Earth, recreated early Earth atmosphere & passed electric spark into environment 2. Microspheres Cell membrane formed 1 st genetic material proved to be RNA Needed for life: Genetic material & microsphere

16 3. Prokaryotic cells with RNA Unicellular organisms without a nucleus years ago -fossils show presence of prokaryotic (single-celled) cells = modern bacteria Formed in absence of oxygen 4. Photosynthetic Organisms Evolved from mutations, produced oxygen Accumulated water then saturated into atmosphere Formed ozone layer in atmosphere 5. Eukaryotic cells Endosymbiotic Theory: Formation mitochondria: able to use oxygen to generate ATP Formation chloroplasts: ability to photosynthesize 6. Sexual Reproduction Genetic variation: genetic info of offspring comes from two parent, only way to get variety mutations Speed up rate of evolution b/c increases generic variation (at larger level have more opportunity to create better varieties) 7. Multicellular Organisms Underwent series of adaptive radiations, results: genetic diversity Advantage: cell specialization, so not all of DNA is used at same Describe mass extinction and adaptive radiation(divergent evolution) o Mass extinction: o Adaptive Radiation: Example:

17 Chapter 18 Classification Explain how living things are organized to study o What is taxonomy? a taxon? o Kingdom, phylum, class, order, family, genus, species o binomial nomenclature o Phylum Chordata (think of some sample organisms) o What is a cladogram? How do you find common ancestry? Binomial nomenclature o Developed by Carolus Linnaeus o Two part scientific name, in Latin known as o Genus (group of closely related) species (unique).organisms must be classified under genus must be in the same phylum, but may be different. Describe the 3-domain system of classification o Domain : Kingdom Protista, Fungi, Plantae, Animalia: eukaryotic, multicellular o Domain : Kingdom Eubacteria: prokaryotic, unicellular without a nucleus o Domain : Kingdom Archaeabacteria: prokaryotic, unicellular