Section 4 Professor Donald McFarlane

Size: px
Start display at page:

Download "Section 4 Professor Donald McFarlane"

Transcription

1 Characteristics Section 4 Professor Donald McFarlane Lecture 11 Animals: Origins and Bauplans Multicellular heterotroph Cells lack cell walls Most have nerves, muscles, capacity to move at some point in the life cycle Ability to reproduce sexually Specialized sensory structures and nervous system 2 Traditional classifications Most biologists agree kingdom is monophyletic About 35 recognized animal phyla Most likely ancestor a colonial flagellated protist similar to choanoflagellates Some are colonial Some cells my have taken on specialized functions Choanoflagellate cell Sponge cell (choanocyte) 3 (a) Colonial choanoflagellate (b) Sponge 4 1

2 Traditional classification based on body plans 4 main morphological and developmental features used 1. Presence or absence of different tissue types 2. Type of body symmetry 3. Presence or absence of a true body cavity 4. Patterns of embryonic development 1. Tissues Metazoa - all animals Divided into Parazoa (no specialized tissues or organs) Porifera sponges Eumetazoa (more than one type of tissue and organs) Symmetry Eumetazoa are radially symmetrical (Radiata) or bilaterally symmetrical (Bilateria) Bilateral animals have cephalization and dorsal and ventral ends 3 germ layers Radial animals have oral and aboral sides 2 germ layers 7 8 2

3 Number of cell layers Bilateria are triplobalstic 3 layers Radiata are diploblastic 2 layers Cell layers develop during gastrulation Inner layer endoderm Outer layer ectoderm Mesoderm - 3 rd layer in bilateral animals Forms muscles and most other organs 9 10 Blastula (hollow ball) 8-cell stage 8-cell stage

4 Endoderm Archenteron Blastula (hollow ball) Blastula (hollow ball) Ectoderm 8-cell stage Gastrulation Gastrula Mesoderm Blastopore 8-cell stage Gastrulation Body cavity True coelom body cavity is completely lined with mesoderm (coelomates) Pseudocoelom coelom is not completely lined by tissue derived from mesoderm (pseudocoelomates) Acoelomates lack a body cavity entirely Fluid-filled body cavity can protect internal organs or be used as hydrostatic skeleton

5 4. Embryonic development Protostome Spiral cleavage determinate Blastopore becomes mouth Deuterostome Radial cleavage is indeterminate- pluripotent stem cells Blastopore becomes anus Other methods of classification Possession of exoskeleton Development of notochord Presence or absence of segmentation Traced to changes in homeotic or Hox genes

6 Changes in Hox Gene Expression Control Body Segment Specialization Hox genes involved in pattern formation in early embryos. Relatively simple changes in the expression patterns of these genes can account for the large variation in arthropod appendage types Hox genes designated 1-13 Shifts in patterns of gene expression in the embryo along the anteroposterior axis govern transition from one type of vertebra to another and short or long necks Mice, chicken, goose, and snake Illustrates descent with modification GAGGTTCGAAGACGATCAGATACCGTCGTAGTTCCGACCATAAACGATG Sponge GAGGTTCGAAGACGATCAGAT ACCGTCGTAGTTCCAACCATAAACGATG Flatworm GAGGTTCGAAGACGATCAGAT ACCGTCGTAGT TCTGACCATAAACGATG Seagull GGGGATCAAAGACGATCAGAT ACCGTCGTAGTCTTAACTATAAACT ATA Paramecium KEY Identical in all four species Identical in two or three species Dissimilar in one animal species Dissimilar in the protist Fig

7 Similarities between traditional and molecular phylogeny 1. The clade called Metazoa is monophyletic, meaning all animals came from a single common ancestor. 2. At the earliest stages of evolution, molecular phylogeny supports the traditional view of the split between Parazoa and Eumetazoa. 3. There is also agreement about an early split between Radiata and Bilateria, with most animal phyla belonging to the Bilateria. 4. Molecular phylogeny also agrees that the echinoderms and chordates belong to a clade called the Deuterostomia. 2 additional key differences between traditional and molecular phylogeny 1. Relationships among Bilateria 2. Presence or absence of a body cavity

Outline. v Definition and major characteristics of animals v Dividing animals into groups based on: v Animal Phylogeny

Outline. v Definition and major characteristics of animals v Dividing animals into groups based on: v Animal Phylogeny BIOSC 041 Overview of Animal Diversity: Animal Body Plans Reference: Chapter 32 Outline v Definition and major characteristics of animals v Dividing animals into groups based on: Body symmetry Tissues

More information

v Scientists have identified 1.3 million living species of animals v The definition of an animal

v Scientists have identified 1.3 million living species of animals v The definition of an animal Biosc 41 9/10 Announcements BIOSC 041 v Genetics review: group problem sets Groups of 3-4 Correct answer presented to class = 2 pts extra credit Incorrect attempt = 1 pt extra credit v Lecture: Animal

More information

Biosc 41 9/10 Announcements

Biosc 41 9/10 Announcements Biosc 41 9/10 Announcements v Genetics review: group problem sets Groups of 3-4 Correct answer presented to class = 2 pts extra credit Incorrect attempt = 1 pt extra credit v Lecture: Animal Body Plans

More information

8/23/2014. Introduction to Animal Diversity

8/23/2014. Introduction to Animal Diversity Introduction to Animal Diversity Chapter 32 Objectives List the characteristics that combine to define animals Summarize key events of the Paleozoic, Mesozoic, and Cenozoic eras Distinguish between the

More information

Chapter 32, 10 th edition Q1.Which characteristic below is shared by plants, fungi, and animals? ( Concept 32.1)

Chapter 32, 10 th edition Q1.Which characteristic below is shared by plants, fungi, and animals? ( Concept 32.1) Chapter 32, 10 th edition Q1.Which characteristic below is shared by plants, fungi, and animals? ( Concept 32.1) A) They are multicellular eukaryotes. B) They are heterotrophs. C) Their cells are supported

More information

Animal Diversity. Features shared by all animals. Animals are multicellular, heterotrophic eukaryotes with tissues that develop from embryonic layers

Animal Diversity. Features shared by all animals. Animals are multicellular, heterotrophic eukaryotes with tissues that develop from embryonic layers Animal Diversity Animals are multicellular, heterotrophic eukaryotes with tissues that develop from embryonic layers Nutritional mode Ingest food and use enzymes in the body to digest Cell structure and

More information

An Introduction to Animal Diversity

An Introduction to Animal Diversity Chapter 32 An Introduction to Animal Diversity PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

An Introduction to Animal Diversity

An Introduction to Animal Diversity Chapter 32 An Introduction to Animal Diversity PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Overview: Welcome to Your Kingdom The animal kingdom

More information

An Introduction to Animal Diversity

An Introduction to Animal Diversity Chapter 32 An Introduction to Animal Diversity PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

Chapter 32 Introduction to Animal Diversity. Copyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings

Chapter 32 Introduction to Animal Diversity. Copyright 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings Chapter 32 Introduction to Animal Diversity Welcome to Your Kingdom The animal kingdom extends far beyond humans and other animals we may encounter 1.3 million living species of animals have been identified

More information

1. General Features of Animals

1. General Features of Animals Chapter 32: An Overview of Animal Diversity 1. General Features of Animals 2. The History of Animals 1. General Features of Animals General Characteristics of Animals animals are multicellular eukaryotic

More information

BIOLOGY. Chapter 27 Introduction to Animal Diversity

BIOLOGY. Chapter 27 Introduction to Animal Diversity BIOLOGY Chapter 27 Introduction to Animal Diversity Fig. 32-1 An Overview of Animal Diversity Multicellular Nutrition mode: Heterotrophic (ingestion) Cell structure & specialization Tissues develop from

More information

BIOLOGY - CLUTCH CH.32 - OVERVIEW OF ANIMALS.

BIOLOGY - CLUTCH CH.32 - OVERVIEW OF ANIMALS. !! www.clutchprep.com Animals are multicellular, heterotrophic eukaryotes that feed by ingesting their food Most animals are diploid, and produce gametes produced directly by meiosis Animals lack cell

More information

Animal Diversity. Animals are multicellular, heterotrophic eukaryotes with tissues that develop from embryonic layers 9/20/2017

Animal Diversity. Animals are multicellular, heterotrophic eukaryotes with tissues that develop from embryonic layers 9/20/2017 Animal Diversity Chapter 32 Which of these organisms are animals? Animals are multicellular, heterotrophic eukaryotes with tissues that develop from embryonic layers Animals share the same: Nutritional

More information

ANIMAL DIVERSITY AND THE EVOLUTION OF BODY PLANS

ANIMAL DIVERSITY AND THE EVOLUTION OF BODY PLANS ANIMAL DIVERSITY AND THE EVOLUTION OF BODY PLANS GENERAL FEATURES OF ANIMALS Heterotrophy - obtain energy and organic molecules by ingesting other organisms Multicellularity - Many have complex bodies

More information

Animal Origins and Evolution

Animal Origins and Evolution Animal Origins and Evolution Common Features of Animals multicellular heterotrophic motile Sexual reproduction, embryo Evolution of Animals All animals are multicellular and heterotrophic, which means

More information

Introduction to Animal Diversity Lecture 7 Winter 2014

Introduction to Animal Diversity Lecture 7 Winter 2014 Introduction to Animal Diversity Lecture 7 Winter 2014 Evolution of Animals 1 Prokaryotes Eukaryotes Prokaryotes No nucleus Nucleoid region Simple No membrane bound organelles Smaller (1-5 nm) Evolutionarily

More information

BIOLOGY. An Introduction to Animal Diversity CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson

BIOLOGY. An Introduction to Animal Diversity CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 32 An Introduction to Animal Diversity Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick A Kingdom of Consumers

More information

Chapter 32 Introduction to Animal Diversity

Chapter 32 Introduction to Animal Diversity Chapter 32 Introduction to Animal Diversity Review: Biology 101 There are 3 domains: They are Archaea Bacteria Protista! Eukarya Endosymbiosis (proposed by Lynn Margulis) is a relationship between two

More information

BIOLOGY. An Overview of Animal Diversity CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson

BIOLOGY. An Overview of Animal Diversity CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 32 An Overview of Animal Diversity Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick Concept 32.1: Animals are

More information

What Is an Animal? Section 25.1 Typical Animal Characteristics. I. Characteristics of Animals. Biology II Mrs. Michaelsen

What Is an Animal? Section 25.1 Typical Animal Characteristics. I. Characteristics of Animals. Biology II Mrs. Michaelsen What Is an Animal? Section 25.1 Typical Animal Characteristics Biology II Mrs. Michaelsen I. Characteristics of Animals A. All animals are eukaryotic, multicellular, have ways of moving to reproduce, obtain

More information

Learning Objectives. The Animal Kingdom: An Introduction to Animal Diversity. Sexual Reproduction

Learning Objectives. The Animal Kingdom: An Introduction to Animal Diversity. Sexual Reproduction Learning Objectives The Animal Kingdom: An Introduction to Animal Diversity Chapter 29 What characters are common to most animals? Advantages and disadvantages of different environments Searching for relationships

More information

Chapter 32. Objectives. Table of Contents. Characteristics. Characteristics, continued. Section 1 The Nature of Animals

Chapter 32. Objectives. Table of Contents. Characteristics. Characteristics, continued. Section 1 The Nature of Animals Introduction to Animals Table of Contents Objectives Identify four important characteristics of animals. List two kinds of tissues found only in animals. Explain how the first animals may have evolved

More information

An Overview of Animal Diversity

An Overview of Animal Diversity Figure 32.1 CAMPBELL BIOLOGY Figure 32.1a A Kingdom of Consumers TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson! Most animals are mobile and use traits such as strength, speed, toxins, or camouflage

More information

3. Choanoflagellates resemble what? What is the significance of this resemblance?

3. Choanoflagellates resemble what? What is the significance of this resemblance? I. Animal Diversity 1. What are some basic characteristics of the animal kingdom? What characteristics make them different from plants? - Eukaryotic, heterotrophic (we don t make our own food), we store

More information

A. Incorrect! Sponges are mostly marine animals. This is a feature of sponges.

A. Incorrect! Sponges are mostly marine animals. This is a feature of sponges. College Biology - Problem Drill 15: The Evolution of Animal Diversity Question No. 1 of 10 1. Which is not a feature of the phyla porifera- sponges? Question #01 (A) Most are marine animals. (B) They have

More information

Revision Based on Chapter 25 Grade 11

Revision Based on Chapter 25 Grade 11 Revision Based on Chapter 25 Grade 11 Biology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. A cell that contains a nucleus and membrane-bound organelles

More information

Biology 11. The Kingdom Animalia

Biology 11. The Kingdom Animalia Biology 11 The Kingdom Animalia Objectives By the end of the lesson you should be able to: Describe the 5 ways we classify animals Symmetry Germ layers Body plan Segmentation Animal Evolution Hank Video

More information

An Introduction to Animal Diversity

An Introduction to Animal Diversity Chapter 32 An Introduction to Animal Diversity Lecture Outline Overview: Welcome to Your Kingdom Biologists have identified 1.3 million living species of animals. Estimates of the total number of animal

More information

Introduction to Animal Kingdom. Invertebrates and Vertebrates

Introduction to Animal Kingdom. Invertebrates and Vertebrates Introduction to Animal Kingdom Invertebrates and Vertebrates Introduction To Animals Vertebrate animal with a backbone. Invertebrate animal without a backbone; includes more than 95% of all animal species

More information

Instructor Information!

Instructor Information! Instructor Information Dr. Anne Boettger Office: 610-430-4601 email: aboettger@wcupa.edu Schmucker North 475 Office hours: Monday 1-2 pm Tuesday/Thursday 9-11am otherwise by appointment All pertinent information

More information

Workshop: The Evolution of Animalia body symmetry embryonic germ layers ontogenetic origins I. What is an Animal? II. Germ Layers

Workshop: The Evolution of Animalia body symmetry embryonic germ layers ontogenetic origins I. What is an Animal? II. Germ Layers Workshop: The Evolution of Animalia by Dana Krempels Perhaps even more than the other Eukarya, Animalia is characterized by a distinct progression of complexity in form and function as one moves from the

More information

Biology 211 (1) Exam 2 Worksheet!

Biology 211 (1) Exam 2 Worksheet! Biology 211 (1) Exam 2 Worksheet Chapter 33 Introduction to Animal Diversity Kingdom Animalia: 1. Approximately how many different animal species are alive on Earth currently. How many those species have

More information

Features of the Animal

Features of the Animal Features of the Animal Kingdom Bởi: OpenStaxCollege Even though members of the animal kingdom are incredibly diverse, animals share common features that distinguish them from organisms in other kingdoms.

More information

Lecture XII Origin of Animals Dr. Kopeny

Lecture XII Origin of Animals Dr. Kopeny Delivered 2/20 and 2/22 Lecture XII Origin of Animals Dr. Kopeny Origin of Animals and Diversification of Body Plans Phylogeny of animals based on morphology Porifera Cnidaria Ctenophora Platyhelminthes

More information

Page 1. Skill: Knowledge/Comprehension. Skill: Application/Analysis. Skill: Knowledge/Comprehension

Page 1. Skill: Knowledge/Comprehension. Skill: Application/Analysis. Skill: Knowledge/Comprehension Chapter 32 An Introduction to Animal Diversity Multiple-Choice Questions 1) Which of the following terms or structures is properly associated only with animals? A) Hox genes B) cell wall C) autotrophy

More information

KINGDOM ANIMALIA CHARACTERISTICS

KINGDOM ANIMALIA CHARACTERISTICS KINGDOM ANIMALIA CHARACTERISTICS EUKARYOTIC MULTICELLULAR HETEROTROPHIC (by ingestion) MOVE AT SOME POINT IN LIFE (not all - sponges are sessile) DIGEST FOOD TO GET NUTRIENTS LACK CELL WALLS CHARACTERISTICS

More information

Chapter 8-9 Intro to Animals. Image from:

Chapter 8-9 Intro to Animals. Image from: Chapter 8-9 Intro to Animals Image from: http://animaldiversity.ummz.umich.edu/index.html Zoology Definition: the scientific study of the behavior, structure, physiology, classification, and distribution

More information

Introduction to Animals

Introduction to Animals Introduction to Animals Moving Forward Quizlet Each section we cover, 1 group will go to our class on Quizlet and create 20 flash cards on the topic (/5mks) If I warn you about talking while I m talking,

More information

Are these organisms. animals or not?

Are these organisms. animals or not? 1 2 3 4 5 Are these organisms 6 7 8 animals or not? 9 10 11 12 13 14 15 16 1 2 3 4 5 6 7 8 9 10 11 12 Typical Animal Characteristics Eukaryotic Multicellular Ability to move Reproduce Obtain food (heterotrophic)

More information

Chapter 32 Intro to Animals. Image from:

Chapter 32 Intro to Animals. Image from: Chapter 32 Intro to Animals Image from: http://animaldiversity.ummz.umich.edu/index.html Animals Invertebrates (animals without a backbone) Porifera Cnidaria Worms Mollusks Echinoderms Arthropods Animals

More information

What defines the zygote, the blastula, and the gastrula? Draw pictures.

What defines the zygote, the blastula, and the gastrula? Draw pictures. What makes a multicellular organism multicellular? a) Multiple cells b) Multiple cells that work together c) Specialized cells d) Multiple specialized cells that work together What defines the zygote,

More information

1/30/2009. Copyright The McGraw Hill Companies, Inc. Permission required for reproduction or display.

1/30/2009. Copyright The McGraw Hill Companies, Inc. Permission required for reproduction or display. CHAPTER 9 Architectural Pattern of an Animal New Designs for Living Zoologists recognize 34 major phyla of living multicellular animals Survivors of around 100 phyla that appeared 600 million years ago

More information

Workshop: The Evolution of Animalia body symmetry embryonic germ layers ontogenetic origins I. What is an Animal?

Workshop: The Evolution of Animalia body symmetry embryonic germ layers ontogenetic origins I. What is an Animal? Workshop: The Evolution of Animalia by Dana Krempels Perhaps even more than the other Eukarya, Animalia is characterized by a distinct progression of complexity in form and function as one moves from the

More information

Kingdom Animalia. Zoology the study of animals

Kingdom Animalia. Zoology the study of animals Kingdom Animalia Zoology the study of animals Summary Animals are multicellular and eukaryotic. consume and digest organic materials thereby being heterotrophs. Most are motile at some time in their lives.

More information

Introduction to Animals

Introduction to Animals Introduction to Animals Characteristics of Animals multicellular Except for sponges, animal cells are arranged into tissues. Tissues are necessary to produce organs and organ systems. Tissues, organs,

More information

Resources. Visual Concepts. Chapter Presentation. Copyright by Holt, Rinehart and Winston. All rights reserved.

Resources. Visual Concepts. Chapter Presentation. Copyright by Holt, Rinehart and Winston. All rights reserved. Chapter Presentation Visual Concepts Transparencies Standardized Test Prep Introduction to Animals Table of Contents Section 2 Animal Body Systems Objectives Identify the features that animals have in

More information

Animals. What are they? Where did they come from? What are their evolutionary novelties? What characterizes their diversification?

Animals. What are they? Where did they come from? What are their evolutionary novelties? What characterizes their diversification? Animals What are they? Where did they come from? What are their evolutionary novelties? What characterizes their diversification? What synapomorphies unite Animals Multicellular Heterotrophs (Metazoans)?

More information

If done properly, is based on evolutionary relationships (at least to some extent). Kingdom -> Phylum -> Class -> Order -> Family -> Genus -> species

If done properly, is based on evolutionary relationships (at least to some extent). Kingdom -> Phylum -> Class -> Order -> Family -> Genus -> species Taxonomy. (Your text makes a real mess of this. Use these notes as a guide through the book.) Study of classifying and naming organisms. Founded by Linnaeus. If done properly, is based on evolutionary

More information

Brief Introduction to the Animal Kingdom

Brief Introduction to the Animal Kingdom Brief Introduction to the Animal Kingdom Vocabulary Vertebrate Invertebrate Detritivore Asymmetry Bilateral symmetry Radial symmetry Cephalization Coelum Pseudocoelum Acoelomates Blastula Blastophore Protosome

More information

The Radiata-Bilateria split. Second branching in the evolutionary tree

The Radiata-Bilateria split. Second branching in the evolutionary tree The Radiata-Bilateria split Second branching in the evolutionary tree Two very important characteristics are used to distinguish between the second bifurcation of metazoans Body symmetry Germinal layers

More information

23.1 Animal Characteristics EQ Although diverse, what common characteristics do all animal share?

23.1 Animal Characteristics EQ Although diverse, what common characteristics do all animal share? 23.1 Animal Characteristics EQ Although diverse, what common characteristics do all animal share? Sea Slug 23.1 Animal Characteristics Animals are the most physically diverse kingdom of organisms and all

More information

Bacteria, Protists, Fungi, Plants, Animals: Phylogeny and Diversity

Bacteria, Protists, Fungi, Plants, Animals: Phylogeny and Diversity Bacteria, Protists, Fungi, Plants, Animals: Phylogeny and Diversity 1/8/2006 Phylogeny 2 1/8/2006 Phylogeny 3 Proteobacteria Chlamydias Spirochetes Cyanobacteria Gram positive bacteria Korarchaeotes Euryarchaeotes,

More information

Animal Diversity I: Porifera, Cnidaria, Ctenophora, Platyhelminthes, Rotifera, Annelida

Animal Diversity I: Porifera, Cnidaria, Ctenophora, Platyhelminthes, Rotifera, Annelida 1 Animal Diversity I: Porifera, Cnidaria, Ctenophora, Platyhelminthes, Rotifera, Annelida Objectives: Be able to distinguish radial symmetry from bilateral symmetry. Be able to identify which of the phyla

More information

Embryonic Development. Chapters 32-34: Animal Diversity AP Biology Fig Zygote Cleavage Blastocoel. Cleavage.

Embryonic Development. Chapters 32-34: Animal Diversity AP Biology Fig Zygote Cleavage Blastocoel. Cleavage. Chapters 32-34: Animal Diversity AP Biology 2012 1 Animal Characteristics Heterotrophs Multicellular Eukaryotes Cells lack cell walls Bodies held together by structural proteins like collagen Contain nervous

More information

31.1 What Evidence Indicates the Animals Are Monophyletic?

31.1 What Evidence Indicates the Animals Are Monophyletic? 31.1 What Evidence Indicates the Animals Are Monophyletic? What traits distinguish the animals from the other groups of organisms? In contrast to the Bacteria, Archaea, and most microbial eukaryotes, all

More information

BIO 170 General Biology I Spring 2014 Freeman Lecture Exam 1

BIO 170 General Biology I Spring 2014 Freeman Lecture Exam 1 BIO 170 General Biology I Spring 2014 Freeman Lecture Exam 1 Part A 1) This is part Aof the lecture exam. Please choose the answer a below: a. Choose this answer b. Do not choose this answer 2) How many

More information

Invertebrate Survey Lab

Invertebrate Survey Lab Answer these questions before lab. 1. What kingdom do all animals fall into? a. Protist b. Animalia c. Eukarya 2. How many phyla of invertebrates are in appendix E on pages 1074-1076? a. 9 b. 7 c. 8 3.

More information

BIO 221 Invertebrate Zoology I Spring Correction: Porifera. Lower Metazoan Clades: Choanoflagellata Porifera Placozoa Cnidaria Ctenophora

BIO 221 Invertebrate Zoology I Spring Correction: Porifera. Lower Metazoan Clades: Choanoflagellata Porifera Placozoa Cnidaria Ctenophora BIO 221 Invertebrate Zoology I Spring 2010 Stephen M. Shuster Northern Arizona University http://www4.nau.edu/isopod Lecture 6 Correction: Porifera a. Are distinct from the Placozoa by: 1. Have collar

More information

The Evolution of Animal Diversity. Dr. Stephen J. Salek Biology 130 Fayetteville State University

The Evolution of Animal Diversity. Dr. Stephen J. Salek Biology 130 Fayetteville State University The Evolution of Animal Diversity Dr. Stephen J. Salek Biology 130 Fayetteville State University Create your own animal? Start with a basic plant. Make the plant into a simple animal such as a worm. Consider:

More information

Eukaryote Phylogeny. Glycogen. Kingdom Animalia. Amoebozoa Animalia. Plantae. Chromalveolata Rhizaria. Fungi. Excavata

Eukaryote Phylogeny. Glycogen. Kingdom Animalia. Amoebozoa Animalia. Plantae. Chromalveolata Rhizaria. Fungi. Excavata Eukaryote Phylogeny most protozoans, brown algae, & water molds Excavata Chromalveolata Rhizaria Plantae Amoebozoa Animalia Fungi cpsts. w/ 2 memb. chitin, hyphae glycogen eukaryotic cells (nucleus, etc.)

More information

Chapter 32: An Introduction to Animal Diversity

Chapter 32: An Introduction to Animal Diversity Chapter 32: An Introduction to Animal Diversity Chapter 32: An Introduction to Animal Diversity Name Period Concept 32.1 Animals are multicellular, heterotrophic eukaryotes with tissues that develop from

More information

Questions in developmental biology. Differentiation Morphogenesis Growth/apoptosis Reproduction Evolution Environmental integration

Questions in developmental biology. Differentiation Morphogenesis Growth/apoptosis Reproduction Evolution Environmental integration Questions in developmental biology Differentiation Morphogenesis Growth/apoptosis Reproduction Evolution Environmental integration Representative cell types of a vertebrate zygote => embryo => adult differentiation

More information

Unit 10: Animals Guided Reading Questions (80 pts total)

Unit 10: Animals Guided Reading Questions (80 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 32 An Introduction to Animal Diversity 1. Define the following

More information

Overview of Animal Diversity

Overview of Animal Diversity Chapter 32 CHAPTER Overview of Animal Diversity Chapter Outline 32.1 Some General Features of Animals 32.2 Evolution of the Animal Body Plan 32.3 The Classification of Animals 32.4 The Roots of the Animal

More information

BIOS1101 Lab Notes. Contents ANIMALS. Lab 1: Animal Diversity invertebrates. Lab 2: Animal Diversity 2 vertebrates

BIOS1101 Lab Notes. Contents ANIMALS. Lab 1: Animal Diversity invertebrates. Lab 2: Animal Diversity 2 vertebrates Contents ANIMALS Lab 1: Animal Diversity invertebrates Lab 2: Animal Diversity 2 vertebrates Lab 3: Animal Structure 1 Gross morphology Lab 4: Animal Structure 2 Histology Lab 5: The Nervous System & Sensory

More information

INVERTEBRATE DIVERSITY

INVERTEBRATE DIVERSITY INVERTEBRATE DIVERSITY 1 INVERTEBRATES Animals that lack a backbone Invertebrates 2 1 ANIMAL DEVELOPMENT Meiosis Egg Sperm Zygote Adult Blastula hollow ball of cells in a developing animal Gastrula Stage

More information

OpenStax-CNX module: m Animal Phylogeny * OpenStax. Abstract. 1 Constructing an Animal Phylogenetic Tree

OpenStax-CNX module: m Animal Phylogeny * OpenStax. Abstract. 1 Constructing an Animal Phylogenetic Tree OpenStax-CNX module: m44658 1 Animal Phylogeny * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you will be able

More information

A mind is a fire to be kindled, not a vessel to be filled.

A mind is a fire to be kindled, not a vessel to be filled. A mind is a fire to be kindled, not a vessel to be filled. - Mestrius Plutarchus, or Plutarch, a leading thinker in the Golden Age of the Roman Empire (lived ~45 125 A.D.) Lecture 2 Distinction between

More information

The Animals, or Metazoa. Approximate proportions of animal species presently known; The true diversity of animals may be more than 90% Arthropods

The Animals, or Metazoa. Approximate proportions of animal species presently known; The true diversity of animals may be more than 90% Arthropods The Animals, or Metazoa Are some of the best-studied organisms Comprise over a million known species Originated c. the Cambrian (~550 MYA) Most animal phyla are marine; however, due to the diversity of

More information

Superphylum Deuterostomia

Superphylum Deuterostomia Superphylum Deuterostomia Bởi: OpenStaxCollege The phyla Echinodermata and Chordata (the phylum in which humans are placed) both belong to the superphylum Deuterostomia. Recall that protostome and deuterostomes

More information

Invertebrate Diversity

Invertebrate Diversity CHAPTER 23 Invertebrate Diversity Summary of Key Concepts Concept 23.1 Diverse animals share several key characteristics. (pp. 494 496) More than a million living species of animals are organized into

More information

Introduction to Animal Diversity. Chapter 23.1, 23.2 and additional

Introduction to Animal Diversity. Chapter 23.1, 23.2 and additional Introduction to Animal Diversity Chapter 23.1, 23.2 and additional 1 Think of an Animal... Does your choice have hair or fur? Does it have a skeleton? Over a million species of animals described 95% have

More information

Chapter 9. Benefits of Being Large. Levels of Organization in Organismal Complexity. Hierarchical Organization of Animal Complexity. Fig. 9.

Chapter 9. Benefits of Being Large. Levels of Organization in Organismal Complexity. Hierarchical Organization of Animal Complexity. Fig. 9. Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 9 Architectural Pattern of an Animal Levels of Organization in Organismal Complexity Zoologists recognize

More information

6 characteristics blastula

6 characteristics blastula Animals Characteristics The animal kingdom is divided into approximately 35 phyla with diverse species. However, all organisms in the animal kingdom share these 6 characteristics Eukaryotic Lack cell walls

More information

Physiological Evolution of Animals. Principles of Animal Physiology, 3e (Moyes/Schulte)

Physiological Evolution of Animals. Principles of Animal Physiology, 3e (Moyes/Schulte) Principles of Animal Physiology Canadian 3rd Edition Moyes TEST BANK Full download at: https://testbankreal.com/download/principles-of-animal-physiologycanadian-3rd-edition-moyes-test-bank/ Chapter 2 Physiological

More information

Number of Species. Taxonomy and Animal Phylogeny. Approx. 1.5 million species known. Taxonomy = Systematics = Phylogeny. Miller and Harley Chap.

Number of Species. Taxonomy and Animal Phylogeny. Approx. 1.5 million species known. Taxonomy = Systematics = Phylogeny. Miller and Harley Chap. Taxonomy and Animal Phylogeny Miller and Harley Chap. 7 Number of Species Approx. 1.5 million species known Taxonomy = Systematics = Phylogeny 1 Taxonomic Hierarchy Carolus Linnaeus (1707-1778) Kingdom

More information

Classification. The three-domains. The six-kingdom system. The traditional five-kingdom system. Bacteria Archaea Eukarya

Classification. The three-domains. The six-kingdom system. The traditional five-kingdom system. Bacteria Archaea Eukarya Classification The three-domains Bacteria Archaea Eukarya The six-kingdom system Bacteria Archaea Protista Plantae Fungi Animalia The traditional five-kingdom system Monera Protista Plantae Fungi Animalia

More information

Unit 10: Animals Guided Reading Questions (100 pts total)

Unit 10: Animals Guided Reading Questions (100 pts total) Name: AP Biology Biology, Campbell and Reece, 7th Edition Adapted from chapter reading guides originally created by Lynn Miriello Chapter 32 An Introduction to Animal Diversity 1. Define the following

More information

Comparative Anatomy Biology 440 Fall semester

Comparative Anatomy Biology 440 Fall semester Comparative Anatomy Biology 440 Fall semester TuTh 10:00 11:15 G23 Lab at 1:00 in 3106 or 3108 Comparative Anatomy Biology 440 Spring semester TuTh 11:30-12:45 G23 Lab at 2:00 in either 3108 or 3106 Dr.

More information

Lecture 5 Sex Determination and genes influenced by sex (7/08/17)

Lecture 5 Sex Determination and genes influenced by sex (7/08/17) Lecture 5 Sex Determination and genes influenced by sex (7/08/17) Antigen antibody reaction - Any molecule which induces an immune response is called an antigen (antibody generator) - Antibodies = immunoglobulins

More information

Number of Species. Taxonomy and Animal Phylogeny. Approx. 1.5 million species known. Taxonomy = Systematics = Phylogeny. Miller and Harley Chap.

Number of Species. Taxonomy and Animal Phylogeny. Approx. 1.5 million species known. Taxonomy = Systematics = Phylogeny. Miller and Harley Chap. Taxonomy and Animal Phylogeny Miller and Harley Chap. 7 Number of Species Approx. 1.5 million species known Taxonomy = Systematics = Phylogeny 1 Taxonomic Hierarchy Carolus Linnaeus (1707-1778) Kingdom

More information

BIOLOGY. An Introduction to Invertebrates CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson

BIOLOGY. An Introduction to Invertebrates CAMPBELL. Reece Urry Cain Wasserman Minorsky Jackson CAMPBELL BIOLOGY TENTH EDITION Reece Urry Cain Wasserman Minorsky Jackson 33 An Introduction to Invertebrates Lecture Presentation by Nicole Tunbridge and Kathleen Fitzpatrick Figure 33.UN08 Metazoa Eumetazoa

More information

Biology 1030 Winter 2009

Biology 1030 Winter 2009 Animal Diversity Chapters 32, 33 and 34 (select pages) Living Organisms Three Domains of life Bacteria Archaea Eukarya True nucleus True organelles Heterotrophic Animals Fungi Protists Autotrophic Plants

More information

A Brief Survey of Life s Diversity 1

A Brief Survey of Life s Diversity 1 Name A Brief Survey of Life s Diversity 1 AP WINTER BREAK ASSIGNMENT (CH 25-34). Complete the questions using the chapters of your textbook Campbell s Biology (8 th edition). CHAPTER 25: The History of

More information

Biology 340 Comparative Embryology Lecture 4 Dr. Stuart Sumida. Overview of Pre-Metazoan. and Protostome Development (Insects)

Biology 340 Comparative Embryology Lecture 4 Dr. Stuart Sumida. Overview of Pre-Metazoan. and Protostome Development (Insects) Biology 340 Comparative Embryology Lecture 4 Dr. Stuart Sumida Overview of Pre-Metazoan and Protostome Development (Insects) Plants Fungi Animals In1998 fossilized animal embryos were reported from the

More information

LEARNING OBJECTIVES FOR BY 124 EXAM II. 1. List characteristics that distinguish fungi from organisms in other kingdoms.

LEARNING OBJECTIVES FOR BY 124 EXAM II. 1. List characteristics that distinguish fungi from organisms in other kingdoms. LEARNING OBJECTIVES FOR BY 124 EXAM II CHAPTER 31 1. List characteristics that distinguish fungi from organisms in other kingdoms. 2. Explain how fungi obtain their nutrients. 3. Describe the basic body

More information

INTRODUCTION TO ANIMALS

INTRODUCTION TO ANIMALS CHAPTER 32 INTRODUCTION TO ANIMALS The diversity of animal life is staggering. Animals have adapted to Earth s lushest environments and to its harshest environments. This Sally Lightfoot crab, Grapsus

More information

CHAPTER 32 INTRODUCTION TO ANIMAL EVOLUTION. Section A: What is an animal?

CHAPTER 32 INTRODUCTION TO ANIMAL EVOLUTION. Section A: What is an animal? CHAPTER 32 INTRODUCTION TO ANIMAL EVOLUTION Section A: What is an animal? 1. Structure, nutrition, and life history define animals 2. The animal kingdom probably evolved from a colonial, flagellated protist

More information

Number of Species. Taxonomic Hierarchy. Representing the Groups. Binomial Nomenclature. Taxonomy and Animal Phylogeny. Carolus Linnaeus ( )

Number of Species. Taxonomic Hierarchy. Representing the Groups. Binomial Nomenclature. Taxonomy and Animal Phylogeny. Carolus Linnaeus ( ) Taxonomy and Animal Phylogeny Number of Species Approx. 1.5 million species known Miller and Harley Chap. 7 Taxonomy = Systematics = Phylogeny Taxonomic Hierarchy Carolus Linnaeus (1707-1778) Kingdom Phylum

More information

Survey of the Phyla- Animalia, Invertebrates

Survey of the Phyla- Animalia, Invertebrates Survey of the Phyla- Animalia, Invertebrates The Kingdom Animalia is in the domain Eukarya and in the supergroup Unikonta. They are in the group Opisthkonta with fungi. Both groups have different unicellular

More information

Lecture V Eukaryotes and the Cambrian Explosion.

Lecture V Eukaryotes and the Cambrian Explosion. Lecture V Eukaryotes and the Cambrian Explosion. I. Early Metabolisms. 1. Heterotrophs: Anaerobic; aerobic; 2. Autotrophs: Anoxic; oxygenic. Some Metabolic Pathways Heterotrophy Pathway Energy Source Initial

More information

What is an animal? Introduction to Animals. Germ Layers. Tissues and Organs. Structural Support. Types of Symmetry 11/3/2015

What is an animal? Introduction to Animals. Germ Layers. Tissues and Organs. Structural Support. Types of Symmetry 11/3/2015 What is an animal? Introduction to Animals Multicellular chemoorganoheterotrophs Eukaryotes that lack cell walls and chloroplasts Have mitochondria Are motile at some point in their lives Contain collagen

More information

Of all the kingdoms of organisms, the animal kingdom is the

Of all the kingdoms of organisms, the animal kingdom is the 26 1 Introduction to the Animal Kingdom Of all the kingdoms of organisms, the animal kingdom is the most diverse in appearance. Some animals are so small that they live on or inside the bodies of other

More information

Chapter 24 Introduction to Animals

Chapter 24 Introduction to Animals 1 Chapter 24 Introduction to Animals I. Animal characteristics A. General Animal Features Multicellular B. Feeding and Digestion a. acquire nutrients from various sources obtaining nutrients unique to

More information

THE EVOLUTION OF METAZOAN AXIAL PROPERTIES

THE EVOLUTION OF METAZOAN AXIAL PROPERTIES THE EVOLUTION OF METAZOAN AXIAL PROPERTIES Mark Q. Martindale Abstract Renewed interest in the developmental basis of organismal complexity, and the emergence of new molecular tools, is improving our ability

More information

Animal Diversity I: Porifera, Cnidaria, Ctenophora, Platyhelminthes, and Lophotrochozoa

Animal Diversity I: Porifera, Cnidaria, Ctenophora, Platyhelminthes, and Lophotrochozoa 1 Animal Diversity I: Porifera, Cnidaria, Ctenophora, Platyhelminthes, and Lophotrochozoa Objectives: Be able to distinguish radial symmetry from bilateral symmetry. Be able to identify which of the phyla

More information

Natural Sciences 360 Legacy of Life Lecture 07 Dr. Stuart S. Sumida ANIMALIA. (More Similar to Fungi than Plants)

Natural Sciences 360 Legacy of Life Lecture 07 Dr. Stuart S. Sumida ANIMALIA. (More Similar to Fungi than Plants) Natural Sciences 360 Legacy of Life Lecture 07 Dr. Stuart S. Sumida ANIMALIA (More Similar to Fungi than Plants) ANIMAL SIMILARITIES PLANTS FUNGI Cell Walls - Immobile - Often need - substrate - Heterotrophs

More information

Proterozoic Eon. BIO1130 Organismal Biology. Page 1. Phanerozoic Paleozoic era. Phanerozoic. Paleozoic era. Major Era

Proterozoic Eon. BIO1130 Organismal Biology. Page 1. Phanerozoic Paleozoic era. Phanerozoic. Paleozoic era. Major Era Phanerozoic Paleozoic era 1 Geological time scale and building height ( 1floor 60Ma, 72 floors, 12 feet/floor) Major Era Phanerozoic Cenozoic (65 Ma to present time, 72 nd floor) Mesozoic (245-65 Ma, 65

More information